Establishment of an immortalized stromal cell line derived from human Endometriotic lesion

Background: Endometriosis is a benign gynecological disease with obviously feature of estrogen-dependence and inflammatory response. The applications of primary endometriotic stromal cells in research of endometriosis are restricted for short life span, dedifferentiation of hormone and cytokine responsiveness. The objective of this study was to establish and characterize immortalized human endometriotic stromal cells (ihESCs).

The endometriotic samples were from a patient with ovarian endometriosis and the primary endometriotic stromal cells were isolated from the endometriotic tissues.The primary cells were infected by lentivirus to establish telomerase reverse transcriptase (hTERT)-induced immortalized cells. Quantification of mRNA and proteins was examined by quantitative real-time polymerase chain reaction (qRT-PCR) and Western Blot. CCK-8 assay and EdU labeling assay were assigned to assess the growth of ihESCs. Karyotype assaywas performed to detect the chromosomes of ihESCs. Colony formation assay and nude mouse tumorigenicity assay were usedto evaluate colony-formation and tumorigenesis abilities. Results:ihESCs continuously overexpressed hTERT via infection of lentivirus and significant extended the life span reaching 31 passages. The morphology, proliferation and karyotype of ihESCs remained unchanged. The expression of epithelial- mesenchymal transition (EMT) markers, estrogen-metabolizing proteins and estrogen/progesterone receptors (ERs and PRs) were unaltered. Furthermore, the treatment of estrogen increased the proliferation and EMT of ihESCs. Lipopolysaccharides (LPS) and IL-1β remarkably induced inflammatory response. The clonogenesis ability of ihESCs was consistent with primary cells, which were much lower than Ishikawa cells. In addition,nude mouse tumorigenicity assay demonstrated that ihESCs were unable to trigger tumor formation. Conclusion:This study established and characterized an immortalizedendometriotic stromal cellline that exhibited longer life span and kept the cellular morphology and physiological function as the primary cells. The immortalized cells remained normal feedback to estrogen and inflammatory response. Moreover, the immortalized cells were not available with tumorigenic ability. Therefore, ihESCs would be serviceable as in vitro cell tool to investigate the pathogenesis of endometriosis. Keywords:Immortalized, Endometriotic stromal cells, Estrogen, Inflammation, Tumorigenicity © The Author(s). 2020 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver ( http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data. * Correspondence: [email protected]; [email protected] †Zhi-Xiong Huang and Rong-Feng Wu contributed equally to this work. 3The Key Laboratory of Research and Diagnosis of Gynecological Diseases of Xiamen City and Department of Obstetrics and Gynecology, the First Affiliated Hospital of Xiamen University, Xiamen 361003, China 1School of Life Sciences, Xiamen University, Xiamen 361102, China Full list of author information is available at the end of the article Huang et al. Reproductive Biology and Endocrinology (2020) 18:119 https://doi.org/10.1186/s12958-020-00669-x

Endometriosis, a frequent gynecology disease of reproductive-aged female, is defined that the endometrium is present outside of the uterus location [ 1, 2]. The estimated 10% of women within childbearing age may suffer from endometriosis [3, 4]. And appearance of endometriosis gen- erally accompanied by chronic pelvic pain, dysmenorrhea, se- vere dyspareunia, and even infertility [ 5–7]. It is approximated that 47% of infertile women have endometri- osis [8]. Moreover, the high recurrence rate of endometriosis r e q u i r e dt h r e eo rm o r es u r g e r i e s[9, 10]. Therefore, endo- metriosis negative impacts on the large number of women patients and indirectly on healthcare systems and society. Although many factors repor ted were closely associated with incidence of endometriosis, the etiology of this disease is still unknown. Of all pathogenic theories about endomet- riosis occurrence, hypothesis of retrograde menstruation is the most recognized version, in which retrograde menstru- ation of endometrial tissue slough through patent fallopian tubes into the peritoneal cavity and then adhere, invade and proliferate in ectopic locations [2]. These processes are concerned with background of family heredity, hormone response, and immunological factors [11–13]. Endometriosis is reputed as estrogen and inflammation- dependent disease [14, 15]. It was reported that the increased level of aromatase in eutopic endometrial tissues allowed the implantation of ectopic tissues on peritoneal surfaces [ 16]. Capellino et all claimed that est rogen, via its functional re- ceptors, modulated macrophages to regulate the immune response [17]. And Han et al. found that ER β inhibited T N F - a l p h a - i n d u c e da p o p t o s i sa n dp r o m o t e di n f l a m m a t i o n by increasing IL-1β to enhance cellular adhesion and prolif- eration of ectopic endometriotic tissues [ 18]. Thus, the stimulation of estrogen and inflammation are mutually bene- ficial during establishment of endometriotic lesions. For investigations on the molecular mechanisms of endo- metriosis, cultured human primary endometriotic cells are de- sirable in vitro tools. However, the applicability of primary endometriotic cells is largely restricted by dedifferentiation during cell culture, including loss of hormone and cytokine re- sponsiveness, and short life span. The subjective of this study was to establish and characterize an hTERT-induced immor- talized endometriotic stomal cell line (ihESCs), which kept pri- mary morphology and proliferation. The expression of EMT markers, estrogen synthetase and estrogen/progesterone re- ceptors in ihESCs remained unchanged. Moreover, ihESCs contained normal number of chromosomes and were con- firmed not maligned transformed by tumorgenicity assay.

Reagents DMEM/F12 medium (#SH30023.01) was from Hyclone (Shanghai, China) and fetal bovine serum (FBS; #04 –001- 1A) was bought from Biological Industries (BI; Cromwell, CT, USA). 17β-estradiol/estrogen/E2 (#E2758) and lipopoly- saccharides (LPS; #L4391) were from Sigma-Aldrich (Shang- hai, China). Recombinant Human IL-1 β (#C600002) was bought from Sangon Biotech (Shanghai, China). GAPDH mouse monoclonal antibody (#40493) was procured from ABclonal (Boston, USA). Cytokeratin 18 antibodies (#4548), E-cadherin antibodies (#14472), Vimentin antibodies (#5741), N-cadherin antibodies (#13116), Progesterone Re- ceptor (PR) antibodies (#8757S), and ER α antibodies (#13258) were acquired from Cell Signaling Technology (Danvers, MA, USA). HSD17B1 antibodies (#ab51045), TERT antibodies (#ab32020), ER β antibodies (#ab288), COX-2 antibodies (#ab151 91) and CYP17A1 antibodies (#ab125022) were purchased from Abcam (Cambridge, UK). Patients and primary cells culture Endometriotic tissues were collected in Department of Obstetrics and Gynecology in the First Affiliated Hos- pital of Xiamen University. The application of samples received permission from the ethics committee and all patients signed the informed consent. Endometriotic le- sions were from a 35-year-old female suffered from ovarian endometriosis confirmed by laparoscopy and histopathology. This endometriosis patient had regular menstrual cycles and was without hormone treatment for more 3 months before the surgery. The endometriotic samples were minced and digested by collagenase IV (#A004186 –0001; Sangon Biotech; Shanghai, China) and deoxyribonuclease I (DNase I; #B002004–0005; Sangon Biotech; Shanghai, China). After being filtered through nylon cell-strainers with a 100 mesh which intercepted pieces of tissue, and then through a mesh size of 400 which blocked the epithelial glands cells and passed through the stromal cells. The epithelial and stromal cells were respectively cultured within DMEM/F12 medium containing 10% FBS in dishes at 10% CO 2 37 °C incubation. Establishment of ihESCs hTERT, human telomerase reverse transcriptase, activates telomerase activity which maintains telomere length and ex- tends cell lifespan [19]. hTERT coding regions were cloned and inserted into CV186 vector (GeneChem; Shanghai, China) and then mixed with le ntivirus packing plasmids (VSVG/PMDL/REV). The mixture of plasmids was trans- fected into 293 T cells by Lipofectamine 3000 (#L3000015; ThermoFisher; Shanghai, China) to generate lentivirus. The primary endometriotic stromal cells were cocultured with viral supernatants for 24 h to generate infected cells. Drugs treatment 5×1 0 5 cells were plated into 60 cm dishes in DMEM/F12 medium without phenol red. After 24 h culture to remove endogenous hormones, 200 nM estrogen, 100 μg/ml LPS Huang et al. Reproductive Biology and Endocrinology (2020) 18:119 Page 2 of 9 or 10 μg/ml IL-1 β were respectively diluted in DMEM/ F12 medium with 10% charcoal-treated FBS (#04 –201-1A; Cromwell, CT, USA) and exposed to cells for 48 h. RNA extraction and qRT-PCR The lysis of cells was performed by RNAiso Plus (#9108; Takala Biotechnology; Kyoto, Japan) and total RNA was ex- tracted by chloroform and isopropyl alcohol. The synthesis of cDNA was by using PrimeScript RT reagent kit (#RR047A; Takara). PCR reaction was executed by the SYBR Premix Ex Taq II (#RR820A, Takala) in Lightcycler 480 (Roche; Basel, Switzerland). The results were normalized based on GAPDH expression and calculated by the 2 -△△CT method. All primer sequences were listed in Table1. Western blot assay Total proteins were harvested by RIPA lysis buffer with protease inhibitors. SDS-PAGE was assumed to separate proteins of different molecule mass which then were transferred onto PVDF membranes (#IPVH00010; Merck; Germany). The PVDF membranes were incubated within primary antibodies for overnight at 4 °C. After cleaned by PBS, the PVDF membranes were then immersed in corre- sponding secondary antibody. The dilution rates of antibodies were hTERT (1:1000), Cytokeratin 18 (1:1000), E-cadherin (1:500), Vimentin (1:1000), N-cadherin (1: 1000), COX-2 (1:1000), HSD17B1 (1:500), CYP17A1 (1: 1000), ERα (1:1000), ERβ (1:500), PR (1:1000), GAPDH (1: 10000), and secondary antibody (1:10000). The signal was finally visualized by an enhanced chemiluminescence (ECL; # NCI4106; Pierce, Waltham, MA, USA). Observation of cell ultrastructure At o t a lo f1 × 1 0 5 cells were planted into 35 cm dishes which of bottom were polylysine-coated cover slides. After 24 h till all cells attached to the slides, 2.5% glutaraldehyde and 1% osmic acid were employed to fix the cells. After dehydrated with gradient ethanol, the slides were immersed in tert-butanol overnight at 4 °C. And the slides were freeze-dried and then sprayed with gold. The images of cell ultrastructure were observed and photographed by Scanning Electron Microscope (#JSM-6390LV; Japan Elec- tron Optics Laboratory; Tokyo, Japan). Cell proliferation assay To analyze the proliferation of cells, Cell Counting Kit-8 (#HY-K0301; MedChemExpress; Shanghai, China) was used to quantify the growth rate. 5 × 10 3 cells were planked into 96-well plates and treated with 200 nM es- trogen. CCK-8 was added into each well and reacted in 37 °C incubator for 2 h every 24 h. The absorbance of su- pernatants was measured by an ELISA reader spectro- photometer (Dynatech Laboratories, Chantilly, VA). EdU labeling assay According to the instructions of EdU assay kit (#C0071S; Beyotime Biotechnology, Shanghai, China), 1×1 0 5 ihESCs were seeded into 6-well plates and treated with 200 nM estrogen for 48 h. The treated cells were incubated with 10 μME d Us o l u t i o nf o r3 h . After fixed and permeabilized, the cells were cultured in click sdditive solution for 30 min. Finally, Hoechst 33342 solution was employed to stain the cell nu- cleus. The results were observed and captured using the fluorescence microsco pe (Olympus Corporation, Tokyo, Japan). Karyotype analysis 1×1 0 6 cells were planted into in a 10 cm dish with DMEM/F12 medium containing 10% FBS for 48 h. After incubated with 0.2 μg/ml colchicine (#HY-16569; MCE; Shanghai, China) for 2 h, the cells were treated with low osmotic pressure for 20 min and then fixed by fixative solution (methanol: acetic acid =3:1). The fixed cells were added to the slide and stained by Giemsa. The im- ages of chromosomes observed and captured by micro- scope were clipped and sorted by Photoshop soft. Immunocytochemistry (ICC) Primary cells and ihESCs were planked on 6-well plates and cultured to 100% confluence. The cells were fixed by cold methanol and permeated by 0.3% Triton-X. After incubated with 5% bovine serum albumin (BSA) for 1 h, the cells were covered within primary antibody overnight. The immunocomplexes were incubated with corresponding secondary antibody for 1 h at room temperature. DAB Color Development Kit (#AR1022; Boster Biological Technology, Wuhan, China) was used to stain the immunocomplexes. The results of immuno- staining were captured using the microscope (Olympus Corporation, Tokyo, Japan). Table 1 Primer sequences used in qRT-PCR analysis Gene Name Sequences (5 ′-3′) GAPDH Forward: GGAAGGTGAAGGTCGGAGTCA Reverse: GAGTCCTTCCACGATACCAA hTERT Forward: CGGCCTATTCCCCTGGT Reverse: ATGTTCCTCCCAGCCTTGA IL-1β Forward: ATGATGGCTTATTACAGTGGCAA Reverse: GTCGGAGATTCGTAGCTGGA IL-6 Forward: ACTCACCTCTTCAGAACGAATTG Reverse: CCATCTTTGGAAGGTTCAGGTTG IL-10 Forward: TCAAGGCGCATGTGAACTCC Reverse: GATGTCAAACTCACTCATGGCT MCP-1 Forward: AGTGTCCCAAAGAAGCTGTGA Reverse: CCTGAACCCACTTCTGCTTG Huang et al. Reproductive Biology and Endocrinology (2020) 18:119 Page 3 of 9 Colony formation assay A total of 1 × 10 3 primary cells, ihESCs or Ishikawa cells were evenly planked in 6 cm dishes with DMEM/F12 containing 10% FBS. After cultured for 7 days, the col- onies of cells were wash with PBS and fixed by 4% para- formaldehyde for 10 min. 0.1% crystal violet (#E607309; Sangon Biotech; Shanghai, China) was applied to stain the cells for 15 min. The colonies were photographed and counted visually. Xenograft The acquisition of female BALB/c nude mice (5–8w e e k so l d and 15–20 g) and operation were relied on Animal Research Laboratory of Xiamen University. The ethics of animal ex- periment was strictly followed in the course of experiments. The mice were acclimatized for a week before processing. The mice were divided into 3 groups and each group con- tained 3 mice. The primary ESCs, ihESCs and Ishikawa cells were subcutaneously injected into the right dorsal of the mice (1 × 107 cells/mouse) according to grouping. The mice were monitored for enough tumor growth. After 2 months, the mice were sacrificed and photographed.

Establishment of hTERT-induced immortalized endometriotic stromal cells by infection of lentivirus Lentivirus was employed to increase the hTERT expres- sion of primary endometriotic stromal cells. As shown in Fig. 1a, the red fluorescence protein (RFP), as a molecular tracer, was stably expressed in ihESCs of 5, 15 and 25 pas- sages. Further investigations were employed to detected the expression of hTERT in ihESCs from different pas- sages. In Fig. 1b and c, both mRNA and proteins of hTERT in ihESCs were significant increased compared with primary cells. Furthermore, there was not obvious cell morphological change between ihESCs and primary stromal cells observed by optical microscope (Fig. 1d upper) and scanning electron microscope (Fig. 1d lower). Fig. 1 Establishment of immortalized human endometriotic stomal cells (ihESCs) by lentivirus transfection of hTERT. a The observation of red fluorescent from infected cells to estimate infection efficiency. b The expression of hTERT mRNA in ihESCs of 5, 15 and 25 passages. c hTERT protein level of ihESCs from various passages detected by Western Blot. d The morphology of ihESCs observed by using Optical Microscope (upper) and Scanning Electron Microscope (lower). e The life span of primary cells and ihESCs. Data represent the mean ± SEM. **P < .001, ***P < .0001 Huang et al. Reproductive Biology and Endocrinology (2020) 18:119 Page 4 of 9 To record life span of ihESCs and primary cells, the results of continuous cell cultivation exhibited that the life span of ihESCs which reached 31 passages much longer than that of primary cells which is 14 passages (Fig. 1e). The cell physiology of ihESCs keeps unchanged compared with primary cells To further explore whether the cell physiology of ihESCs was changed, the proliferation and different marker proteins were detected. As in Fig. 2a, the pro- liferative activity of ihESCs extraordinary resembled primary cells. The expression of epithelial- mesenchymal transition (EMT) markers in ihESCs was consistent with primary cells (Fig. 2b). Further- more, the estrogen-metabolizing proteins, including COX-2, HSD17B1 and CYP17A1, kept similar with primary cells. The expression of ERs and PRs were original level as well (Fig. 2c). Further, ihESCs maintain high expression of Vimentin and low expression of Cyto- keratin 18, which suggested the mesenchymal cell charac- teristics of ihESCs were tenacious (Fig. 2d). To further examine the chromosomes of ihESCs, karyotype analysis was performed. As in Fig. 2e, ihESCs presented normal number of 23 pairs chromosomes. Normal estrogen response is kept in ihESCs To demonstrate the response of ihESCs to estrogen stimulation, 200 nM estrogen was used to treat ihESCs. As shown in Fig. 3a, the treatment of estro- gen significant promoted the proliferation of ihESCs. And stimulation of estrogen to ihESCs increased the number of EdU-labeled cells, which suggested estro- gen could enhance cell division of ihESCs (Fig. 3b and c). Furthermore, estrogen reduced the expression of Cytokeratin 18 and E-cadherin proteins, but en- hanced the level of mesenchymal marker proteins Fig. 2 The phenotypes and marker proteins of ihESCs kept unchanged compared with primary stromal cells. a The growth curve of ihESCs and primary stromal cells detected by CCK-8 assays. b The protein expression of epithelial-mesenchymal transition from primary stomal cells and ihESCs. c The level of estrogen-metabolizing proteins and estrogen/progesterone receptors proteins in primary cell and ihESCs. d Identification of epithelial and mesenchymal cells assessed by immunocytochemistry (ICC). e Chromosome karyotype analysis of ihESCs and sorting result (right) Huang et al. Reproductive Biology and Endocrinology (2020) 18:119 Page 5 of 9 (Fig. 3d ) .T h u s ,e s t r o g e np r o m o t e dt h ep r o l i f e r a t i o n and EMT of ihESCs, which suggested ihESCs kept normal response to estrogen. Inflammatory response is detected in ihESCs To verify inflammatory response of ihESCs, 100 ng/ml LPS and 10 ng/ml IL-1 β were employed to induced Fig. 3 Normal estrogen response and inflammation are found in ihESCs. a The proliferation of ihESCs with stimulation of estrogen. b EdU-labeled assay employed to monitor cell division of ihESCs treated with estrogen. c Quantified analysis of EdU assays. d The protein expression of EMT markers from ihESCs with treatment of estrogen. The mRNA ( e) and protein ( f) expression of inflammatory factor in ihESCs with stimulation of LPS. The mRNA ( g) and proteins ( h) of inflammatory factor from ihESCs treated with IL-1 β. Data represent the mean ± SEM. * P < .05, **P < .001, ***P < .0001 Huang et al. Reproductive Biology and Endocrinology (2020) 18:119 Page 6 of 9 inflammation respectively. As the results of Fig. 3e and f, LPS remarkably promoted the expression of IL-1 β, IL-6, IL-10 and MCP-1. And the mRNA and proteins of these inflammatory factors were significant increased with treatment of IL-1 β (Fig. 3g and h). Therefore, the normal inflammatory response was retained in ihESCs. ihESCs are not available with tumorigenic ability To identify whether ihESCs were malignant transform- ation, colony formation assay and nude mouse tumorigen- icity assay were performed. As shown in Fig. 4a, the clonogenesis ability of ihESCs was as weak as primary cells which much lower than endometrial cancer Ishikawa cells. Moreover, different from Ishikawa cells which induced formation of tumors, both ihESCs and primary stromal cells were incapable of triggering occurrence of tumors (Fig. 4b). Consequently, ihESCs kept characteristics of pri- mary cells and were not malignant transformed. Discussions This study established immortalized human endometrio- tic stromal cells (ihESCs) by overexpressing hTERT. The lifespan of immortalized cells was beyond 30 passages which much longer than primary cells. The morphology and proliferation of ihESCs remained original. The ex- pression of EMT markers, estrogen-metabolizing proteins and estrogen/progestogen receptors in ihESCs were unchanged from the primary cells. The chromo- some karyotype of ihESCs retained normal. The normal feedback of estrogen and inflammation response were observed in ihESCs. Furthermore, ihESCs were not ma- lignant transformed to trigger the formation of tumors. Thus, we established an immortalized endometriotic stromal cells with stable characteristics and function, which might be a practical cellular tool. According to abundant reports about high-throughput sequencing of endometriosis, thousands of genes aber- rant expressed in endometriosis were found [ 20–22]. Compared with normal and eutopic endometria, endo- metriotic lesions were remarkably mutative including change of inflammation response [ 13, 23], hormone dys- regulation [ 14], disordered proliferation and apoptosis [24, 25], promoted angiogenesis [ 26] and EMT [ 27]. Therefore, endometriotic cells are much more appreciate model cells in the mechanism research of endometriosis. To establish model cells with stabled characteristics and long lifespan is considerable significance for practical ap- plication. Thus, establishment of immortalized endome- triotic cells could be an effective method to supply the cell tool for research. The immortalized cell ihESCs estab- lished in this study remained unchanged morphology, proliferation and EMT markers, which indicated that the Fig. 4 ihESCs are not malignant transformed to trigger tumors. a Colony formation assay used to assess the oncogenic potential of ihESCs. b Nude mouse tumorigenicity assay performed to evaluate tumorigenic capacity of ihESCs Huang et al. Reproductive Biology and Endocrinology (2020) 18:119 Page 7 of 9 process of immortalization did not affect the growth and type of cells. On the other hands, it was well recognized that estrogen was greatly increased in endometriotic le- sions compared with normal and eutopic endometria [ 14]. And significantly increased estrogen synthases are closely associated with recurrence of endometriosis [ 28–30]. Our

manifested that these estrogen synthases including COX-2, HSD17B1 and CYP17A1 kept consistent with pri- mary cells. Furthermore, the expression of estrogen/pro- gestogen receptors were not changed, which implied that the functional approaches of estrogen and progestogen re- main complete. Moreover, the immortalized cells main- tained normal number of chromosomes suggesting the genes were not obviously changed with the influence of immortalization. Therefore, these results demonstrated that ihESCs kept morphology and genes characteristics as the primary endometrial stromal cells. Endometriosis is recognized as estrogen-dependent and inflammatory disorder [ 29, 30]. Estrogen stimulated the proliferation of endometriotic cells predominantly via its nuclear receptors [31]. And our previous study found that estrogen markedly promoted EMT [ 32]. In this study, the proliferation and EMT of ihESCs were obviously pro- moted with stimulation of estrogen, which suggested the original ability responding to estrogen of primary cell remained in ihESCs. Additionally, the treatment of LPS and IL-1 β could trigger obvious inflammation of ihESCs, which demonstrated that inflammatory response was present in ihESCs. Consequently, ihESCs suffice for the usage of research about the effect and mechanisms of es- trogen and inflammation on endometriosis. A previous study analyzed numerous genes expression associated with estrogen/progesterone biosynthesis and signaling, cell cycle regulation, and cytokine production from different immortalized human endometriotic epi- thelial cells and stromal cells [ 33]. Mariarosaria et all established immortalized endometriotic epithelial and stromal cells by retroviral transfection of hTERT, which kept the primary characteristics of phenotype and ex- pression of estrogen and progesterone receptors [ 34]. However, the change of cell morphology, physiology and malignant transformation were lack of identification in these immortalized cells. To evaluate comprehensively our immortalized cell, the cell morphology, proliferation, EMT markers and different cell physiology were moni- tored unchanged. Moreover, the karyotype analysis and tumor formation experiment demonstrated that ihESCs were not malignant transformed and could be reliable model cells. In conclusion, this study established immor- talized endometriotic stromal cells, and characterized that these cells kept much longer lifespan, primary physiological characteristics and were not malignant transformed. Thus, ihESCs are potentially useful as an experimental model to demonstrate endometriosis. Abbreviations ihESCs: Immortalized human endometriotic stromal cells (ihESCs); hTERT: Human telomerase reverse transcriptase; qRT-PCR: Quantitative real- time polymerase chain reaction; EMT: Epithelial-mesenchymal transition; LPS: Lipopolysaccharide; E2: Estrogen Acknowledgments Deep appreciations to Dr. Qian-Sheng Huang and Wei-Dong Zhou for many valuable comments and excellent technical assistance in this study. Authors’ contributions Zhi-Xiong Huang and Rong-Feng Wu completed the experiments and fin- ished the manuscript. Xiao-Mei Mao and Shao-Min Huang undertook primary cell culture and clinical samples collection. Tian-Tian Liu analyzed the data and revised the manuscript. Qing-Xi Chen and Qiong-Hua Chen conceived the study, provided financial support, and revised the manuscript. All authors read and approved the final manuscript. Funding This research was financial supported by the National Science Foundation of China (No. 81871145 and 81701419) and the Science and Technology Planning Project of Xiamen City (No. 2018S2326). Availability of data and materials All data in this study are included in this published article. Ethics approval and consent to participate All use of samples got consent from the participant and was approved by the First Affiliated Hospital of Xiamen University. Competing interests All authors announced there were no potential conflicts of interest in this article. Author details 1School of Life Sciences, Xiamen University, Xiamen 361102, China. 2Reproductive Medical Center, The First Affiliated Hospital of Xiamen University, Xiamen, China. 3The Key Laboratory of Research and Diagnosis of Gynecological Diseases of Xiamen City and Department of Obstetrics and Gynecology, the First Affiliated Hospital of Xiamen University, Xiamen 361003, China. Received: 12 June 2020 Accepted: 6 November 2020

1. Peiris AN, Chaljub E, Medlock D. Endometriosis. Jama. 2018;320:2608. 2. Vercellini P, Somigliana E, Fedele L. Endometriosis: pathogenesis and treatment. Nat Rev Endocrinol. 2014;10:261 –75. 3. Giudice LC, Kao LC. Endometriosis. Lancet. 2004;364:1789 –99. 4. de Ziegler D, Borghese B, Chapron C. Endometriosis and infertility: pathophysiology and management. Lancet. 2010;376:730 –8. 5. Culley L, et al. The social and psychological impact of endometriosis on women's lives: a critical narrative review. Hum Reprod Update. 2013;19:625–39. 6. Mehedintu C, et al. Endometriosis-related inflammation and fertility. Eur J Clin Investig. 2016;46:51.. 7. Lin YH, et al. Chronic Niche Inflammation in Endometriosis-Associated Infertility: Current Understanding and Future Therapeutic Strategies. Int J Mol Sci. 2018;19. 8. Meuleman C, et al. High prevalence of endometriosis in infertile women with normal ovulation and normospermic partners. Fertil Steril. 2009;92:68–74. 9. Bulletti C, et al. Vaginal parturition decreases recurrence of endometriosis. Fertil Steril. 2010;94:850 –5. 10. Bozdag G. Recurrence of endometriosis: risk factors, mechanisms and biomarkers. Womens Health. 2015;11:693 –9. 11. Bai H, et al. Establishment and characterization of immortalized bovine endometrial epithelial cells. Animal Sci J = Nihon chikusan Gakkaiho. 2014; 85:799–804. 12. Reis FM, Petraglia F, Taylor RN. Endometriosis: hormone regulation and clinical consequences of chemotaxis and apoptosis. Hum Reprod Update. 2013;19:406–18. Huang et al. Reproductive Biology and Endocrinology (2020) 18:119 Page 8 of 9 13. Wu J, Xie H, Yao S, Liang Y. Macrophage and nerve interaction in endometriosis. J Neuroinflammation. 2017;14:53. 14. Ferrero S, et al. Aromatase and endometriosis: estrogens play a role. Ann N Y Acad Sci. 2014;1317:17 –23. 15. Huang Q, et al. Dioxin-like rather than non-dioxin-like PCBs promote the development of endometriosis through stimulation of endocrine- inflammation interactions. Arch Toxicol. 2017;91:1915 –24. 16. Noble LS, Simpson ER, Johns A, Bulun SE. Aromatase expression in endometriosis. J Clin Endocrinol Metab. 1996;81:174 –9. 17. Capellino S, et al. Role of estrogens in inflammatory response: expression of estrogen receptors in peritoneal fluid macrophages from endometriosis. Ann N Y Acad Sci. 2006;1069:263 –7. 18. Han SJ, et al. Estrogen receptor beta modulates apoptosis complexes and the Inflammasome to drive the pathogenesis of endometriosis. Cell. 2015; 163:960–74. 19. Gudjonsson T, Villadsen R, Ronnov-Jessen L, Petersen OW. Immortalization protocols used in cell culture models of human breast morphogenesis. Cellular and molecular life sciences : CMLS. 2004;61:2523 –34. 20. Sun PR, Jia SZ, Lin H, Leng JH, Lang JH. Genome-wide profiling of long noncoding ribonucleic acid expression patterns in ovarian endometriosis by microarray. Fertility Sterility. 2014;101:1038 –46.e1037. 21. Braza-Boils A, et al. Peritoneal fluid modifies the microRNA expression profile in endometrial and endometriotic cells from women with endometriosis. Human reproduction (Oxford, England). 2015;30:2292 –302. 22. Borghese B, et al. Gene expression profile for ectopic versus eutopic endometrium provides new insights into endometriosis oncogenic potential. Molecular endocrinology (Baltimore, Md.). 2008;22:2557 –62. 23. Laux-Biehlmann A, d'Hooghe T, Zollner TM. Menstruation pulls the trigger for inflammation and pain in endometriosis. Trends Pharmacol Sci. 2015;36:270–6. 24. Delbandi AA, et al. Eutopic and ectopic stromal cells from patients with endometriosis exhibit differential invasive, adhesive, and proliferative behavior. Fertil Steril. 2013;100:761 –9. 25. Harada T, et al. Apoptosis and endometriosis. Front Biosci. 2007;12:3140 –51. 26. Mari-Alexandre J, et al. MicroRNAs and angiogenesis in endometriosis. Thromb Res. 2015;135(Suppl 1):S38 –40. 27. Zondervan KT, et al. Endometriosis. Nat Rev Dis Primers. 2018;4(9). 28. Zidan HE, Rezk NA, Alnemr A, Abd El Ghany AM. COX-2 gene promoter DNA methylation status in eutopic and ectopic endometrium of Egyptian women with endometriosis. J Reprod Immunol. 2015;112:63 –7. 29. Huber A, et al. Ten estrogen-related polymorphisms and endometriosis: a study of multiple gene-gene interactions. Obstet Gynecol. 2005;106:1025–31. 30. Bozdag G, et al. CYP17 and CYP2C19 gene polymorphisms in patients with endometriosis. Reprod BioMed Online. 2010;20:286 –90. 31. Huhtinen K, Stahle M, Perheentupa A, Poutanen M. Estrogen biosynthesis and signaling in endometriosis. Mol Cell Endocrinol. 2012;358:146 –54. 32. Wu RF, et al. Lipoxin A4 suppresses estrogen-induced epithelial- Mesenchymal transition via ALXR-dependent manner in endometriosis. Reprod Sci. 2018;25:566 –78. 33. Banu SK, Lee J, Starzinski-Powitz A, Arosh JA. Gene expression profiles and functional characterization of human immortalized endometriotic epithelial and stromal cells. Fertil Steril. 2008;90:972 –87. 34. Boccellino M, et al. In vitro model of stromal and epithelial immortalized endometriotic cells. J Cell Biochem. 2012;113:1292 –301. Publisher’sN o t e Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Huang et al. Reproductive Biology and Endocrinology (2020) 18:119 Page 9 of 9