{"paper_id":"407eb351-47d8-4618-b4fe-7244b6993750","body_text":"R E S E A R C H Open Access\nEstablishment of an immortalized stromal\ncell line derived from human Endometriotic\nlesion\nZhi-Xiong Huang 1†, Rong-Feng Wu 2†, Xiao-Mei Mao 1, Shao-Min Huang 2, Tian-Tian Liu 1, Qiong-Hua Chen 3* and\nQing-Xi Chen 1*\nAbstract\nBackground: Endometriosis is a benign gynecological disease with obviously feature of estrogen-dependence and\ninflammatory response. The applications of primary endometriotic stromal cells in research of endometriosis are\nrestricted for short life span, dedifferentiation of hormone and cytokine responsiveness. The objective of this study\nwas to establish and characterize immortalized human endometriotic stromal cells (ihESCs).\nMethods: The endometriotic samples were from a patient with ovarian endometriosis and the primary endometriotic\nstromal cells were isolated from the endometriotic tissues.The primary cells were infected by lentivirus to establish\ntelomerase reverse transcriptase (hTERT)-induced immortalized cells. Quantification of mRNA and proteins was examined by\nquantitative real-time polymerase chain reaction (qRT-PCR) and Western Blot. CCK-8 assay and EdU labeling assay were\nassigned to assess the growth of ihESCs. Karyotype assaywas performed to detect the chromosomes of ihESCs. Colony\nformation assay and nude mouse tumorigenicity assay were usedto evaluate colony-formation and tumorigenesis abilities.\nResults:ihESCs continuously overexpressed hTERT via infection of lentivirus and significant extended the life span reaching\n31 passages. The morphology, proliferation and karyotype of ihESCs remained unchanged. The expression of epithelial-\nmesenchymal transition (EMT) markers, estrogen-metabolizing proteins and estrogen/progesterone receptors (ERs and PRs)\nwere unaltered. Furthermore, the treatment of estrogen increased the proliferation and EMT of ihESCs. Lipopolysaccharides\n(LPS) and IL-1β remarkably induced inflammatory response. The clonogenesis ability of ihESCs was consistent with primary\ncells, which were much lower than Ishikawa cells. In addition,nude mouse tumorigenicity assay demonstrated that ihESCs\nwere unable to trigger tumor formation.\nConclusion:This study established and characterized an immortalizedendometriotic stromal cellline that exhibited longer\nlife span and kept the cellular morphology and physiological function as the primary cells. The immortalized cells remained\nnormal feedback to estrogen and inflammatory response. Moreover, the immortalized cells were not available with\ntumorigenic ability. Therefore, ihESCs would be serviceable as in vitro cell tool to investigate the pathogenesis of\nendometriosis.\nKeywords:Immortalized, Endometriotic stromal cells, Estrogen, Inflammation, Tumorigenicity\n© The Author(s). 2020 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License,\nwhich permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give\nappropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if\nchanges were made. The images or other third party material in this article are included in the article's Creative Commons\nlicence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons\nlicence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain\npermission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.\nThe Creative Commons Public Domain Dedication waiver ( http://creativecommons.org/publicdomain/zero/1.0/) applies to the\ndata made available in this article, unless otherwise stated in a credit line to the data.\n* Correspondence: cqhua616@126.com; chenqx@xmu.edu.cn\n†Zhi-Xiong Huang and Rong-Feng Wu contributed equally to this work.\n3The Key Laboratory of Research and Diagnosis of Gynecological Diseases of\nXiamen City and Department of Obstetrics and Gynecology, the First\nAffiliated Hospital of Xiamen University, Xiamen 361003, China\n1School of Life Sciences, Xiamen University, Xiamen 361102, China\nFull list of author information is available at the end of the article\nHuang et al. Reproductive Biology and Endocrinology          (2020) 18:119 \nhttps://doi.org/10.1186/s12958-020-00669-x\n\nIntroduction\nEndometriosis, a frequent gynecology disease of\nreproductive-aged female, is defined that the endometrium is\npresent outside of the uterus location [ 1, 2]. The estimated\n10% of women within childbearing age may suffer from\nendometriosis [3, 4]. And appearance of endometriosis gen-\nerally accompanied by chronic pelvic pain, dysmenorrhea, se-\nvere dyspareunia, and even infertility [ 5–7]. It is\napproximated that 47% of infertile women have endometri-\nosis [8]. Moreover, the high recurrence rate of endometriosis\nr e q u i r e dt h r e eo rm o r es u r g e r i e s[9, 10]. Therefore, endo-\nmetriosis negative impacts on the large number of women\npatients and indirectly on healthcare systems and society.\nAlthough many factors repor ted were closely associated\nwith incidence of endometriosis, the etiology of this disease\nis still unknown. Of all pathogenic theories about endomet-\nriosis occurrence, hypothesis of retrograde menstruation is\nthe most recognized version, in which retrograde menstru-\nation of endometrial tissue slough through patent fallopian\ntubes into the peritoneal cavity and then adhere, invade\nand proliferate in ectopic locations [2]. These processes are\nconcerned with background of family heredity, hormone\nresponse, and immunological factors [11–13].\nEndometriosis is reputed as estrogen and inflammation-\ndependent disease [14, 15]. It was reported that the increased\nlevel of aromatase in eutopic endometrial tissues allowed the\nimplantation of ectopic tissues on peritoneal surfaces [ 16].\nCapellino et all claimed that est rogen, via its functional re-\nceptors, modulated macrophages to regulate the immune\nresponse [17]. And Han et al. found that ER β inhibited\nT N F - a l p h a - i n d u c e da p o p t o s i sa n dp r o m o t e di n f l a m m a t i o n\nby increasing IL-1β to enhance cellular adhesion and prolif-\neration of ectopic endometriotic tissues [ 18]. Thus, the\nstimulation of estrogen and inflammation are mutually bene-\nficial during establishment of endometriotic lesions.\nFor investigations on the molecular mechanisms of endo-\nmetriosis, cultured human primary endometriotic cells are de-\nsirable in vitro tools. However, the applicability of primary\nendometriotic cells is largely restricted by dedifferentiation\nduring cell culture, including loss of hormone and cytokine re-\nsponsiveness, and short life span. The subjective of this study\nwas to establish and characterize an hTERT-induced immor-\ntalized endometriotic stomal cell line (ihESCs), which kept pri-\nmary morphology and proliferation. The expression of EMT\nmarkers, estrogen synthetase and estrogen/progesterone re-\nceptors in ihESCs remained unchanged. Moreover, ihESCs\ncontained normal number of chromosomes and were con-\nfirmed not maligned transformed by tumorgenicity assay.\nMaterials and methods\nReagents\nDMEM/F12 medium (#SH30023.01) was from Hyclone\n(Shanghai, China) and fetal bovine serum (FBS; #04 –001-\n1A) was bought from Biological Industries (BI; Cromwell,\nCT, USA). 17β-estradiol/estrogen/E2 (#E2758) and lipopoly-\nsaccharides (LPS; #L4391) were from Sigma-Aldrich (Shang-\nhai, China). Recombinant Human IL-1 β (#C600002) was\nbought from Sangon Biotech (Shanghai, China). GAPDH\nmouse monoclonal antibody (#40493) was procured from\nABclonal (Boston, USA). Cytokeratin 18 antibodies (#4548),\nE-cadherin antibodies (#14472), Vimentin antibodies\n(#5741), N-cadherin antibodies (#13116), Progesterone Re-\nceptor (PR) antibodies (#8757S), and ER α antibodies\n(#13258) were acquired from Cell Signaling Technology\n(Danvers, MA, USA). HSD17B1 antibodies (#ab51045),\nTERT antibodies (#ab32020), ER β antibodies (#ab288),\nCOX-2 antibodies (#ab151 91) and CYP17A1 antibodies\n(#ab125022) were purchased from Abcam (Cambridge, UK).\nPatients and primary cells culture\nEndometriotic tissues were collected in Department of\nObstetrics and Gynecology in the First Affiliated Hos-\npital of Xiamen University. The application of samples\nreceived permission from the ethics committee and all\npatients signed the informed consent. Endometriotic le-\nsions were from a 35-year-old female suffered from\novarian endometriosis confirmed by laparoscopy and\nhistopathology. This endometriosis patient had regular\nmenstrual cycles and was without hormone treatment\nfor more 3 months before the surgery.\nThe endometriotic samples were minced and digested\nby collagenase IV (#A004186 –0001; Sangon Biotech;\nShanghai, China) and deoxyribonuclease I (DNase I;\n#B002004–0005; Sangon Biotech; Shanghai, China).\nAfter being filtered through nylon cell-strainers with a\n100 mesh which intercepted pieces of tissue, and then\nthrough a mesh size of 400 which blocked the epithelial\nglands cells and passed through the stromal cells. The\nepithelial and stromal cells were respectively cultured\nwithin DMEM/F12 medium containing 10% FBS in\ndishes at 10% CO 2 37 °C incubation.\nEstablishment of ihESCs\nhTERT, human telomerase reverse transcriptase, activates\ntelomerase activity which maintains telomere length and ex-\ntends cell lifespan [19]. hTERT coding regions were cloned\nand inserted into CV186 vector (GeneChem; Shanghai,\nChina) and then mixed with le ntivirus packing plasmids\n(VSVG/PMDL/REV). The mixture of plasmids was trans-\nfected into 293 T cells by Lipofectamine 3000 (#L3000015;\nThermoFisher; Shanghai, China) to generate lentivirus. The\nprimary endometriotic stromal cells were cocultured with\nviral supernatants for 24 h to generate infected cells.\nDrugs treatment\n5×1 0 5 cells were plated into 60 cm dishes in DMEM/F12\nmedium without phenol red. After 24 h culture to remove\nendogenous hormones, 200 nM estrogen, 100 μg/ml LPS\nHuang et al. Reproductive Biology and Endocrinology          (2020) 18:119 Page 2 of 9\n\nor 10 μg/ml IL-1 β were respectively diluted in DMEM/\nF12 medium with 10% charcoal-treated FBS (#04 –201-1A;\nCromwell, CT, USA) and exposed to cells for 48 h.\nRNA extraction and qRT-PCR\nThe lysis of cells was performed by RNAiso Plus (#9108;\nTakala Biotechnology; Kyoto, Japan) and total RNA was ex-\ntracted by chloroform and isopropyl alcohol. The synthesis\nof cDNA was by using PrimeScript RT reagent kit\n(#RR047A; Takara). PCR reaction was executed by the SYBR\nPremix Ex Taq II (#RR820A, Takala) in Lightcycler 480\n(Roche; Basel, Switzerland). The results were normalized\nbased on GAPDH expression and calculated by the 2 -△△CT\nmethod. All primer sequences were listed in Table1.\nWestern blot assay\nTotal proteins were harvested by RIPA lysis buffer with\nprotease inhibitors. SDS-PAGE was assumed to separate\nproteins of different molecule mass which then were\ntransferred onto PVDF membranes (#IPVH00010; Merck;\nGermany). The PVDF membranes were incubated within\nprimary antibodies for overnight at 4 °C. After cleaned by\nPBS, the PVDF membranes were then immersed in corre-\nsponding secondary antibody. The dilution rates of\nantibodies were hTERT (1:1000), Cytokeratin 18 (1:1000),\nE-cadherin (1:500), Vimentin (1:1000), N-cadherin (1:\n1000), COX-2 (1:1000), HSD17B1 (1:500), CYP17A1 (1:\n1000), ERα (1:1000), ERβ (1:500), PR (1:1000), GAPDH (1:\n10000), and secondary antibody (1:10000). The signal was\nfinally visualized by an enhanced chemiluminescence\n(ECL; # NCI4106; Pierce, Waltham, MA, USA).\nObservation of cell ultrastructure\nAt o t a lo f1 × 1 0 5 cells were planted into 35 cm dishes\nwhich of bottom were polylysine-coated cover slides. After\n24 h till all cells attached to the slides, 2.5% glutaraldehyde\nand 1% osmic acid were employed to fix the cells. After\ndehydrated with gradient ethanol, the slides were\nimmersed in tert-butanol overnight at 4 °C. And the slides\nwere freeze-dried and then sprayed with gold. The images\nof cell ultrastructure were observed and photographed by\nScanning Electron Microscope (#JSM-6390LV; Japan Elec-\ntron Optics Laboratory; Tokyo, Japan).\nCell proliferation assay\nTo analyze the proliferation of cells, Cell Counting Kit-8\n(#HY-K0301; MedChemExpress; Shanghai, China) was\nused to quantify the growth rate. 5 × 10 3 cells were\nplanked into 96-well plates and treated with 200 nM es-\ntrogen. CCK-8 was added into each well and reacted in\n37 °C incubator for 2 h every 24 h. The absorbance of su-\npernatants was measured by an ELISA reader spectro-\nphotometer (Dynatech Laboratories, Chantilly, VA).\nEdU labeling assay\nAccording to the instructions of EdU assay kit\n(#C0071S; Beyotime Biotechnology, Shanghai, China),\n1×1 0 5 ihESCs were seeded into 6-well plates and\ntreated with 200 nM estrogen for 48 h. The treated\ncells were incubated with 10 μME d Us o l u t i o nf o r3 h .\nAfter fixed and permeabilized, the cells were cultured\nin click sdditive solution for 30 min. Finally, Hoechst\n33342 solution was employed to stain the cell nu-\ncleus. The results were observed and captured using\nthe fluorescence microsco pe (Olympus Corporation,\nTokyo, Japan).\nKaryotype analysis\n1×1 0 6 cells were planted into in a 10 cm dish with\nDMEM/F12 medium containing 10% FBS for 48 h. After\nincubated with 0.2 μg/ml colchicine (#HY-16569; MCE;\nShanghai, China) for 2 h, the cells were treated with low\nosmotic pressure for 20 min and then fixed by fixative\nsolution (methanol: acetic acid =3:1). The fixed cells\nwere added to the slide and stained by Giemsa. The im-\nages of chromosomes observed and captured by micro-\nscope were clipped and sorted by Photoshop soft.\nImmunocytochemistry (ICC)\nPrimary cells and ihESCs were planked on 6-well plates\nand cultured to 100% confluence. The cells were fixed\nby cold methanol and permeated by 0.3% Triton-X.\nAfter incubated with 5% bovine serum albumin (BSA)\nfor 1 h, the cells were covered within primary antibody\novernight. The immunocomplexes were incubated with\ncorresponding secondary antibody for 1 h at room\ntemperature. DAB Color Development Kit (#AR1022;\nBoster Biological Technology, Wuhan, China) was used\nto stain the immunocomplexes. The results of immuno-\nstaining were captured using the microscope (Olympus\nCorporation, Tokyo, Japan).\nTable 1 Primer sequences used in qRT-PCR analysis\nGene Name Sequences (5 ′-3′)\nGAPDH Forward: GGAAGGTGAAGGTCGGAGTCA\nReverse: GAGTCCTTCCACGATACCAA\nhTERT Forward: CGGCCTATTCCCCTGGT\nReverse: ATGTTCCTCCCAGCCTTGA\nIL-1β Forward: ATGATGGCTTATTACAGTGGCAA\nReverse: GTCGGAGATTCGTAGCTGGA\nIL-6 Forward: ACTCACCTCTTCAGAACGAATTG\nReverse: CCATCTTTGGAAGGTTCAGGTTG\nIL-10 Forward: TCAAGGCGCATGTGAACTCC\nReverse: GATGTCAAACTCACTCATGGCT\nMCP-1 Forward: AGTGTCCCAAAGAAGCTGTGA\nReverse: CCTGAACCCACTTCTGCTTG\nHuang et al. Reproductive Biology and Endocrinology          (2020) 18:119 Page 3 of 9\n\nColony formation assay\nA total of 1 × 10 3 primary cells, ihESCs or Ishikawa cells\nwere evenly planked in 6 cm dishes with DMEM/F12\ncontaining 10% FBS. After cultured for 7 days, the col-\nonies of cells were wash with PBS and fixed by 4% para-\nformaldehyde for 10 min. 0.1% crystal violet (#E607309;\nSangon Biotech; Shanghai, China) was applied to stain\nthe cells for 15 min. The colonies were photographed\nand counted visually.\nXenograft\nThe acquisition of female BALB/c nude mice (5–8w e e k so l d\nand 15–20 g) and operation were relied on Animal Research\nLaboratory of Xiamen University. The ethics of animal ex-\nperiment was strictly followed in the course of experiments.\nThe mice were acclimatized for a week before processing.\nThe mice were divided into 3 groups and each group con-\ntained 3 mice. The primary ESCs, ihESCs and Ishikawa cells\nwere subcutaneously injected into the right dorsal of the\nmice (1 × 107 cells/mouse) according to grouping. The mice\nwere monitored for enough tumor growth. After 2 months,\nthe mice were sacrificed and photographed.\nResults\nEstablishment of hTERT-induced immortalized\nendometriotic stromal cells by infection of lentivirus\nLentivirus was employed to increase the hTERT expres-\nsion of primary endometriotic stromal cells. As shown in\nFig. 1a, the red fluorescence protein (RFP), as a molecular\ntracer, was stably expressed in ihESCs of 5, 15 and 25 pas-\nsages. Further investigations were employed to detected\nthe expression of hTERT in ihESCs from different pas-\nsages. In Fig. 1b and c, both mRNA and proteins of\nhTERT in ihESCs were significant increased compared\nwith primary cells. Furthermore, there was not obvious\ncell morphological change between ihESCs and primary\nstromal cells observed by optical microscope (Fig. 1d\nupper) and scanning electron microscope (Fig. 1d lower).\nFig. 1 Establishment of immortalized human endometriotic stomal cells (ihESCs) by lentivirus transfection of hTERT. a The observation of red\nfluorescent from infected cells to estimate infection efficiency. b The expression of hTERT mRNA in ihESCs of 5, 15 and 25 passages. c hTERT\nprotein level of ihESCs from various passages detected by Western Blot. d The morphology of ihESCs observed by using Optical Microscope\n(upper) and Scanning Electron Microscope (lower). e The life span of primary cells and ihESCs. Data represent the mean ± SEM.\n**P < .001, ***P < .0001\nHuang et al. Reproductive Biology and Endocrinology          (2020) 18:119 Page 4 of 9\n\nTo record life span of ihESCs and primary cells, the results\nof continuous cell cultivation exhibited that the life span\nof ihESCs which reached 31 passages much longer than\nthat of primary cells which is 14 passages (Fig. 1e).\nThe cell physiology of ihESCs keeps unchanged compared\nwith primary cells\nTo further explore whether the cell physiology of\nihESCs was changed, the proliferation and different\nmarker proteins were detected. As in Fig. 2a, the pro-\nliferative activity of ihESCs extraordinary resembled\nprimary cells. The expression of epithelial-\nmesenchymal transition (EMT) markers in ihESCs\nwas consistent with primary cells (Fig. 2b). Further-\nmore, the estrogen-metabolizing proteins, including\nCOX-2, HSD17B1 and CYP17A1, kept similar with\nprimary cells. The expression of ERs and PRs were\noriginal level as well (Fig. 2c). Further, ihESCs maintain\nhigh expression of Vimentin and low expression of Cyto-\nkeratin 18, which suggested the mesenchymal cell charac-\nteristics of ihESCs were tenacious (Fig. 2d). To further\nexamine the chromosomes of ihESCs, karyotype analysis\nwas performed. As in Fig. 2e, ihESCs presented normal\nnumber of 23 pairs chromosomes.\nNormal estrogen response is kept in ihESCs\nTo demonstrate the response of ihESCs to estrogen\nstimulation, 200 nM estrogen was used to treat\nihESCs. As shown in Fig. 3a, the treatment of estro-\ngen significant promoted the proliferation of ihESCs.\nAnd stimulation of estrogen to ihESCs increased the\nnumber of EdU-labeled cells, which suggested estro-\ngen could enhance cell division of ihESCs (Fig. 3b\nand c). Furthermore, estrogen reduced the expression\nof Cytokeratin 18 and E-cadherin proteins, but en-\nhanced the level of mesenchymal marker proteins\nFig. 2 The phenotypes and marker proteins of ihESCs kept unchanged compared with primary stromal cells. a The growth curve of ihESCs and\nprimary stromal cells detected by CCK-8 assays. b The protein expression of epithelial-mesenchymal transition from primary stomal cells and\nihESCs. c The level of estrogen-metabolizing proteins and estrogen/progesterone receptors proteins in primary cell and ihESCs. d Identification of\nepithelial and mesenchymal cells assessed by immunocytochemistry (ICC). e Chromosome karyotype analysis of ihESCs and sorting result (right)\nHuang et al. Reproductive Biology and Endocrinology          (2020) 18:119 Page 5 of 9\n\n(Fig. 3d ) .T h u s ,e s t r o g e np r o m o t e dt h ep r o l i f e r a t i o n\nand EMT of ihESCs, which suggested ihESCs kept\nnormal response to estrogen.\nInflammatory response is detected in ihESCs\nTo verify inflammatory response of ihESCs, 100 ng/ml\nLPS and 10 ng/ml IL-1 β were employed to induced\nFig. 3 Normal estrogen response and inflammation are found in ihESCs. a The proliferation of ihESCs with stimulation of estrogen. b EdU-labeled\nassay employed to monitor cell division of ihESCs treated with estrogen. c Quantified analysis of EdU assays. d The protein expression of EMT\nmarkers from ihESCs with treatment of estrogen. The mRNA ( e) and protein ( f) expression of inflammatory factor in ihESCs with stimulation of\nLPS. The mRNA ( g) and proteins ( h) of inflammatory factor from ihESCs treated with IL-1 β. Data represent the mean ± SEM. * P < .05,\n**P < .001, ***P < .0001\nHuang et al. Reproductive Biology and Endocrinology          (2020) 18:119 Page 6 of 9\n\ninflammation respectively. As the results of Fig. 3e and f,\nLPS remarkably promoted the expression of IL-1 β, IL-6,\nIL-10 and MCP-1. And the mRNA and proteins of these\ninflammatory factors were significant increased with\ntreatment of IL-1 β (Fig. 3g and h). Therefore, the normal\ninflammatory response was retained in ihESCs.\nihESCs are not available with tumorigenic ability\nTo identify whether ihESCs were malignant transform-\nation, colony formation assay and nude mouse tumorigen-\nicity assay were performed. As shown in Fig. 4a, the\nclonogenesis ability of ihESCs was as weak as primary cells\nwhich much lower than endometrial cancer Ishikawa cells.\nMoreover, different from Ishikawa cells which induced\nformation of tumors, both ihESCs and primary stromal\ncells were incapable of triggering occurrence of tumors\n(Fig. 4b). Consequently, ihESCs kept characteristics of pri-\nmary cells and were not malignant transformed.\nDiscussions\nThis study established immortalized human endometrio-\ntic stromal cells (ihESCs) by overexpressing hTERT. The\nlifespan of immortalized cells was beyond 30 passages\nwhich much longer than primary cells. The morphology\nand proliferation of ihESCs remained original. The ex-\npression of EMT markers, estrogen-metabolizing\nproteins and estrogen/progestogen receptors in ihESCs\nwere unchanged from the primary cells. The chromo-\nsome karyotype of ihESCs retained normal. The normal\nfeedback of estrogen and inflammation response were\nobserved in ihESCs. Furthermore, ihESCs were not ma-\nlignant transformed to trigger the formation of tumors.\nThus, we established an immortalized endometriotic\nstromal cells with stable characteristics and function,\nwhich might be a practical cellular tool.\nAccording to abundant reports about high-throughput\nsequencing of endometriosis, thousands of genes aber-\nrant expressed in endometriosis were found [ 20–22].\nCompared with normal and eutopic endometria, endo-\nmetriotic lesions were remarkably mutative including\nchange of inflammation response [ 13, 23], hormone dys-\nregulation [ 14], disordered proliferation and apoptosis\n[24, 25], promoted angiogenesis [ 26] and EMT [ 27].\nTherefore, endometriotic cells are much more appreciate\nmodel cells in the mechanism research of endometriosis.\nTo establish model cells with stabled characteristics and\nlong lifespan is considerable significance for practical ap-\nplication. Thus, establishment of immortalized endome-\ntriotic cells could be an effective method to supply the cell\ntool for research. The immortalized cell ihESCs estab-\nlished in this study remained unchanged morphology,\nproliferation and EMT markers, which indicated that the\nFig. 4 ihESCs are not malignant transformed to trigger tumors. a Colony formation assay used to assess the oncogenic potential of ihESCs. b\nNude mouse tumorigenicity assay performed to evaluate tumorigenic capacity of ihESCs\nHuang et al. Reproductive Biology and Endocrinology          (2020) 18:119 Page 7 of 9\n\nprocess of immortalization did not affect the growth and\ntype of cells. On the other hands, it was well recognized\nthat estrogen was greatly increased in endometriotic le-\nsions compared with normal and eutopic endometria [ 14].\nAnd significantly increased estrogen synthases are closely\nassociated with recurrence of endometriosis [ 28–30]. Our\nresults manifested that these estrogen synthases including\nCOX-2, HSD17B1 and CYP17A1 kept consistent with pri-\nmary cells. Furthermore, the expression of estrogen/pro-\ngestogen receptors were not changed, which implied that\nthe functional approaches of estrogen and progestogen re-\nmain complete. Moreover, the immortalized cells main-\ntained normal number of chromosomes suggesting the\ngenes were not obviously changed with the influence of\nimmortalization. Therefore, these results demonstrated\nthat ihESCs kept morphology and genes characteristics as\nthe primary endometrial stromal cells.\nEndometriosis is recognized as estrogen-dependent and\ninflammatory disorder [ 29, 30]. Estrogen stimulated the\nproliferation of endometriotic cells predominantly via its\nnuclear receptors [31]. And our previous study found that\nestrogen markedly promoted EMT [ 32]. In this study, the\nproliferation and EMT of ihESCs were obviously pro-\nmoted with stimulation of estrogen, which suggested the\noriginal ability responding to estrogen of primary cell\nremained in ihESCs. Additionally, the treatment of LPS\nand IL-1 β could trigger obvious inflammation of ihESCs,\nwhich demonstrated that inflammatory response was\npresent in ihESCs. Consequently, ihESCs suffice for the\nusage of research about the effect and mechanisms of es-\ntrogen and inflammation on endometriosis.\nA previous study analyzed numerous genes expression\nassociated with estrogen/progesterone biosynthesis and\nsignaling, cell cycle regulation, and cytokine production\nfrom different immortalized human endometriotic epi-\nthelial cells and stromal cells [ 33]. Mariarosaria et all\nestablished immortalized endometriotic epithelial and\nstromal cells by retroviral transfection of hTERT, which\nkept the primary characteristics of phenotype and ex-\npression of estrogen and progesterone receptors [ 34].\nHowever, the change of cell morphology, physiology and\nmalignant transformation were lack of identification in\nthese immortalized cells. To evaluate comprehensively\nour immortalized cell, the cell morphology, proliferation,\nEMT markers and different cell physiology were moni-\ntored unchanged. Moreover, the karyotype analysis and\ntumor formation experiment demonstrated that ihESCs\nwere not malignant transformed and could be reliable\nmodel cells. In conclusion, this study established immor-\ntalized endometriotic stromal cells, and characterized\nthat these cells kept much longer lifespan, primary\nphysiological characteristics and were not malignant\ntransformed. Thus, ihESCs are potentially useful as an\nexperimental model to demonstrate endometriosis.\nAbbreviations\nihESCs: Immortalized human endometriotic stromal cells (ihESCs);\nhTERT: Human telomerase reverse transcriptase; qRT-PCR: Quantitative real-\ntime polymerase chain reaction; EMT: Epithelial-mesenchymal transition;\nLPS: Lipopolysaccharide; E2: Estrogen\nAcknowledgments\nDeep appreciations to Dr. Qian-Sheng Huang and Wei-Dong Zhou for many\nvaluable comments and excellent technical assistance in this study.\nAuthors’ contributions\nZhi-Xiong Huang and Rong-Feng Wu completed the experiments and fin-\nished the manuscript. Xiao-Mei Mao and Shao-Min Huang undertook primary\ncell culture and clinical samples collection. Tian-Tian Liu analyzed the data\nand revised the manuscript. Qing-Xi Chen and Qiong-Hua Chen conceived\nthe study, provided financial support, and revised the manuscript. All authors\nread and approved the final manuscript.\nFunding\nThis research was financial supported by the National Science Foundation of\nChina (No. 81871145 and 81701419) and the Science and Technology\nPlanning Project of Xiamen City (No. 2018S2326).\nAvailability of data and materials\nAll data in this study are included in this published article.\nEthics approval and consent to participate\nAll use of samples got consent from the participant and was approved by\nthe First Affiliated Hospital of Xiamen University.\nCompeting interests\nAll authors announced there were no potential conflicts of interest in this\narticle.\nAuthor details\n1School of Life Sciences, Xiamen University, Xiamen 361102, China.\n2Reproductive Medical Center, The First Affiliated Hospital of Xiamen\nUniversity, Xiamen, China. 3The Key Laboratory of Research and Diagnosis of\nGynecological Diseases of Xiamen City and Department of Obstetrics and\nGynecology, the First Affiliated Hospital of Xiamen University, Xiamen\n361003, China.\nReceived: 12 June 2020 Accepted: 6 November 2020\nReferences\n1. Peiris AN, Chaljub E, Medlock D. Endometriosis. Jama. 2018;320:2608.\n2. Vercellini P, Somigliana E, Fedele L. Endometriosis: pathogenesis and\ntreatment. Nat Rev Endocrinol. 2014;10:261 –75.\n3. Giudice LC, Kao LC. Endometriosis. Lancet. 2004;364:1789 –99.\n4. de Ziegler D, Borghese B, Chapron C. Endometriosis and infertility:\npathophysiology and management. Lancet. 2010;376:730 –8.\n5. Culley L, et al. The social and psychological impact of endometriosis on\nwomen's lives: a critical narrative review. Hum Reprod Update. 2013;19:625–39.\n6. Mehedintu C, et al. Endometriosis-related inflammation and fertility. Eur J\nClin Investig. 2016;46:51..\n7. Lin YH, et al. Chronic Niche Inflammation in Endometriosis-Associated\nInfertility: Current Understanding and Future Therapeutic Strategies. Int J\nMol Sci. 2018;19.\n8. Meuleman C, et al. High prevalence of endometriosis in infertile women with\nnormal ovulation and normospermic partners. Fertil Steril. 2009;92:68–74.\n9. Bulletti C, et al. Vaginal parturition decreases recurrence of endometriosis.\nFertil Steril. 2010;94:850 –5.\n10. Bozdag G. Recurrence of endometriosis: risk factors, mechanisms and\nbiomarkers. Womens Health. 2015;11:693 –9.\n11. Bai H, et al. Establishment and characterization of immortalized bovine\nendometrial epithelial cells. Animal Sci J = Nihon chikusan Gakkaiho. 2014;\n85:799–804.\n12. Reis FM, Petraglia F, Taylor RN. Endometriosis: hormone regulation and\nclinical consequences of chemotaxis and apoptosis. Hum Reprod Update.\n2013;19:406–18.\nHuang et al. Reproductive Biology and Endocrinology          (2020) 18:119 Page 8 of 9\n\n13. Wu J, Xie H, Yao S, Liang Y. Macrophage and nerve interaction in\nendometriosis. J Neuroinflammation. 2017;14:53.\n14. Ferrero S, et al. Aromatase and endometriosis: estrogens play a role. Ann N\nY Acad Sci. 2014;1317:17 –23.\n15. Huang Q, et al. Dioxin-like rather than non-dioxin-like PCBs promote the\ndevelopment of endometriosis through stimulation of endocrine-\ninflammation interactions. Arch Toxicol. 2017;91:1915 –24.\n16. Noble LS, Simpson ER, Johns A, Bulun SE. Aromatase expression in\nendometriosis. J Clin Endocrinol Metab. 1996;81:174 –9.\n17. Capellino S, et al. Role of estrogens in inflammatory response: expression of\nestrogen receptors in peritoneal fluid macrophages from endometriosis.\nAnn N Y Acad Sci. 2006;1069:263 –7.\n18. Han SJ, et al. Estrogen receptor beta modulates apoptosis complexes and\nthe Inflammasome to drive the pathogenesis of endometriosis. Cell. 2015;\n163:960–74.\n19. Gudjonsson T, Villadsen R, Ronnov-Jessen L, Petersen OW. Immortalization\nprotocols used in cell culture models of human breast morphogenesis.\nCellular and molecular life sciences : CMLS. 2004;61:2523 –34.\n20. Sun PR, Jia SZ, Lin H, Leng JH, Lang JH. Genome-wide profiling of long\nnoncoding ribonucleic acid expression patterns in ovarian endometriosis by\nmicroarray. Fertility Sterility. 2014;101:1038 –46.e1037.\n21. Braza-Boils A, et al. Peritoneal fluid modifies the microRNA expression profile\nin endometrial and endometriotic cells from women with endometriosis.\nHuman reproduction (Oxford, England). 2015;30:2292 –302.\n22. Borghese B, et al. Gene expression profile for ectopic versus eutopic\nendometrium provides new insights into endometriosis oncogenic\npotential. Molecular endocrinology (Baltimore, Md.). 2008;22:2557 –62.\n23. Laux-Biehlmann A, d'Hooghe T, Zollner TM. Menstruation pulls the trigger for\ninflammation and pain in endometriosis. Trends Pharmacol Sci. 2015;36:270–6.\n24. Delbandi AA, et al. Eutopic and ectopic stromal cells from patients with\nendometriosis exhibit differential invasive, adhesive, and proliferative\nbehavior. Fertil Steril. 2013;100:761 –9.\n25. Harada T, et al. Apoptosis and endometriosis. Front Biosci. 2007;12:3140 –51.\n26. Mari-Alexandre J, et al. MicroRNAs and angiogenesis in endometriosis.\nThromb Res. 2015;135(Suppl 1):S38 –40.\n27. Zondervan KT, et al. Endometriosis. Nat Rev Dis Primers. 2018;4(9).\n28. Zidan HE, Rezk NA, Alnemr A, Abd El Ghany AM. COX-2 gene promoter\nDNA methylation status in eutopic and ectopic endometrium of Egyptian\nwomen with endometriosis. J Reprod Immunol. 2015;112:63 –7.\n29. Huber A, et al. Ten estrogen-related polymorphisms and endometriosis: a\nstudy of multiple gene-gene interactions. Obstet Gynecol. 2005;106:1025–31.\n30. Bozdag G, et al. CYP17 and CYP2C19 gene polymorphisms in patients with\nendometriosis. Reprod BioMed Online. 2010;20:286 –90.\n31. Huhtinen K, Stahle M, Perheentupa A, Poutanen M. Estrogen biosynthesis\nand signaling in endometriosis. Mol Cell Endocrinol. 2012;358:146 –54.\n32. Wu RF, et al. Lipoxin A4 suppresses estrogen-induced epithelial-\nMesenchymal transition via ALXR-dependent manner in endometriosis.\nReprod Sci. 2018;25:566 –78.\n33. Banu SK, Lee J, Starzinski-Powitz A, Arosh JA. Gene expression profiles and\nfunctional characterization of human immortalized endometriotic epithelial\nand stromal cells. Fertil Steril. 2008;90:972 –87.\n34. Boccellino M, et al. In vitro model of stromal and epithelial immortalized\nendometriotic cells. J Cell Biochem. 2012;113:1292 –301.\nPublisher’sN o t e\nSpringer Nature remains neutral with regard to jurisdictional claims in\npublished maps and institutional affiliations.\nHuang et al. Reproductive Biology and Endocrinology          (2020) 18:119 Page 9 of 9","source_license":"CC0","license_restricted":false}