Therapeutic targeting of interleukin-17C signaling in carcinogenesis of endometriosis

The study was designed by P.L. and H.Z. The research was conducted by B.Y., R.Z., Y.Y., and Z.Z. Histopathological analyses were performed by M.W. and P.L. Bioinformatics analysis were performed by Y.Y. and B.Y. M.W., B.G., J.P., and H.S. contributed to resources and research design of experiments. G.E.L. reviewed and provided intellectual insights into endometriosis. H.Z. and M.W. provided critical discussions and supervised the project. P.L. conceived the project and designed and wrote the original manuscript. All authors have read and approved the final manuscript.

ST samples were performed across the three freshly frozen specimens from normal endometrium (normal), EMs, and EAOCs ( Table S1 ). The ST data consisted of 2,648–4,029 spots per tissue. Batch effects were removed using Harmony. After clustering, we identified a total of 24 clusters in the three tissues. Tissue-specific gene expression analysis was used to further determine the annotation of spots ( Figure S1 ), and seven tissue-specific clusters were identified, including endometrial gland, endometrial stroma, immune-enriched endometrial stroma, cancer-associated fibroblasts (CAFs), ovarian stroma, bleeding area, and blood vessels ( Figures 1 A and 1B; Table S2 ). To verify whether the transcriptomic features were consistent with the histological information, the H&E staining images and their corresponding immunohistochemistry (IHC) images of adjacent sections were compared with the ST-based clustering. CDH1 (E-cadherin [E-cad]) encodes an epithelial-related membrane protein commonly expressed in endometrial gland clusters, including normal uterine gland epithelium, ectopic endometrial epithelium, and cancerous regions developed from epithelial tissues. Vim (vimentin) is an intermediate filament protein that is widely present in mesenchymal cells, fibroblasts, smooth muscle cells, and other types of cells. It was extensively expressed in the endometrial stroma and ovarian stroma, and the distribution of these areas aligns with the stroma clustering. Immunostaining confirmed the presence of endometriosis (glandular component ER [estrogen receptor] positive, endometrial-like stroma CD10 positive) in EM and EAOC tissue. ACTA2 (α-SMA) is a specific maker of fibroblast activation, suggesting the ectopic lesion in EMs and CAFs in EAOC ( Figure 1 C). Differential gene expression (DEG) analysis was performed in all clusters to obtain a detailed view of the heterogeneity between clusters. The expression pattern of the DEG was visualized using heatmaps, followed by Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis to display the pathways enriched in each cluster, providing a deeper understanding of their biological significance and potential functions, such as cell adhesion, epithelial-to-mesenchymal transition (EMT), epithelial cell development, and immune response ( Figure S2 A). Figure 1 ST atlas of normal, EM, and EAOC tissues (A) Workflow of sample collection, ST sequencing, and data analysis. (B) Uniform manifold approximation and projection plot of all spots from the three tissues. Twenty-three clusters were identified. (C) Prediction of the cell type profiles of the ST niches. (D) Clustering analysis of the ST data of the three tissues. (E) The distribution of each cluster among the three samples and per plot indicating the proportion of clusters in each sample. (F) The trajectory of epithelial cells inferred by Monocle v2, color coded by cell subtypes. (G) Functional analysis of epithelial clusters showed enrichment of the IL-17 signaling pathway. ST atlas of normal, EM, and EAOC tissues (A) Workflow of sample collection, ST sequencing, and data analysis. (B) Uniform manifold approximation and projection plot of all spots from the three tissues. Twenty-three clusters were identified. (C) Prediction of the cell type profiles of the ST niches. (D) Clustering analysis of the ST data of the three tissues. (E) The distribution of each cluster among the three samples and per plot indicating the proportion of clusters in each sample. (F) The trajectory of epithelial cells inferred by Monocle v2, color coded by cell subtypes. (G) Functional analysis of epithelial clusters showed enrichment of the IL-17 signaling pathway. Clusters 2, 3, 7, 9, and 16 were classified as epithelial cells with highly expressing epithelial marker genes EPCAM and CDH1 ( Figures 1 D and S2 B). In normal endometrium, these tissues are located at the inner edge of the endometrial glands, representing normal endometrial glandular epithelium. However, in endometriotic tissue, endometrial gland-like tissues are irregularly distributed in small clumps at the edges and within the tissue. In tumor tissue sections, endometrial gland-like structures are distributed in large sheets and overlap with the tumor areas ( Figures 1 D and S2 C). Clusters 0, 1, 5, 6, 8, 14, 17, 18, 23, and 10 exhibited relatively high stromal characteristics, with elevated expression of “COL6A1” and “VIM,” representing endometrial stromal-like regions ( Figures 1 D, S2 B, and S2C). Furthermore, clusters 17, 18, and 23 highly expressed immune cell markers “ CD79A ,” “ CSF3R ,” “ IL2RB ,” and “ GZMM ,” indicating immune-enriched endometrial stroma. These tissues were predominantly distributed in the areas of endometriosis, with scattered distribution also present in normal tissues ( Figures 1 D and S2 C). However, such spots were absent in tumor tissues. Cluster 10 cells are generally distributed in a scattered pattern within the tissue; with a similar scattered appearance in tumor regions. They highly expressed the CAF markers “ COL4A1 ” and “ TGFB1 ,” and were defined as CAF in stroma cluster ( Figures 1 D and S2 B). Clusters 4, 11, 12, 15, 19, 20, and 22 were primarily distributed in the ovarian stromal regions and highly express ovarian stromal markers “ SVIL ” and “ PRELP ” and were defined as ovarian stroma. Cluster 13, blood vessel cluster, was specifically distributed in vascular regions on H&E staining and highly expressed endothelial markers “ MCAM ” and “ CLDN5 .” Cluster 21 is associated with hemorrhagic regions on H&E staining and exhibited distinct differences from other clusters, and was defined as the cluster of bleeding area ( Figure 1 D). It has been proposed that EAOC arises from a specific cell type. 30 , 31 In the present study, the proportions varied greatly across the three individuals ( Figure 1 E). The tumor epithelium, particularly in the endometrial gland cluster, highly expressed tumor-associated genes such as KRT7 , SPNS2 , and PAX8; proliferative genes like MET, VNN1 , and MUC1 ; as well as genes involved in matrix remodeling, including SPP1 , ITGA3 , and LAMA5 ( Figure S2 B). Moreover, the expression of these genes in EAOC tissue was significantly higher than in EM and normal endometrial tissues, suggesting that EAOC is not only characterized by epithelial tissue specificity but may also exhibit tumor-specific gene expression as the tumor progresses. To further elucidate the origin and progression of EAOC, the trajectory analysis of epithelial clusters was constructed, and the results showed two distinct trajectories and three states of differentiation. Integrating the pseudo-time and spatial information, the bifurcation spots from endometriosis and EAOC were determined ( Figure 1 F), suggesting that the epithelial cells in endometriosis undergo dedifferentiation to malignancy before progressing into cancer. KEGG enrichment analysis of high-expression genes in state 1 was conducted, and the IL-17 signaling pathway was significantly enriched and IL17C/IL-17RE signaling pathway was hyper-activated in the epithelial cluster ( Figures 1 G and S3 ). IL-17 is an important factor in endometriosis, and high IL-17RE expression in peritoneal fluid has been identified in severe endometriosis patients. 17 However, the expression of IL-17C in endometriosis tissues and EAOC has not been reported to date. ST (spatial transcriptomics) plots showed that IL-17C was only minimally transcribed in stromal cells in endometriosis and became activated as the cells started malignant transformation, with the prominent expression being IL-17RE ( Figure 2 A). In human specimens, IHC demonstrated IL-17C and IL-17RE expression was absent in normal endometrium. However, the expression of IL-17C was increased in the epithelia of EAOC rather than in the endometriotic cells of EM. In addition, the presence of immunoreactive IL-17RE was demonstrated in endometriotic epithelial cells and endometriotic stromal cells and the intensity of immunostaining increased greatly in cancer cells of ovarian cancer compared with the endometriotic cells of endometriosis ( Figure 2 B; Table S3 ). Western blot analysis confirmed an increased expression of IL-17C and IL-17RE protein in EAOC compared to EM or normal tissue ( Figure 2 C). Figure 2 High peritoneal fluid IL-17C level is associated with endometriosis carcinogenesis (A) Spatial distribution and deconvolution values for the expression of IL-17C and IL-17RE. (B) Immunohistological staining for IL-17C and IL-17RE in normal endometrium, EMs, and EAOC tissues ( n = 15 per group). (C) Representative western blot quantitative analysis of IL-17C and IL-17RE in tissues ( n = 9 per group). (D) Quantification of IL-17C in peritoneal fluid between normal ( n = 25), EMs ( n = 28), and ovarian cancer patients ( n = 29). (E) ROC curves of peritoneal fluid IL-17C from patients with EMs and ovarian patients. (F) Tumor size comparison between high IL-17C level ( n = 15) and low-level ( n = 14) IL-17C patients. (G) Peritoneal fluid IL-17C level was compared between patients with high TNM stage (I/II) ( n = 20) and low TNM stage (III/IV) ( n = 9). (H) Overall survival in ovarian cancer patients. Data are represented as mean ± SEM. One-way ANOVA with Tukey’s post-hoc test for Figures 2 A–2D, and 2-tailed Student’s t test for Figures 2 F and 2G. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001, and ∗∗∗∗ p < 0.0001 for the indicated comparisons. Scale bars, 100 μm. High peritoneal fluid IL-17C level is associated with endometriosis carcinogenesis (A) Spatial distribution and deconvolution values for the expression of IL-17C and IL-17RE. (B) Immunohistological staining for IL-17C and IL-17RE in normal endometrium, EMs, and EAOC tissues ( n = 15 per group). (C) Representative western blot quantitative analysis of IL-17C and IL-17RE in tissues ( n = 9 per group). (D) Quantification of IL-17C in peritoneal fluid between normal ( n = 25), EMs ( n = 28), and ovarian cancer patients ( n = 29). (E) ROC curves of peritoneal fluid IL-17C from patients with EMs and ovarian patients. (F) Tumor size comparison between high IL-17C level ( n = 15) and low-level ( n = 14) IL-17C patients. (G) Peritoneal fluid IL-17C level was compared between patients with high TNM stage (I/II) ( n = 20) and low TNM stage (III/IV) ( n = 9). (H) Overall survival in ovarian cancer patients. Data are represented as mean ± SEM. One-way ANOVA with Tukey’s post-hoc test for Figures 2 A–2D, and 2-tailed Student’s t test for Figures 2 F and 2G. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001, and ∗∗∗∗ p < 0.0001 for the indicated comparisons. Scale bars, 100 μm. Furthermore, the peritoneal fluid concentration of IL-17C was quantified by ELISA and demonstrated that IL-17C concentrations were significantly higher in patients with ovarian cancers than in patients with EMs and healthy controls ( p < 0.0001), and peritoneal IL-17C levels were elevated in patients with EMs compared with controls ( p < 0.0001) ( Figure 2 D). A receiver operating characteristic (ROC) curve was constructed for determining the best cutoff value of IL-17C concentration; the area under the ROC curves was calculated to evaluate the significant difference of IL-17C concentration in peritoneal fluid between endometriosis and ovarian cancer patients. It showed that IL-17C concentration was significantly associated with malignancy (area under the curve = 0.842, 95% confidence interval [CI]: 0.742–0.943, and p = 0.0001), and the optimal cutoff value of IL-17C concentration was 27.75 ( Figure 2 E). High IL-17C levels were observed in patients with ovarian cancer, and there was a significant association between IL-17C concentration and tumor size and Federation of Gynecology and Obstetrics stage. Tumors with a high IL-17C concentration tended to be larger than those with a low IL-17C concentration ( p = 0.0011) ( Figure 2 F). Peritoneal IL-17C levels was lower in stage I/II (28.16 ± 6.17) than in stage III/IV (34.06 ± 8.28) ( p = 0.04) ( Figure 2 G; Table S4 ). Online clinical databases showed that IL-17C correlated with overall survival in ovarian cancer patients (hazard ratio = 0.7004, 95% CI: 0.4839–1.0141, p = 0.0329) ( Figure 2 H). EMT is an important process of cell remodeling by the gradual loss of epithelial features and acquisition of mobility and invasive potential, which facilitates malignant transformation of cells. 29 , 32 ST analysis demonstrated increased proliferation scores and decreased adhesion scores in EAOC tissue compared with EM tissue ( p < 1.4e−10 and p < 2.22e−16, respectively) ( Figure S4 A). The MOR106 antibody has been shown to be able to neutralize IL-17C and block the IL-17C/IL-17RE interaction in humans and mice. 16 In view of the emerging significance of soluble IL-17C in endometriosis and EAOC, recombinant human IL-17C (rhIL-17C), anti-IL-17RE, and MOR106 were used to assess the role of IL-17C in malignant transformation of endometriotic cells. In vitro , the presence of immunoreactive IL-17C and IL-17RE was demonstrated in the endometriotic cell lines 11Z and 12Z. After treatment with different concentrations of rhIL-17C for 24 h, 100 ng/mL IL-17C significantly enhanced the expression of IL-17RE mRNA ( Figure S4 B), and 100 ng/mL IL-17C was used in subsequent experiments. Proliferating cell nuclear antigen (PCNA) is a marker of cell proliferation and shows higher expression in cancer than in endometriosis 33 and could be used to determine the potential of endometrial malignancy. 34 Immunofluorescence results demonstrated an augmented expression of PCNA in IL-17C-treated cells compared to that in the control, while it was reduced following treatment with 1 μg/mL IL-17RE antibody (anti-IL-17RE) for 24 h ( Figure S4 D). Western blot results demonstrated that E-cad levels decreased, whereas N-cad and vimentin levels were elevated upon rhIL-17C administration ( Figure S4 C). In contrast, MOR106 (1 μg/mL) treatment for 24 h resulted in unregulated E-cad, and downregulated vimentin, N-cad, and PCNA in rhIL-17-treated endometriotic cells ( Figures S4 C and S4D). These data demonstrated that EMT is involved in IL-17C-mediated cellular transformation of endometriotic cells. In addition, changes in cell phenotype can indicate a difference in the ability of cells to adhere to collagen and plastic. IL-17C-treated cells displayed an increase in colony-forming capacity, a tendency toward reduced adhesion to collagen IV, and greater cellular motility and invasion, while the IL-17RE antibody partially reduced the colony-forming capacity, adhesion, migration, and invasion of 11Z and 12Z cells. Meanwhile, IL-17C-induced adhesion, migration, and invasion were abrogated upon MOR106 administration ( Figures S4 E–S4G). Consequently, these results demonstrated that IL-17C exerted a favorable impact on the malignant transformation of endometriotic cells by activating the IL-17C-IL-17RE axis. Epithelial cells display phenotypic alteration during EM carcinogenesis. 35 The ST data demonstrated that the epithelial cells contained 5 subgroups, which are interspersed throughout the endometrial tissue without distinct regional characteristics. However, in EAOC tissues, these subgroups display clear regional partitioning features. Notably, cluster 7 is located in the region with the highest malignancy of the tumor and shows a gradually increasing proportion in normal endometrium, EM, and EAOC tissues. This trend may suggest the potential role of cluster 7 as a hallmark of EAOC. Therefore, cluster 7 was specifically investigated to analyze the uniquely upregulated genes and the enriched biological pathways. Compared to other clusters, the PI3K signaling pathway was hyperactivated in cluster 7 ( Figure S5 A). Accordingly, western blot results demonstrated that phosphorylation of PI3K and AKT levels was increased in ovarian cancer tissues compared with the EMs and normal tissues ( Figure S5 B). In vitro , rhIL-17C administration increased the phosphorylation of activation proteins PI3K and AKT compared with the untreated cells, while MOR106 reversed the IL-17C-induced upregulation of the expression of PI3K/AKT pathway-related proteins, as ascertained by western blot analysis ( Figure S5 C). Previously reported EMT gene sets were used to measure and identify the degree of malignancy in different clusters. 36 PI3K-AKT signaling is implicated in EMT regulation 37 , 38 , 39 and is a salient key differentially expressed pathway in EAOC tissue ( Figure 1 G). Furthermore, the PI3K-AKT inhibitor LY294002 was used alone or together with rhIL-17C in 11Z and 12Z. 10 μM LY294002 enhanced E-cad expression and reduced the expression of vimentin, N-cad, p-PI3K, and p-AKT ( Figure S5 D). Functionally, rhIL-17C-induced cell migration and invasion were suppressed by LY294002 ( Figure S5 E). These data suggested that Il-17C could activate PI3K/AKT signaling in endometriotic cells. Knockdown of IL-17RE in endometriotic cells was established and the downregulation of IL-17RE was confirmed at the mRNA and protein levels ( Figure 3 A). As expected, IL-17RE knockdown reduced cell proliferation, adhesion, migration, and invasion ( Figures 3 B–3E); reduced EMT in IL-17C-induced endometriotic cells by upregulating E-cad and downregulating N-cad and Vim expression; and downregulated p-PI3K and p-AKT levels with IL-17RE activation by rhIL-17 in 11Z and 12Z cells ( Figures 3 F and 3G). Figure 3 Effect of IL-17C on malignant transformation in IL-17RE knockdown and overexpressed endometriotic cells (A) qPCR and western blot assay were used to measure the transfection efficiency and IL-17RE expression of si-IL-17RE in 11Z and 12Z. (B) Immunofluorescence staining reveals the effect of rhIL-17C on the expression of PCNA in IL-17RE knockdown 11Z and 12Z. (C–E) (C) Colony formation, (D) adhesion, and (E) migration and invasion were detected in parallel 11Z and 12Z cultures. (F and G) Western blot analysis was used to detect the expression of EMT-related and PI3K pathway key proteins in IL-17RE knockdown cells with or without rhIL-17C for 24 h. (H–J) (H) Immunohistological staining of PCNA, (I) colony formation, and (J) migration and invasion was detected in IL-17RE-overexpressing 11Z and 12Z with and without MOR106 treatment for 24 h. (K) Western blot analysis was used to detect the expression of EMT-related and (L) PI3K pathway key proteins in 11Z and 12Z with and without MOR106 treatment. n = 3 biological replicates. Data are represented as mean ± SEM. ∗ p < 0.05 and ∗∗ p < 0.01 for the indicated comparisons. Differences between groups were assessed using one-way ANOVA with Tukey’s post-hoc test. ns, not significant. Scale bars, 100 μm. Effect of IL-17C on malignant transformation in IL-17RE knockdown and overexpressed endometriotic cells (A) qPCR and western blot assay were used to measure the transfection efficiency and IL-17RE expression of si-IL-17RE in 11Z and 12Z. (B) Immunofluorescence staining reveals the effect of rhIL-17C on the expression of PCNA in IL-17RE knockdown 11Z and 12Z. (C–E) (C) Colony formation, (D) adhesion, and (E) migration and invasion were detected in parallel 11Z and 12Z cultures. (F and G) Western blot analysis was used to detect the expression of EMT-related and PI3K pathway key proteins in IL-17RE knockdown cells with or without rhIL-17C for 24 h. (H–J) (H) Immunohistological staining of PCNA, (I) colony formation, and (J) migration and invasion was detected in IL-17RE-overexpressing 11Z and 12Z with and without MOR106 treatment for 24 h. (K) Western blot analysis was used to detect the expression of EMT-related and (L) PI3K pathway key proteins in 11Z and 12Z with and without MOR106 treatment. n = 3 biological replicates. Data are represented as mean ± SEM. ∗ p < 0.05 and ∗∗ p < 0.01 for the indicated comparisons. Differences between groups were assessed using one-way ANOVA with Tukey’s post-hoc test. ns, not significant. Scale bars, 100 μm. Meanwhile, an IL-17RE overexpression plasmid was constructed and endometriotic cells were transfected with the IL-17RE plasmid (Ad- IL-17RE ). There was significantly higher expression of IL-17RE in Ad- IL-17RE cells compared to empty vector (Ad-Vector), as evaluated by fluorescence and RT-qPCR green fluorescence ( Figure S6 ). Ad-IL-17RE cells demonstrated a higher positive rate of PCNA staining, increased colony-forming capacity, migration, and invasion in 11Z and 12Z cells, which could be inhibited by MOR106 ( Figures 3 H–3J). In addition, IL-17RE overexpression alone increased the N-cad, vimentin, p-PI3K, and p-AKT and reduced E-cad protein levels to a similar extent as IL-17C treatment, while the effects were completely abrogated upon MOR106 administration ( Figures 3 K and 3L). These data demonstrated that IL-17C-activated IL-17RE promotes EMT and malignant transformation through the PI3K/AKT pathway in endometriotic cells. Organoids can maintain the genetic stability of the original tissue and are, therefore, more physiological than 2-dimensional culture of cell lines. 40 Endometrial organoids are regarded as a reliable model for endometriosis research. 41 , 42 To investigate the effects of IL-17C, endometrial organoids were established from primary endometrial tissue. Morphological analysis by phase contrast imaging demonstrated the generation of cystic organoids as indicated by the presence of lumen inside the organoids and their expansion in vitro ( Figure 4 A). 100 ng/mL rhIL-17C significantly promoted organoid growth and cell proliferation after incubation for 24 h ( Figure 4 B). H&E staining revealed the presence of well-defined epithelial cells around the lumen in the endometrial organoids, and a proliferation and migratory morphology in the cells from the epithelial lining toward the lumen was observed in the rhIL-17C-treated organoids ( Figure 4 E). Immunofluorescence staining demonstrated that IL-17RE was expressed in endometrial organoids, and endometrial organoids cultured for 24 h in the presence of rhIL-17C were significantly larger than controls and had enhanced expression of IL-17RE ( Figure 4 C). The expression of EDU, vimentin, and N-cad was increased and E-cad was reduced in rhIL-17C-treated organoids ( Figures 4 D and 4E). These findings suggested that IL-17C exerted a favorable impact on the proliferation and EMT of endometrial cells. In addition, transmission electron microscopy 34 is a useful adjuvant method of detecting the cellular transition from pre-malignant to malignant status. 43 Ultrastructurally, after rIL-17C treatment, organoids exhibit distortion of stratification, a group of cells with “bushy” microvilli, expanded extracellular space and decreased desmosome number, and condensed nuclear chromatin and mitochondria rich in cristae ( Figure 4 G), suggesting that they are involved in functional energy metabolism and cell adhesion. In contrast, anti-IL-17RE and MOR106 (1 μg/mL) treatment for 24 h reduced cellular growth, adhesion, and proliferation and downregulated EMT and PI3K pathway activities in IL-17-treated endometrial organoids ( Figures 4 B–4G). Furthermore, we used the 12Z cell line in 3-dimensional culture and demonstrated the effects of IL-17C on EMT features of endometriotic cells ( Figure S7 ). Consequently, these results confirmed the consistency of the propensity for malignant transformation in IL-17-treated endometrial organoids. Figure 4 IL-17C promotes endometrial organoid growth and EMT (A) Expansion and morphology of endometrial organoids. (B) Quantification of organoid size and endometrial gland spheres for rIL-17-treated, anti-IL-17RE-treated-treated, and MOR106-treated organoids and control following rIL-17 administration for 24 h . (C–F) (C) Immunofluorescence staining of IL-17RE and (D) EDU; (E) H&E and immunofluorescence staining of vimentin, E-cad and N-cad; and (F) immunoflourescence staining of p-PI3K and p-Akt expression. (G) Electron microscopy. n = 3 biological replicates. Data are represented as mean ± SEM. ∗ p < 0.05, ∗∗ p < 0.01, and ∗∗∗ p < 0.001 for the indicated comparisons. Differences between groups were assessed using one-way ANOVA with Tukey’s post-hoc test. ns, not significant. Scale bars, 300 μm in (B), 100 μm in (C–F), and 2 μm in (G). IL-17C promotes endometrial organoid growth and EMT (A) Expansion and morphology of endometrial organoids. (B) Quantification of organoid size and endometrial gland spheres for rIL-17-treated, anti-IL-17RE-treated-treated, and MOR106-treated organoids and control following rIL-17 administration for 24 h . (C–F) (C) Immunofluorescence staining of IL-17RE and (D) EDU; (E) H&E and immunofluorescence staining of vimentin, E-cad and N-cad; and (F) immunoflourescence staining of p-PI3K and p-Akt expression. (G) Electron microscopy. n = 3 biological replicates. Data are represented as mean ± SEM. ∗ p < 0.05, ∗∗ p < 0.01, and ∗∗∗ p < 0.001 for the indicated comparisons. Differences between groups were assessed using one-way ANOVA with Tukey’s post-hoc test. ns, not significant. Scale bars, 300 μm in (B), 100 μm in (C–F), and 2 μm in (G). Since endometriosis peritoneal microenvironment can induce IL-17C activation, and IL-17C promotes malignant transform of endometriotic cells, we hypothesized that eliminating IL-17C may provide therapeutic effects on EM. IL-17C KO mice were generated by using CRISPR-Cas9 genome editing technology (Shanghai Model Organisms Center, Inc. China). Briefly, exon 1 of IL-17C gene was deleted by using injection of two individual gRNAs (guide RNA) with human codon-optimized Cas 9 mRNA ( Figure 5 A). Successful generation of the IL-17C-deficient mice was assessed by targeted deep sequencing and further confirmed by PCR amplification of genomic DNA from the wild-type (WT) and mutant alleles ( Figure S8 ). Furthermore, the endometrium-rich fragments were transplanted into the peritoneum of WT and IL-17C -KO mice to induce endometriosis, followed by euthanasia and blood and tissue collection on week 2 ( Figures 5 A and 5B). While no body weight difference between the groups was observed ( Figure S9 A), the KO mice showed a significant reduction in lesion volume both macroscopically ( Figure 5 C) and histologically ( Figure 5 D), with an approximately 90% decrease in the concentration of peritoneal fluid IL-17C ( Figure 5 E). IHC staining demonstrated that IL-17RE expression was reduced in both the epithelial and stromal compartments in ectopic lesions of KO as compared with WT mice ( Figure 5 G). Immunofluorescence staining and western blot analysis demonstrated a reduced expression of vimentin and N-cad ( Figures 5 F and 5H), which was accompanied by an increased expression of E-cad, p-PI3K, and p-Akt in ectopic lesions of KO as compared with WT mice, suggesting that IL-17C deletion in the peritoneal compartment reduces lesional IL-17RE response and endometriosis burden. Figure 5 IL-17C-KO inhibits ectopic lesion growth in mice (A and B) Schematic diagram of a mouse model of endometriosis in IL-17C KO mice. (C and D) (C) Representative macroscopic observation and (D) H&E staining and quantification of endometriotic lesions. n = 5 mice per genotype, respectively. (E) The level of IL-17C in peritoneal fluid samples was determined by ELISA. (F and G) (F) Immunostaining of E-cad, vimentin, and N-cad and (G) IL-17RE expression quantification of intensity in endometriotic lesions. (H) Western blot analysis was used to detect the expression of EMT-related and PI3K pathway key proteins, n = 5 animals per genotype. Data represent the mean ± SEM. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001, ∗∗∗∗ p < 0.0001 by 2-tailed Student’s t test. Scale bars, 100 μm. IL-17C-KO inhibits ectopic lesion growth in mice (A and B) Schematic diagram of a mouse model of endometriosis in IL-17C KO mice. (C and D) (C) Representative macroscopic observation and (D) H&E staining and quantification of endometriotic lesions. n = 5 mice per genotype, respectively. (E) The level of IL-17C in peritoneal fluid samples was determined by ELISA. (F and G) (F) Immunostaining of E-cad, vimentin, and N-cad and (G) IL-17RE expression quantification of intensity in endometriotic lesions. (H) Western blot analysis was used to detect the expression of EMT-related and PI3K pathway key proteins, n = 5 animals per genotype. Data represent the mean ± SEM. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001, ∗∗∗∗ p < 0.0001 by 2-tailed Student’s t test. Scale bars, 100 μm. To verify the effects of IL-17C and IL-17RE in vivo , IL-17RE gene was overexpressed by adenoviral vector (Ad- IL-17RE ) ( Figure 6 A). Endometriosis was induced in female C57BL/6J injecting mice endometrial fragments for two weeks and endometriosis mice received 1 × 10 9 PFU Ad- IL-17RE or Ad-vehicle (NC) ( Figure 6 B). No body weight difference between the groups was observed during the experiment ( Figure S9 B). Seven days after peritoneal implantation, the volume of the endometriotic lesions in the IL-17RE overexpression group was increased compared with that in the NC and control group ( Figure 6 C). H&E staining confirmed gland-like structures in harvested ectopic endometrial tissues; the fluorescence of EGFP-labeled endometrial tissue-implanted recipient mice was observed in both groups, which was as expected in accordance with the expression of adenoviral particles ( Figures 6 D and 6E). IHC demonstrated that IL-17RE was expressed in ectopic endometrial epithelial cells, and the immunohistochemical reactive score was increased in the Ad-IL-17RE group compared with control and NC groups ( Figure 6 D). The concentration of peritoneal fluid IL-17C was increased in IL-17RE-overexpressing endometriosis mice ( Figure 6 F). Furthermore, IL-17RE overexpression significantly reduced E-cad expression and enhanced vimentin, N-cad, p-PI3K, and p-Akt expression in ectopic tissues, as ascertained by IHC and western blot analysis ( Figures 6 G and 6H). To determine whether IL-17C signaling links to PI3K, the PI3K inhibitor (LY294002) 10 mg/kg was used to treat in endometriosis mice. LY294002 and IL-17C administration demonstrated efficiency in restoring lesional size, decreasing IL-17C-induced upregulation of EMT and PI3K activities ( Figure S10 ). Figure 6 Overexpression of IL-17RE promotes ectopic lesion growth and carcinogenesis during endometriosis in mice (A)Viral expression vector backbone. (B) Schematic diagram of a mouse model of endometriosis in IL-17RE overexpression mice. (C) Representative macroscopic observation and quantification of endometriotic lesions. (D) Immunofluorescence staining of EGFP and IL-17RE expression in endometriotic lesions. (E) H&E staining and quantification of endometriotic lesions. (F) The level of IL-17C in peritoneal fluid samples was determined by ELISA. (G) E-cad, vimentin, and N-cad expression was detected by immunostaining analysis. (H) Western blot analysis was used to detect the expression of EMT-related and PI3K pathway key proteins, n = 5 animals and 3 randomly selected areas per group. Data represent the mean ± SEM. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001 by one-way ANOVA with Tukey’s post-hoc test. ns, not statistically significant. Scale bars, 100 μm. Overexpression of IL-17RE promotes ectopic lesion growth and carcinogenesis during endometriosis in mice (A)Viral expression vector backbone. (B) Schematic diagram of a mouse model of endometriosis in IL-17RE overexpression mice. (C) Representative macroscopic observation and quantification of endometriotic lesions. (D) Immunofluorescence staining of EGFP and IL-17RE expression in endometriotic lesions. (E) H&E staining and quantification of endometriotic lesions. (F) The level of IL-17C in peritoneal fluid samples was determined by ELISA. (G) E-cad, vimentin, and N-cad expression was detected by immunostaining analysis. (H) Western blot analysis was used to detect the expression of EMT-related and PI3K pathway key proteins, n = 5 animals and 3 randomly selected areas per group. Data represent the mean ± SEM. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001 by one-way ANOVA with Tukey’s post-hoc test. ns, not statistically significant. Scale bars, 100 μm. The blocking of IL-17RE resulted in the inhibition of proliferation and transformation abilities of endometriotic cells, suggesting that IL-17RE is required for tumorigenicity during endometriosis, and that its ligand IL-17C may also be critical in this process. MOR106 antibody (10 mg/kg) that neutralizes IL-17C or IgG control antibody was used to treat in endometriosis mice. MOR106 treatment significantly reduced the size and number of endometriotic lesions in mice ( Figures S11 A and S11B). Furthermore, the concentration of IL-17C was decreased in the peritoneal fluid of MOR106-treated mice compared with controls ( p < 0.001) ( Figure S11 C). In addition, MOR106 treatment enhanced E-cad expression and reduced vimentin, N-cad, and p-PI3K and p-AKT protein expression in ectopic tissues ( Figures S11 D and S11E). Furthermore, an ovarian endometriosis mouse model was established using a minimally invasive surgical technique ( Figure S12 ). The results showed that MOR106 treatment resulted in the growth of endometriotic lesions and the upregulation of EMT and PI3K pathway activities in ovarian endometriosis ( Figures 7 A–7F). These data demonstrate that targeting IL-17C with MOR106 significantly attenuated the progress of endometriosis. Figure 7 IL-17C neutralization attenuates ectopic lesion growth and tumorigenicity of in ovarian endometriosis mice (A) Representative macroscopic observation. (B) H&E staining and quantification of the endometriotic lesions. (C) The level of IL-17C in peritoneal fluid samples was determined by ELISA. (D and E) (D) Immunostaining of IL-17RE and (E) E-cad, vimentin, and N-cad expression in ovarian endometriotic lesions. (F) Western blot analysis of EMT-related and PI3K pathway key proteins’ expression. n = 5 animals and 3 randomly selected areas per group. Data represent the mean ± SEM. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001, ∗∗∗∗ p < 0.0001 by one-way ANOVA with Tukey’s post-hoc test. Scale bars, 100 μm. OEM. ovarian endometriosis. IL-17C neutralization attenuates ectopic lesion growth and tumorigenicity of in ovarian endometriosis mice (A) Representative macroscopic observation. (B) H&E staining and quantification of the endometriotic lesions. (C) The level of IL-17C in peritoneal fluid samples was determined by ELISA. (D and E) (D) Immunostaining of IL-17RE and (E) E-cad, vimentin, and N-cad expression in ovarian endometriotic lesions. (F) Western blot analysis of EMT-related and PI3K pathway key proteins’ expression. n = 5 animals and 3 randomly selected areas per group. Data represent the mean ± SEM. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001, ∗∗∗∗ p < 0.0001 by one-way ANOVA with Tukey’s post-hoc test. Scale bars, 100 μm. OEM. ovarian endometriosis.

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Ping Li ( [email protected] ). This study did not generate unique reagents. • The raw sequencing data in this study have been deposited in Gene Expression Omnibus (GEO: GSE291389 ). The remaining data are available within the article and supplemental information . • This paper does not report original code. • Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request. The raw sequencing data in this study have been deposited in Gene Expression Omnibus (GEO: GSE291389 ). The remaining data are available within the article and supplemental information . This paper does not report original code. Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.

It is well known that local inflammation and immune signaling activation contribute to the acquisition of metastatic features in endometriosis 29 , 44 and endometriosis carcinogenesis. 45 However, how endometriotic cells are induced to undergo malignant transformation remains unknown. The present study demonstrated the comprehensive spatiotemporal transcriptome profiling of tissues from normal endometrium, EMs, and EAOC cases, and determined that the IL-17C/IL-17RE axis is instrumental in carcinogenesis of endometriotic lesions. The IL-17C concentration in peritoneal fluid was significantly higher in women with ovarian cancer than in endometriosis subjects. IL-17C induced malignant transformation in both endometriotic epithelial cells and endometrial organoids, as evidenced by a higher efficiency of proliferation, increased cellular adhesion, and invasion capacity, which was mediated by IL-17RE. IL-17C-activated IL-17RE promoted EMT through the PI3K pathway. Targeting IL17RE or blocking IL-17RE or neutralizing IL-17C significantly reduced cellular proliferation, adhesion, and invasion capacities. IL-17RE has not been previously reported to be involved in EAOC; however, in the present study we have shown that IL-17C/IL-17RE interactions are fundamental for endometriosis carcinogenesis. Ovarian cancer is the deadliest gynecologic cancer, and 70% of cases are diagnosed with advanced-stage disease. While significant advances have been made in surgical treatment, chemo-based treatments, and combination treatment such as bevacizumab and poly(adenosine diphosphate-ribose) polymerase inhibitors for ovarian cancer, 70% of cases will recur and eventually become chemoresistant; therefore, further therapeutic approaches are needed to significantly improve the situation. 46 , 47 By far, immunotherapy has resulted in the greatest shift in treatment over the past decade. However, it remains an obstacle to develop targeted approach for ovarian cancer. 48 It has been proposed that the endometriotic cells are deposited in the pelvic cavity via retrograde menstruation, which is closely regulated by the immune system of the peritoneal fluid. 49 , 50 Several studies have characterized the transcriptomic profiles of epithelial cells from normal endometrium and EMs, demonstrating an activation of the complement pathway in the context of EMs specifically. 10 The complement system has been shown to modulate IL-17 production, 51 and complement components and IL-17 are both altered in peritoneal fluid from women with endometriosis. 17 , 52 , 53 Peritoneal fluid IL-17 has been implicated in the pathogenesis of endometriosis by inducing the production of cytokines such as IL-1β, IL-6, and IL-8. 13 , 54 In particular, the configuration of peritoneal fluid as a tumor microenvironment is fundamental for the development and progression of various cancers. Contrary to other epithelial cancers, ovarian tumor cells are more reliant on peritoneal fluid in the peritoneal cavity in ovarian cancer. 48 The cytokines in peritoneal fluid, including IL-1, IL-6, and IL-8, may contribute to the facilitation of invasiveness of ovarian cancer cells, 23 , 24 suggesting their potential role as mediators between EMs and ovarian cancer. Clear cell carcinoma is the most frequent EAOC type, arising from EMs in 50%–70% cases. 55 EMs carry the highest risk of progression to EAOC because the epithelial cells have a high mutation burden during the formation of the cyst and are critical in the determination of cancerous clonality. 35 , 56 , 57 The immune microenvironment is one of the leading factors to induce or directly influence the development of EAOC. 58 In our EAOC samples, the co-existence of endometriotic lesions and clear cell cancer within the ovary, demonstrate a direct continuity and a transitioning entity from precancerous lesions to a malignant variant. By analyzing the transcriptomic changes in epithelial cells at different stages, it showed that the IL-17C/IL-17RE pathway is significantly unregulated along the process of endometriosis carcinogenesis. It also indicated that the concentration of IL-17C was markedly increased in the peritoneal fluid of patients with ovarian cancer and not in their cancerous tissues. Meanwhile, there was a concomitant and specific expression of IL-17RE in the epithelial cells of EMs and EAOC cancerous cells, prone to respond to peritoneal fluid IL-17C, which may promote EM carcinogenesis. Previous studies suggest that IL-17C and IL-17RE not only mediate inflammatory and autoimmune disease 16 , 21 , 59 but also are involved in the regulation of carcinogenesis; blocking IL-17C signaling resulted in reduced tumor growth in respiratory and intestinal cancers. 26 , 60 , 61 Specifically, increases in the level of IL-17A and IL-17C in peritoneal fluid are correlated with the severity of endometriosis. 17 , 19 However, IL-17A exhibits an active role in both endometriosis and ovarian cancer, but no trials have been conducted thus far for IL-17A therapeutic agents in ovarian cancer. 62 Furthermore, IL-17A is produced late mainly by infiltrated Th17 cells, and functions as an inflammatory mediator within the tumor microenvironment, 63 , 64 and is expressed universally, whereas IL-17RE is expressed only on epithelial cells. 65 , 66 , 67 , 68 Importantly, IL-17C is induced earlier than IL-17A and directly enhances tumor cell survival during carcinogenesis. 60 In this study, the IL-17C-IL-17RE axis contributed to ectopic lesion growth and tumorigenicity of endometriosis, which was verified in our mice endometriosis model. Cancer follows a complex evolutionary path, in which ovarian carcinogenesis or EAOC often has a distinct PI3K pathway activation profile. 69 , 70 , 71 Although little is known about the downstream mediators of IL-17C induction, it has been shown that IL-17 induction may involve nuclear factor κB, PI3K, and p38 MAPK. 72 , 73 , 74 , 75 The present study showed that EMT occurs in cells expressing IL-17RE, with significant activation of the epithelial PI3K pathway coinciding with increasing concentrations of IL-17C. In vitro , IL-17C has the ability to increase IL-17RE expression and transform endometriotic epithelial cells into cancerous cells with properties including higher proliferation, increased propensity to adhere to collagen, and greater capacity to invade the basement membrane. In addition, IL-17RE is mainly expressed on endometriotic epithelial cells and EAOC cancer cells; IL-17RE knockdown significantly reduced IL-17C-mediated proliferation and migration, EMT, and activation of the PI3K signaling pathway. Additionally, the observed EMT induction by IL-17RE overexpression in the absence of IL-17C ligand suggests a ligand-independent activation mechanism, which aligns with emerging paradigms in cytokine receptor biology. One possible mechanism for IL-17RE activation in the absence of its ligand IL-17C is ligand-independent receptor activation, a phenomenon observed in other cytokine receptors (e.g., IL-17RA), which can initiate intracellular signaling cascades even in the absence of ligand binding. 76 This kind of activation is supported by the notion that overexpression of cytokine receptors can lead to constitutive receptor dimerization, which triggers downstream signaling pathways. 77 Thus, blocking the IL-17RE-IL-17C-IL-17RE axis eliminated downstream signaling in response to rIL-17C treatment or reversed rIL-17C-mediated enhancement of proliferation and migration in endometriotic epithelial cells. These results demonstrated that IL-17C-mediated activation of IL-17RE and intracellular signal transduction and blocking IL-17RE may provide a potential target for inhibiting malignant progression of endometriosis in the context of high IL-17C accumulation. In summary, by taking advantage of human specimens of normal endometrium, EMs and EAOC, using ST analysis, functional assays in vitro , and in vivo experiments, the present study identified peritoneal fluid IL-17C as a critical factor that initiates endometriosis carcinogenesis, although it still needs to be determined how IL-17C is produced in the endometriosis environment. IL-17RE is activated by IL-17C and affects the PI3K signaling pathway. This IL-17C/IL-17RE/PI3K axis drives EMT in endometriotic epithelial cells, and finally contributes to cellular transformation during endometriosis carcinogenesis. These data identified IL-17C signaling as a driver of endometriosis carcinogenesis and propose IL-17C/IL-17RE as promising therapeutic targets, particularly for EAOC cases characterized by high IL-17C expression. Although several studies have suggested an association between PI3K signaling and EAOC, there is no conclusive evidence demonstrating that PI3K activation drives EMT as a mechanistic pathway in the development of EAOC. However, when interpreting the experimental results of this study, it is essential to consider its inherent limitations. First, the current findings need to be validated in larger animal models, particularly in non-human primates with naturally occurring endometriosis, to enhance their translational relevance. Second, the present research does not comprehensively assess the potential in vivo side effects of MOR106. More extensive pharmacological and toxicological evaluations are required during preclinical development, utilizing animal models that more closely mimic human physiological conditions.

Ovarian cancer is the most fatal gynecological malignancy in the world. It is rare but more common in women with endometriosis, particularly clear cell ovarian carcinomas. 1 Endometriosis-associated ovarian carcinoma (EAOC) occurs in up to 4.5% of endometriosis cases and is mostly caused by malignant transformation from ovarian lesions (endometriomas [EMs]). 2 The incidence of endometriosis has risen in the past decades, with a concomitant increase in the detection of ovarian tumors among patients with EMs. 3 , 4 In a pooled analysis of 13 case-control studies conducted between 1973 and 2011, concomitant endometriosis was highly associated with clear cell (odds ratio [OR], 3.73) and endometrioid (OR, 2.32) cancer. 3 EAOC remains rare overall; however, the prevalence of EAOC is still likely to be underestimated owing to the lack of preventative screening of endometriosis in ovarian cancer. 5 Compared to other ovarian cancers, chemoresistance, worse prognosis, and frequent occurrence at a younger age are unsolved issues in EAOC, 6 , 7 particularly for clear cell subtypes. 8 However, a causal relationship between endometriosis and EAOC remains to be established. 9 , 10 Thus, elucidation of the mechanism of this malignancy is critical to prevent delayed diagnosis and decrease long-term morbidity resulting from EAOC. The proposed endometriosis carcinogenesis involves predominantly genetic alterations, including gene mutations such as those in ARID1A, as well as epigenetic changes, together with inflammatory processes. 5 , 6 Cytokines are diverse proteins that affect the pathogenesis of endometriosis and/or related ovarian cancers. 11 , 12 The interleukin-17 (IL-17) family of cytokines has emerged as important players in endometriosis and ovarian cancers. 11 , 13 , 14 The IL-17 family includes six members from IL-17A to IL-17F. These ligands bind to specific receptors: for instance, IL17A and IL17F signal through the IL-17 receptor A (IL-17RA)/IL17RC, while IL17C primarily utilizes IL17RA/IL17RE. 15 IL-17C, the least well-understood member of the IL-17 family, 16 has recently been described to contribute to the pathogenesis of endometriosis. 17 In particular, peritoneal fluid is believed to influence the development and progression of endometriosis 13 , 18 , 19 , 20 and IL-17RE has been reported in the peritoneal fluid of patients with moderate-/severe-stage endometriosis, particularly those with EMs, 17 which is highly relevant to malignant transformation of endometriosis. Although IL-17A is the most highly related among IL-17 family cytokines in endometriosis, its receptor IL-17RA is expressed ubiquitously. 21 , 22 However, malignant transformation primarily originates from the epithelial cells within endometriotic lesions. Several pro-inflammatory cytokines are significantly elevated in endometriotic lesions and peritoneal fluid, such as tumor necrosis factor alpha, IL-1β, IL-6, and IL-8, which enhance cell survival, proliferation, invasion, angiogenesis, and immune dysregulation, all critical factors enabling malignant transformation. 23 , 24 In particular, IL-17C can create a self-amplification mechanism that allows for sustained inflammatory signaling and acts directly on epithelial cells. 25 Although IL-17RE has not been previously reported to be involved in EAOC or ovarian cancer, targeting IL-17C/IL-17RE shows great potential as treatment for several tumor conditions, such as liver and lung cancers. 26 , 27 However, the mechanism underlying whether IL-17C/IL-17RE within endometriotic lesions supports EAOC development remains to be determined. Endometriosis is defined as the growth of endometrial-like tissue outside the uterus. Several studies have characterized a role for cellular transformation in endometriosis pathogenesis, 28 , 29 and cluster-specific epithelial cells that carry cancer-driver mutations may be the precursors of endometriosis carcinogenesis. 10 Generally, endometriosis and carcinogenesis share clear parallels; however, the mechanism by which endometriotic lesions support EAOC formation is unclear. In the present study, spatial transcriptomics (ST) revealed IL-17RE upregulation and IL-17C pathway activation in tumor epithelia—neither previously associated with EAOC. The elevated concentration of IL-17C level was identified in peritoneal fluid of patients with ovarian cancer and IL-17RE-overexpressed endometriosis mice. Functionally, the role of IL-17C in endometriosis carcinogenesis was found to be disruption of IL-17C/IL-17RE signaling (via IL-17C knockout, pathway blockade, receptor modulation, or IL-17C neutralization) in in vitro , organoid, and murine endometriosis systems. This study established peritoneal fluid-derived IL-17C as a promoter driving ectopic endometrial carcinogenesis and nominated the IL-17C/IL-17RE axis as a promising therapeutic target.

The authors declare no competing interests.

REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti- E-cadherin BD Biosciences Cat#BD610181; RRID: AB_3683579 Rabbit anti-vimentin Cell Signaling Technology Cat#CST5741; RRID: AB_3683580 Rabbit anti-N-cadherin proteintech Cat#22018-1-AP; RRID: AB_2813891 Mouse anti-PI3K Abmart Cat#T0024 Rabbit anti-Phospho-PI3K p85/p55 Abmart Cat#TA3242; RRID: AB_3683581 Rabbit anti-Akt (pan) Cell Signaling Technology Cat#4691; RRID: AB_915783 Rabbit anti-Phospho-Akt (Ser473) Cell Signaling Technology Cat#4060; RRID: AB_2315049 Mouse anti-PCNA Cell Signaling Technology Cat#2586; RRID: AB_216034 Rabbit anti-IL17C Bioss Cat#bs-2611R; RRID: AB_10856082 Rabbit anti-IL17RE proteintech Cat#11984-1-AP; RRID: AB_878037 Mouse anti-CD10 Invitrogen Cat#MA5-14050; RRID: AB_10983979 Rabbit anti-Estrogen Receptor Invitrogen Cat#MA5-14501; RRID: AB_10981779 DAPI Beyotime Biotechnology Cat#C1002 Rabbit anti-α-Smooth Muscle Actin Cell Signaling Technology Cat #19245; RRID: AB_2734735 Normal Human IgG Control RD Cat#1-001-A; RRID: AB_907192 MOR106 bioleaper Cat#BR2010231; RRID: AB_3683582 Mouse anti-IL17RE Recombinant Creative biolabs Cat#NEUT-1237CQ; RRID: AB_3683583 Rabbit anti-β-actin Affinity Biosciences Cat#T0022; RRID: AB_2839417 Bacterial and virus strains Adenoviral Vector OBiO Technology N/A Biological samples normal endometrium Clinic Trial Ethics Committee of Longgang District People’s Hospital See Table S1 for details endometriomas Clinic Trial Ethics Committee of Longgang District People’s Hospital See Table S1 for details EAOC tissue Clinic Trial Ethics Committee of Longgang District People’s Hospital See Table S1 for details blood, peritoneal fluid and fresh tissue Clinic Trial Ethics Committee of Longgang District People’s Hospital See Table S3 for details Chemicals, peptides, and recombinant proteins rhIL-17C R&D Systems 1234-IL-025 LY294002 MCE HY-10108 DMEM medium Gibco C11995500BT fetal bovine serum Gibco 10099141C Advanced DMEM/F12 Thermo Fisher Gibco 12634028 N2 supplement Thermo Fisher Gibco 17502048 B27 supplement minus vitamin A Thermo Fisher Gibco 12587010 Insulin Transferrin Selenium Thermo Fisher Gibco 41400045 Penicilin/Streptomycin Thermo Fisher Gibco 15140122 N-acetyl L-cysteine (NAC) Sigma Aldrich A9165-5G L-Glutamine Thermo Fisher 25030149 Recombinant human EGF Peprotech AF-100-15 Recombinant human HGF Peprotech 100–39 Recombinant human Noggin (NOG) Peprotech 120-10c Recombinant human Rspondin-1 R&D 4645-RS Recombinant human FGF-10 Peprotech 100–26 ALK-4,-5,-7 inhibitor A83-01 Sigma Aldrich SML0788-5MG Nicotinamide Sigma Aldrich N0636 SB202190 (p38i) Sigma Aldrich S7067-5MG 17-β Estradiol a Sigma Aldrich E8750-100MG Y-27632 b Merk Millipore SCM075 Critical commercial assays human IL-17C ELISA kit Jiangsu Boshen Biotechnology BS-E3942H2 mouse IL-17C ELISA kit Jiangsu Boshen Biotechnology BS-E10643M2 Cell Counting Kit-8 Vazyme Biotech A311-01 collagen IV BestBio BB-48123 Mouse HiFi PCR Kit GenStar A158-02 Deposited data Raw and analyzed data This paper GEO: GSE291389 https://www.ncbi.nlm.nih.gov Experimental models: Cell lines The human endometriotic cell line 11Z Dr. Gendie E. Lash N/A The human endometriotic cell line 12Z Zhejiang Meisen Cell Technology CTCC-001-0695 Endometrial organoids This paper N/A Experimental models: Organisms/strains IL-17C knockout (KO) mice Shanghai Model Organisms Center N/A IL-17C knockout (KO) endometriosis mice (C57BL/6J) This paper N/A IL-17RE overexpression endometriosis mice (C57BL/6J) This paper N/A Oligonucleotides qRT-PCR primers Sangon see Table S5 siRNA RiboBio see Table S5 gRNA sequences Shanghai Model Organisms Center see Table S5 Ad-IL17RE OBiO Technology see Table S5 Software and algorithms R (4.4.2) RCoreTeam https://www.R-project.org/ Seurat (5.2.0) Satija Lab satijalab.org/seurat/ ClusterProfiler (4.14.4) Bioconductor bioconductor.org GSVA (2.0.4) Bioconductor bioconductor.org Monocle v.2 (2.34.0) Bioconductor bioconductor.org ImageJ NIH https://imagej.nih.gov/ij/ GraphPad Prism 9.0 Graphpad https://www.graphpad.com/ As endometriosis is relevant only to females, only female mice and humans were involved in the present studies. For the spatial transcriptomics analysis, normal endometrium, endometriomas and EAOC tissue were collected from patients who underwent surgical resection. Each sample was split into 3 parts for performing frozen sections for histological diagnosis, formalin fixed and paraffin-embedded sections for immunohistochemistry analysis, and stored at −80°C for other analyses. The clinical characteristics of enrolled subjects are summarized in Table S1 . Since EAOC presents a low incidence, archival paraffin-embedded specimens of endometriomas synchronous with ovarian carcinoma ( n = 15) were collected for immunostaining analysis. Cases of ovarian cancer ( n = 29) consisting of endometrioid tumor ( n = 20) and clear-cell tumor ( n = 9) were recruited and included as EAOC, 78 and blood, peritoneal fluid and fresh tissue samples were collected and used for ELISA and western blot analysis. Meanwhile, cases of endometriomas ( n = 28) were recruited and blood, cyst fluid and tissue samples collected. Normal endometrium and peritoneal fluid samples ( n = 25) were obtained from age-matched women undergoing interval tubectomy. The clinical characteristics of enrolled subjects are summarized in Table S3 . For endometrial organoids, the eutopic endometrium was obtained from three women of reproductive age who had undergone hysterectomy for uterine leiomyomas. Study enrollment was limited to premenopausal women and excluded patients with an irregular menstrual cycle or a history of hormone use in the 3 months prior to surgery. All endometrium, endometriosis and tumor subjects were confirmed by laparoscopic surgery and postoperative histological examination. The current study was approved by the Clinic Trial Ethics Committee of Longgang District People’s Hospital, Shenzhen, China (approval no. 2022038), and Jinan University School of Medicine (approval no: KY-2023-107). Written informed consent was provided by all participants. The C57BL/6J female mice (aged 6–8 weeks; weight, 18.1 ± 0.1 g) are obtained from Beijing Vital River Laboratory Animal Technology Co., Ltd (China). All the mice were maintained at 22 ± 3°C with 35% ± 5% humidity and a 12:12 h light/dark cycle. IL-17C knockout (KO) mouse was generated by using CRISPR/Cas9 genome editing technology (Shanghai Model Organisms Center, Inc. China). Briefly, pronuclear-staged C57BL/6J zygotes were injected with human codon-optimized Cas9 mRNA transcripts (50 ng/μL) combined with two guide RNAs (120 ng/μL) each. Exon 1 was selected as the target site (gRNA1: CCACAGAGTCTCCTGCTTCTAGG; gRNA2: GGTGCCTGGA A TGTCTGTCCTGG). Cas9 and gRNAs were co-injected into fertilized embryos. For genotyping, genomic DNA was purified from mouse tails using the StarDirect Mouse HiFi PCR Kit (GenStar, A158-02) and identified by gel electrophoresis. IL-17C +/+ (wild-type, WT) primers used for genotyping were 5′- AGGGGCTCCGAAGTATCTGT-3′ and 5′–TAGCCTCAGGCAGAGATGGT-3'. IL-17C −/- (knockout, KO) primers were used for genotyping were 5′-AGGG G CTCCG AAGTATCTGT-3′ and 5′–TAGCCTCAGGCAGAGATGGT-3'. The quality of DNA was assessed by Nanodrop (Thermo Scientific, Wilmington, DE) and a result of 1.8–2 was considered a good quality. For induction of the endometriosis mice model, donor mice were subcutaneously injected with 17-β-estradiol-3-benzoate (100 μg/mouse; E8515, Sigma-Aldrich) and sacrificed 1 week later. The uterus was removed, the two horns were isolated, the myometrium was removed by scraping, and the remaining endometrial tissues were derived and washed twice with PBS and cut into 3 to 5 mm 3 pieces. Each endometrial fragment of equal size was injected into the peritoneum of recipient mice. Each uterus from the donor mouse was evenly distributed between two recipient mice. Then 17-β-Estradiol-3-benzoate (100 μg/mouse) was administered every 3 days. Two weeks later, the endometriosis model was confirmed, the mice were randomly divided into different groups. For overexpression, IL17RE overexpression (Ad- IL17RE) was cloned into the adenoviral vector Ad-GFP, which were verified by DNA sequencing (OBiO Technology Corp., Ltd., Shanghai, China). Endometriosis mice were administrated with Ad-IL17RE (1 × 10 9 PFU/mice), Ad-vector and saline and into the transplants. To observe the infection efficiency, a portion of the endometrial tissues was made into frozen sections and scanned by confocal laser scanning microscopy. Meanwhile, treatment of MOR106 (BR2010231, Shanghai bioleaper biotechnology Co. Ltd., China) was given 10 mg/kg two times a week for one week. The ectopic lesions were dissected, weighed, and embedded into paraffin for future analysis when the mice were sacrificed. For PI3K pathway activity, LY294002 (HY-10108, MCE) was i.p. injected 10 mg/kg in the endometriosis mouse model. Furthermore, an ovarian endometriosis model was established using a minimally invasive surgical technique. 79 Systemic anesthesia was induced and maintained with 3% isoflurane. Bilateral incisions of 5–7 mm were made through the dorsal skin and muscle layers to access the ovaries. Following dissection of the bursal membrane and exposure of the ovarian surfaces, endometrial fragments from a donor mouse were evenly distributed onto each ovary. Finally, the incisions were closed with a Z-suture technique using 4-0 absorbable sutures (Jinhuan Medical, Shanghai, China). All animal experiments were conducted in strict compliance with the specific guidelines of the Committee of Medical Ethics of the National Health Commission, China and adhered to the ARRIVE guidelines. The experimental protocols are approved by the Laboratory Animal Committee of Jinan University (Approval No. IACUC-20231226-02; IACUC-20240326-03; IACUC-20250212-12; IACUC-20250523-07; IACUC-20250603-1). The human endometriotic cell line 12Z was purchased from MeisenCTCC (Zhejiang Meisen Cell Technology Co. Ltd., Zhejiang, China). 11Z was endowed by from Professor Gendie E. Lash (Guangzhou Medical University, China). All cell lines were authenticated by STR(Short Tandem Repeat) analysis and tested free of mycoplasma infection. The cell lines were cultured in DMEM medium (Gibco, USA) supplemented with 10% fetal bovine serum (Gibco, USA) (5% CO 2 , 20% O 2 , 37°C). Moreover, the effects of rhIL-17C (1234-IL-025, R&D Systems), anti-IL-17RE (NEUT-1237CQ, Creative biolabs, USA), MOR106 (BR2010231, Shanghai bioleaper biotechnology Co. Ltd., China) and LY294002 (HY-10108, MCE) were evaluated on cells respectively. In addition, Il-17RE expression level was upregulated or downregulated by infecting with Ad-IL-17RE or siRNA at 70–80% of cell density, respectively. Cell Counting Kit-8 (CCK-8, Vazyme Biotech Co., Ltd., Nanjing, China) was used to examine cell viability. Growth rates were determined by measuring optical density with a microplate reader. Each experiment was performed in triplicate. Endometrial samples were dissociated using collagenase IV (17104019, Thermo Fisher Scientific) and mechanical trituration using a Pasteur pipet for 2 h. The suspension was centrifuged and the pellet resuspended in TrypLE (12604013, Thermo Fisher Scientific) with Rock inhibitor Y27632 (SCM075, Merck Millipore) for 15 min at 37°C. After centrifugation, the pellet was resuspended in 70% Matrigel (356231, Corning) and cultured in DMEM/F12 medium (11330032, Thermo Fisher Scientific), and 20 μL droplets were deposited in prewarmed 48 well plates. Organoids were cultured in medium as described in the Table S5 , and enzymatically dissociated and passaged every 14 days. Unless otherwise stated, organoids of low passage number (P3-P5) were used for the experiments. Human biopsy samples were used for RNA extraction on frozen embedded tissues stored at −80°C to obtain RNA which has good integrity for future spatial transcription experiments. Tissue was smaller than 1 cm × 1 cm in size and snap frozen prior to embedding in Optimal Cutting Temperature (O.C.T.) compound for solidification. The embedded tissues were cryosectioned at 10 μm thickness, processed for ST-seq as per the TBI datasets. After quality control, all 3 samples were merged into a single dataset. Batch effects among the samples were corrected using Harmony by Seurat package (5.2.0). Additionally, UMAP was used for dimensionality reduction, and clustering was performed using the FindClusters function with a resolution set to 0.8. Cell types to cluster assignments were performed based on the most variable features (genes) and revised by a pathologist to confirm with the histological regions. KEGG enrichment analysis was performed using the clusterProfiler package (version 4.14.4) and construct gene set enrichment scores for GO gene sets using the gsva package (version 2.0.4). Monocle v.2 (version 2.34.0), an R package was used to perform the trajectory and pseudo-time analysis. 80 Gene expression data was used for trajectory analysis to find the connections within the cluster. The pseudo time is calculated by the diffusion pseudo time method. In this study, the subclones of cells based on pseudo-temporal analysis were defined as roots, and then the pseudo-space-time distance (PSTD) was calculated. UMI count matrices and the negbinomial.size parameter were used to create a CellDataSet object in the default setting. The filtered variable genes with the following cutoff criteria: genes expressed in more than 10 cells; average expression value >0.1; and Qval <0.01. These variable genes were used for semisupervised trajectory reconstruction. Dimensional reduction and cell ordering were performed using the DDRTree method and the orderCells function. Serum, cyst fluid or peritoneal fluid was obtained from patients and mice during the operation and stored at −70°C until analysis. IL-17C concentrations were measured by human and mouse IL-17C ELISA kit (BS-E3942H2 and BS-E10643M2, Jiangsu Boshen Biotechnology Co., Ltd., Jsbossen, China), and recorded by microplate reader (TZCAN-SAFIRZ-Z, TZCAN, Austria). The sensitivity of the assay was 0.1 pg/mL for human and 1.0 pg/mL for mice. The procedure was performed as the manufacturer indicated and the negative control absorbance at 450 nm was determined. The intraassay and interassay coefficients of variation were less than 5%. Cells were normalized to 3 × 10 5 cells per mL and added 100 μL into 96-well plates that were uncoated or coated with collagen IV (BestBio Company, Shanghai, China) (5). After incubation 24h at 4°C, cells were washed with PBS and fixed for 10 min. Wells were washed again with PBS and stained for 10 min. Stained cells were extensively washed with PBS and absorbance was measured at 450 nm using a microplate reader (Microwin). Paraffin-embedded sections were routinely dewaxed and hydrated, followed by antigen retrieval using Tris/EDTA pH 9.0 buffer. Immunohistochemistry and immunofluorescence staining were performed as previously described. 81 Values were averaged to obtain a value for each tissue. The intensity was quantified using ImageJ (version 1.54j). The number of positive staining cells was semiquantitatively scored by the immunohistochemical reactive scores (IRSs). 81 Photographs were taken using an epifluorescence microscope (Olympus IX51, Leica DM 4000B). Five samples were selected randomly from each group and six fields per sample were photographed and analyzed for quantification (total of at least 30 images per group). qRT-PCR was performed as previously described. 29 Total RNA was extracted using an RNA Extraction Kit (Takara, Shiga, Japan). cDNA synthesis was subsequently carried out via reverse transcription using a PrimeScript RT Reagent Kit with gDNA Eraser (Takara, Shiga, Japan). The specific primers are presented in Table S6 . Total protein was extracted from cells, animal tissues and human tissues using RIPA lysis buffer (89900,Thermo Fisher Scientific). The protein concentration was determined using the BCA protein Assay Kit (P0010,Beyotime). Proteins of the same concentration were separated by SDS-PAGE and transferred onto polyvinylidene fluoride (PVDF) membranes. The PVDF membrane was blocked in TBST with 5% skimmed milk for 30 min and incubated overnight with the primary antibody at 4°C. Membranes were then incubated with the enzyme-labeled secondary antibody for 1 h. Antibodies for western blotting are listed in the key resources table and Table S7 . Bands were detected using Immobilon Western Chemilum HRP Substrate (WBKLS0100, Millipore). The expression of genes was normalized to β-actin. The results are representative of three independent experiments. Organoids were fixed in 2.5% glutaraldehyde and embedded in epoxy resin. The specimens were ultrathin-sectioned, stained with uranium acetate, and examined under a transmission electron microscope (FEI, TECNAI12, USA), as previously described. 82 GraphPad Prism 9.0 Software (GraphPad Software, San Diego, CA) was used for all analyses. The descriptions about statistical details are indicated in the figure legends, text or methods. All data are presented as mean ± standard deviation (SD), median (interquartile range) and number (%), respectively, and p < 0.05 was considered statistically significant. Data are shown as mean immunohistologic intensity per area in arbitrary units. Distribution normality was assessed using the Kolmogorov-Smirnov test. The differences between the groups were analyzed with the Student’s t -test or one-way AVOVA analysis of variance of independent experiments, and a χ2 test was used to evaluate the associations between clinicopathologic variables and IL-17 level. The best cut-off value for IL-17 level was determined based on the receiver operating characteristic (ROC) analysis.

Tissues samples had been collected for research purposes with owner consent. The graphical abstract was created using BioRender.com . This study is supported by 10.13039/501100021171 Guangdong Basic and Applied Basic Research Foundation ( 2024A1515011821 to P.L. and 2023A1515140168 to B.G. and P.L.); the Longgang District Science and Technology Innovation Bureau Project, Shenzhen ( LGKCYLWS2024-9 to M.W. and P.L.); Guangzhou Science and Technology Plan Project ( 2025A04J3471 to H.Z. and 2024A03J0516 to H.S.); Fundamental Research Business Expenses of Central Universities ( 11624322 to H.Z.); and 10.13039/501100001809 National Natural Science Foundation of China (NSFC 81971395 to P.L.).