EXPLORING OF THE AMELIORATIVE EFFECTS OF ETHANOLIC EXTRACT OF THE WHEATGRASS (TRITICUM AESTIVUM L.) ON SURGICALLY INDUCED ENDOMETRIOSIS RAT MODEL

The purpose of this study was to investigate the healing effects of an ethanolic wheatgrass (WG) extract obtained from young wheat leaves on a surgically induced endometriosis rat model. 30 female Wistar albino rats with endometriosis were randomly organized into five groups (N = 6): Control, Letrozole a reference drug for endometriosis (0.2 mg/kg/day), WG -25 (25 mg/kg/day WG extract), WG -100 (100 mg/kg/day WG extract) and WG -400 (400 mg/kg/day WG extract). WG -100 extract and Letrozole caused a significantly decrease in adhesion sc ore compared to the control. Additionally, treatment with WG extracts resulted in a significant reduction of endometrial cyst volumes compared to the control group. IL -6 cytokine levels in peritoneal fluid of WG -100 and Letrozole groups were importantly lo wer than the control. Matrix metallopeptidase 9, VEGF and kinase insert domain receptor genes were expressed in endometrial cysts. According to LC -MS/MS analysis, aconitic acid was the major phenolic acid (54.004 mg analyte/g extract) in the WG extract. Ad ditionally, quinic acid (3.687 mg analyte/g extract) and protocatechuic acid (0.014 mg analyte/g extract) were determined in the WG extract. Moreover, the WG extract had vitamin E (5.49 ± 0.08 mg/g extract) and vitamin C (7.42 ± 0.13 mg/g extract). As conc lusion, WG extract obtained from young leaves of wheat has ameliorative effects on surgically induced endometriosis due to its rich phytochemical content. Rezumat Scopul acestui studiu a fost de a investiga efectele unui extract etanolic de grâu verde (WG) obținut din frunze tinere de grâu, pe un model de șobolan cu endometrioză indusă chirurgical. 30 de șobolani Albino Wistar de sex feminin cu endometrioză au fost împărțiți aleatoriu în cinci grupuri (N = 6): Martor, Letrozol , un medicament de referință pentru endometrioză (0,2 mg/kg/zi), WG -25 (25 mg/kg/zi), WG -100 (100 mg/kg/zi) și WG -400 (400 mg/kg/zi). Extractul WG -100 și letrozolul au determinat o scădere semnificativă a scorului de aderență în comparație cu grupul control. În plus, tratamentul cu extracte WG a condus la o reducere semnificativă a volumelor chisturilor endometriale în comparație cu grupul control. Nivelurile de citokine IL -6 în lichidul peritoneal din grupurile WG -100 și Letrozol au fost semnificativ mai mici decât controlul. Metalopeptidaza matriceală 9, VEGF și genele receptorului domeniului de inserție al kinazei au fost exprimate în chisturile endometriale. Conform analizei LC -MS/MS, acidul aconitic a fost acidul fenolic preponderent (54,004 mg an alit/g extract) din extractul WG. În plus, acid ul chinic (3,687 mg analit/g extract) și acid ul protocatecuic (0,014 mg analit/g extract) au fost determinați în extractul WG. Mai mult, acesta conține vitamina E (5,49 ± 0,08 mg/g extract) și vitamina C (7,42 ± 0,13 mg/g extract). În concluzie, extractul WG obținut din frunze tinere de grâu verde are efecte amelioratoare asupra endometriozei induse chirurgical, datorită conținutului său bogat fitochimic.

aconitic acid, endometriosis, vitamin C, vitamin E, wheatgrass

Endometriosis is characterized by the presence of endometrial tissue outside of the uterus. One of the ten women at the reproductive stage was affected by endometriosis [1, 2]. Pelvic pain, dysmenorrhea, dyspareunia, irregular bleeding, and subfertility ar e the most common symptoms of endometriosis [3]. Metastatic tissue behaviour, angiogenesis and reduced apoptosis occur during endometriosis as well as cancer [4]. Endometriosis has become a major social and economic problem because of its complications. Gonadotropin-releasing hormone (GnRH) agonists, oral contraceptive pills and aromatase inhibitors are used in the treatment of endometriosis [5]. Drugs used to treat endometriosis have severe side effects such as osteoporosis, hot flashes, fatigue and weight gain [5, 6]. Thus, scientists focus on alternative approaches to endometriosis treatment and the improvement of the daily comfort of women with endometriosis. Women pay attention to phytochemically rich medicinal plants, especially during the menstrual FARMACIA, 2023, Vol. 71, 2 272 cycle and menopause, to increase their daily comfort. Additionally, plant crude extracts and isolated bioactive compounds have ameliorative effects on endometriosis [7, 8]. Sprouts of bread wheat ( Triticum aestivum L.) also known as wheatgrass (WG) are obtained from germinating T. aestivum caryopses. WG is consumed by people as tablets, capsules and freshly prepared wheatgrass juice. WG possesses anti-ulcer, anti-cancer, antioxidant and anti-arthritis activities, and it can also be used against thalassemia [9 -13]. Consumption of WG juice is advised as a dietary supplement to improve endometriosis treatment [14]. Wheat sprouts have also been shown to have anti-endometrial activity [15]. WG is a rich source of vitamins (especially vitamin C and vitamin E), -carotene, some amino acids and minerals. Additionally, it contains apigenin, quercetin, luteolin, abscisic acid, vanillic acid and ferulic acid [16]. Ap igenin, luteolin and quercetin present in WG are phytochemicals used for the treatment of endometriosis [8, 17]. This study aimed to investigate the healing effects of the ethanolic WG extract on a surgically induced endometriosis rat model. Additionally, we aimed to determine the phenolic acid quantities of the WG extract by LC-MS/MS and to measure its vitamin C and vitamin E contents.

Growth of wheat seedlings Caryopses of the Tosunbey bread wheat cultivar were used to grow seedlings. The caryopses (Serial number: 6546920, lot number: TR.06.20.1001.0329) were obtained from the Turkish Seed Association. Surface sterilized caryopses were sown in plastic trays with bi-layered tissue paper soaked in Hoagland's medium [18]. Plants were incubated in a controlled growth room for 14 days at a light/dark (16/8) photoperiod and 24 ± 1°C. Seedlings were separated from their roots and used to make an ethanolic extract. The preparation of the extract The young leaves of T. aestivum were cut into small pieces and extracted with 80 percent ethanol. Ethanol was removed from the solution by using a rotavapor (Rotavapor R-300, BUCHI) at 40°C under reduced pressure. The residue was frozen at -22°C and the aqueous part was evaporated by the lyoph ilization process using a freeze dryer (Alpha 1-2 LD, Christ). Finally, the lyophilized ethanolic WG extract was obtained. The yield was calculated as 3.62% for ethanolic WG extract. Animals Thirty female rats were supplied by Van Yüzüncü Yıl University Experimental Animal Research Unit. Wistar albino rats (150 - 200 g weight and 2 - 3 months old) were used in the present study. All rats were housed in 25 ± 2ºC, 12/12 hours light/dark cycle. Rats were fed ad libitum with standard pellet food and tap water. This study was conducted according to ARRIVE guidelines and the protocol was approved by the Van Yuzuncu Yil University Animal Researches Local Ethic Committee. Experimental design The endometriosis rat model was induced by surgery according to the auto -transplantation method with some modifications [19]. This model is composed of two stages, the first was the induction and confirmation of the endometriosis model stage (28 days) and the second was the treatment stage (28 days). The experiment duration was a total of 56 days. Endometriosis model induction and confirmation: at this stage, a surgically induced endometriosis model was created under aseptic conditions. The rats in the pre-oestrous phase were anesthetized with ketamine HCl and xylazine HCl. The abdomens of the rats were shaved, and the same region was disinfected with an iodine solution. A three cm incision was created on the abdomen (the first operation). The right endometrium was removed and separated from the myometrium. A 15 mm piece was trimmed, and this cleaned part was opened longitudinally. The endometrium part was ligated to the peryton, and the incision was sutured. Rats were fed ad libitum with standard pellet food and tap water for 28 days without any treatment. At the end of the 28 days, rats were labelled, and induction of the endometriosis model was confirmed by the second operation. Induction of endometrial cysts was achieved on the peryton of all rats. Treatment stage: Rats were treated with WG extract and letrozole, an aromatase inhibitor drug, in this stage. Carboxymethyl cellulose 0.5% (CMC) was used as a vehicle for WG extract and letrozole. Rats were fed ad libitum with standard pellet food and tap water during this stage (28 days). Thirty female rats with endometrial cysts were randomly organized into five groups (N = 6). Group I (Control): Rats with endometrial cysts were treated with 0.5% CMC for 2 mL/day via gavage for 28 days after the second operation. Group II (Letrozole): Rats with endometrial cysts were treated with letrozole, a reference drug, 0.2 mg/kg/day [20] via gavage for 28 days after the second operation. Group III (WG-25): Rats with endometrial cysts were treated with ethanolic WG extract 25 mg/kg/day via gavage for 28 days after the second operation. Group IV (WG-100): Rats with endometrial cysts were treated with ethanolic WG extract 100 mg/kg/day via gavage for 28 days after the second operation. Group V (WG-400): Rats with endometrial cysts were treated with ethanolic WG extract 400 mg/kg/day via gavage for 28 days after the second operation. At the end of the treatment stage, rats were sacrificed by cardiac puncture under anesthetized with ketamine FARMACIA, 2023, Vol. 71, 2 273 HCl and xylazine HCl. Tissues were remove d and stored in an ultra-freezer. Observation of adhesion scores and measurement of endometriotic cyst volume Intra-abdominal adhesion scores both before and after treatment were evaluated according to Blauer's scoring system (No adhesion: 0; Thin adhesions: 1; Thick adhesion in one area: 2; Spread thick adhesion: 3; Adhesion including internal organs: 4) [21]. Length, height and width of endometrial cysts were measured to calculate the endometriotic cyst volume before (CVB) and after (CVA) treatment using the equation: (/6 x length x height x width) [22]. The endometriotic cyst volume change (%) was calculated according to the formula: (CVA - CVB)/CVB x 100. Determination of cytokine levels Interleukin-6 (IL-6) levels, vascular endothelial growth factor (VEGF) and tumour necrosis factor-alpha (TNF- α) levels were measured in peritoneal fluid collected before and after treatment. Elabscience (USA) provided commercially available ELISA kits to measure IL -6 (E-EL-R0015), VEGF (E-EL-R2603) and TNF-α (E- EL-R2856). Cytokine levels were measured according to kit procedures. RNA isolation and semi-quantitative gene expression All equipment was treated with diethylpyrocarbonate to prevent RNase activity. RNA was isolated from endometrial cysts (0.1 g) using a Gene Jet RNA Purification kit (K0731, Thermo Scientific). Isolated RNAs were quantified and run on agarose gel electro- phoresis. RNAs were treated with DNAse I (EN0521, Thermo Scientific) to avoid DNA contamination before the construction of the cDNA library. cDNA libraries were constructed according to the protocol of the High-Capacity cDNA Reverse Transcription Kit purchased from Applied Biosystems™ (Catalog number: 4368814). cDNA synthesis was confirmed by PCR with glyceraldehyde -3-phosphate dehydrogenase (GAPDH) gene -specific primers (Table I). Semi - quantitative gene expression in endometrial cysts was performed using gene -specific primers for MMP -9, VEGF and Flk-1 genes. AMPIGENE® qPCR Green Mix (ENZ-NUC104-0200) was supplied by Enzo Life Sciences (Switzerland) for the PCR reaction mixture. An equal amount of cDNA was added to the PCR reaction. The PCR reaction conditions were optimized as initial denaturation at 95°C for 2 min, denaturation at 95°C for 5 sec, annealing and extension at 50°C for VEGF, 54°C for Flk-1 and 60°C for MMP-9 for 2 min for 40 cycles. PCR products (10µL) were run in an agarose gel electrophoresis system and monitored using a UV transilluminator bioimaging system. Bands were evaluated by using the ImageJ application, and the GAPDH gene was used as a housekeeping gene (Table I). Table I Primer sequences for semi-quantitative gene expression assay [23] Primer Id Sequence Base length VEGF-RT-F 5’ACCATGAACTTTCTGCTC3’ 18 VEGF-RT-R 5’GGACGGCTTGAAGATATA3’ 18 Flk-1_RT_F 5’GCACTGAATTATGGGAGA3’ 18 Flk-1_RT_R 5’ATGTGATTTTCTTCTTGATG3’ 20 MMP-9_RT_F 5’GTTTCTGCCCCAGTGAGAATCTC3’ 23 MMP-9_RT_R 5’TGCTGGATGTCTTTTATGTCG3’ 21 GAPDH_RT_F 5’CACCACCATGGAGAAGGC3’ 18 GAPDH_RT_R 5’CCATCCACAGTCTTCTGA3’ 18 Phytochemical analysis of the WG extract Phenolic bioactive compounds in WG extract were screened and quantitatively measured by LC-MS/MS (liquid chromatography-mass spectrometry) validated for 56 compounds [24]. Additionally, the vitamin C and vitamin E content of the WG extract were determined according to procedures of commercially available kits. Vitamin C and vitamin E content were determined according to the protocol of commercially available kits (E-BC-K034 for vitamin C and E-BC- K033 for vitamin E). Statistical analysis GraphPad Prism 8 was used for statistical analyses. Data were presented as mean ± standard error of the mean (SEM) or standard deviation (SD). Kolmogorov- Smirnov or Shapiro -Wilk tests were carried out to control whether the distribution is normal or not. Kruskal-Wallis test was performed for the evaluation of the adhesion scores. For the other parameters, one- way ANOVA-Dunnett’s post hoc test was performed. All groups were compared to the control group. p < 0.05 was considered statistically significant.

and Discussion Ectopic endometrial tissue that has been placed out - side of the uterus and exhibits pain sensations and infertility is known as endometriosis, a chronic inflammatory disease [25]. Proliferation, apoptosis, inflammation and angiogenesis are key biological processes that are crucial for the development and survival of endometriotic lesions at ectopic locations [26]. Endometriosis is an important worldwide health FARMACIA, 2023, Vol. 71, 2 274 concern because of its prevalence in women of reproductive age (10%) [27]. The use of medicinal plants and phytochemicals in natural alternative therapies may present new possibilities for the treatment of endometriosis [17]. Numerous natural products with various medicinal effects have demonstrated a reduction in the size of endometriotic lesions, a reduction in pelvic adhesions, and an improvement in pelvic discomfort and ovarian function [28]. Medicinal plants and their phytochemicals are increasingly being used to treat endometriosis due to their anti -angiogenic, anti-oxidative, sedative and pain-alleviating characteristics [29]. Young leaves of wheat have antioxidant, anti - inflammatory, immunomodulatory, anticarcinogenic, diuretic, anti-aging and antibacterial effects because of their bioactive compounds [30]. Adhesion scoring is widely used for the evaluation of endometriotic cysts [31]. Adhesion scores were evaluated before and after treatment. According to the adhesion scores, there were no significant differences between groups before treatment. Adhesion scores were between 3.125 ± 0.398 (Control) and 3.417 ± 0.193 (WG-100) (Table II). Letrozole and WG caused a decrease in adhesion scores after treatment. The lowest adhesion score was in the Letrozole group (1.417 ± 0.452) and statistically significant (p < 0.01) compared to the control group (3.667 ± 0.224). While the adhesion score of WG -100 treatment (2.000 ± 0.302) was statistically important (p < 0.05) according to the control, WG-25 (2.750 ± 0.509) and WG-400 (2.833 ± 0.474) adhesion scores after treatment were not significant compared to the control group (Table II). Methanolic fraction of the Urtica dioica L. extract and its fraction C caused a decrease in adhesion scores of endometrial cysts ac cording to the control group [31]. Treatment of the ethyl acetate fraction of the Achillea biebersteinii Afan. extract in rats with endometriosis resulted in the decrease in adhesion score compared to the control [32]. WG ethanolic extract (100 mg/kg) had a similar effect, according to adhesion score results. Table II Adhesion scores of endometrial implants before and after treatment Before treatment After treatment Control 3.125 ± 0.398 3.667 ± 0.224 Letrozole 3.167 ± 0.322 1.417 ± 0.452** WG-25 3.250 ± 0.279 2.750 ± 0.509 WG-100 3.417 ± 0.193 2.000 ± 0.302* WG-400 3.250 ± 0.329 2.833 ± 0.474 Data were presented as mean ± SEM. * for p < 0.05 and ** for p < 0.01 compared to control in the same column According to endometriotic cyst volume change results, Letrozole which was used as a reference drug and WG extracts caused significant decreases compared to the control group (p < 0.0001) (Figure 1). The most effective treatment was determined in the Letrozole group (84.4% decrease). Endometriotic cyst volume percent was increased in the control group (32.2% increase). WG -100, WG -25 and WG -400 extracts caused 74.5%, 65.8% and 52.2% decrease in endo - metriotic cyst volume, respectively (Figure 1). Figure 1. Endometriotic volume change percent **** indicates p < 0.0001 according to Control Methanolic extract of Urtica dioica L. and its fraction C caused a decrease in the volume of endometrial cysts [31]. Additionally, endometrial cyst volume was decreased in the reference group compared to the control in the same study. Hydro-methanolic extracts of the aerial parts of Alchemilla mollis (Buser) Rothm. and Alchemilla persica Rothm. plants caused a decrease in endometrial cyst volumes [33]. Ethyl acetate fraction of the Achillea biebersteinii Afan. extract-treated rats with endometriosis had less endometrial cyst volume than the control rats [32]. Similarly, ethanolic WG extract caused a decrease in endometrial cyst volume in the current study. Il-6 levels increase peritoneal fluid in women with endometriosis [34]. VEGF is an important factor in the regulation of both normal and abnormal angio - genesis [35]. Cytokines including IL -6, TNF-α and VEGF were evaluated. They present valuable data to evaluate endometriosis pathogenesis [36, 37]. High levels of those cytokines were reported in the peritoneal fluid of women with endometriosis [38]. IL -6 and TNF-α levels in letrozole and WG extract -treated groups were not significantly different compared to the control group. Decreases in IL-6 levels in Letrozole and WG -100 groups after treatment were found statistically important compared to control (p < 0.05) (Figure 2). While the VEGF level of WG -400 was significantly higher than the control before treatment, it was not different from the control after treatment. While hydro -methanolic extract of the aerial p arts of Alchemilla mollis (Buser) Rothm. caused decreases in levels of IL-6, TNF-α and VEGF, their levels were not affected by Alchemilla persica Rothm. aerial extract even if it reduced endometrial cyst volume [33]. FARMACIA, 2023, Vol. 71, 2 275 Figure 2. Cytokine levels before and after treatment Asterix (*) on the columns indicates p < 0.05 according to Control In a gene expression profiling study, it was reported that the expression of 71 genes was upregulated and that 45 genes were downregulated in the endometriosis tissue according to normal uterine [39]. Expression of VEGF, Flk-1 and MMP-9 genes in endometriosis tissue was high and similar to cancer disease [23]. Additionally, an increase in MMP-9 gene expression was determined in women with endometriosis [40]. The expression of VEGF, MMP -9 and Flk -1 genes was determined in the endometrial cyst tissue in the current study (Figure 3). According to semi-quantitative gene expression results, expression of the Flk-1 gene in the Letrozole group was lower than the control group. Phenolic acids were determined and quantified by LC-MS/MS. Wheat seedlings have aconitic acid in their leaves [41]. Aconitic acid was determined to be the major phenolic acid in WG extract (54.004 mg analyte/g extract) (Table III). Quinic acid (3.687 mg analyte/g extract) and protocatechuic acid (0.014 mg analyte/g extract) were other phenolics in the WG extract. Aconitic acid, an organic acid produced by higher plants, has two isomers in nature; cis-aconitic acid and trans-aconitic acid [42]. Cis-aconitic acid is converted to itaconate by the cis-aconitate decarboxylase enzyme one of the most highly upregulated genes during proinflammatory [43]. Antioxidant and anti - inflammatory effects of itaconate have been reported [44]. Hydro-alcoholic extract of Echinodorus grandiflorus leaves having trans-aconitic acid as a major compound had TNF-α inhibition [45]. Metabolic changes in human endometrial stromal cells were induced in oxygen deficiency conditions by reducing the isocitric acid and suppressing cis-aconitic and citric acid [46]. FARMACIA, 2023, Vol. 71, 2 276 Figure 3. Expression levels of MMP-9, Flk-1 and VEGF genes Asterix (*) on the columns indicates p < 0.05 according to Control. Gel figure definitions: 1: Control. 2: Letrozole. 3: WG-25. 4: WG-100. 5: WG-400 Table III Phytochemicals in the WG extract Bioactive compound Quantity Aconitic acid (mg analyte/g extract) 54.004 Quinic acid (mg analyte/g extract) 3.687 Protocatechuic acid (mg analyte/g extract) 0.014 Vitamin C (mg/g extract) 7.42 ± 0.13 Vitamin E (mg/g extract) 5.49 ± 0.08 Vitamin E and vitamin C content of the WG extract were detected at 5.49 ± 0.08 mg/g and 7.42 ± 0.13 mg/g, respectively (Table III). Vitamins are essential for human met abolism and disruptions in vitamin metabolism, especially those of vitamin A, vitamin C, vitamin D and vitamin E, are related to endometriosis [47]. Oxidative stress, characterized by an imbalance between oxidants and antioxidants [48], occurs during endometriosis [49]. Macromolecules that are highly important for biological activities such as lipids, proteins and nucleic acids are targets for oxidants both of reactive oxygen and nitrogen species [5 0]. Vitamin C and vitamin E are powerful antioxidants to prevent oxidative stress in endometriosis [47]. Women with endometriosis had a low level of vitamin E in their serum [51]. Vitamin C and E supplements effectively minimized the severity of dysmenorrhea and improved dyspareunia and the intensity of pelvic inflammation [52]. Additionally, the consumption of nutrients with high amounts of vitamin C, vitamin E, folate and thiamine had a protective role against endometriosis [53]. Therefore, supplementation with vitamins C and E was linked to a reduction in the levels of oxidative stress indicators in endometriosis patients [54]. Intra- venous vitamin C treatment prevented implant induction and endometrial cyst volumes in a surgically induced endometriosis r at model [55]. In the current study, similarly, treatments of WG extract rich in vitamin C and vitamin E caused a decrease in endometrial cysts and adhesions in rats with endometriosis. FARMACIA, 2023, Vol. 71, 2 277

Although the WG-25 and WG-400 treatments reduced endometriotic cyst volume, they did not reduce adhesion scores. Letrozole and WG-100 therapies, on the other hand, reduced both adhesion scores and endometriotic cyst volume. Additionally, IL-6 levels were discovered to decrease in Letrozole and WG - 100 treatments, according to the cytokine findings. Furthermore, molecular biology findings (decrease in Flk-1 gene expression) suggest that Letrozole is more effective than wheatgrass in healing endometriosis. Aconitic acid was the major compound in the WG extract according to LC -MS/MS analysis and WG extract was rich with vitamin C and vitamin E. Because of their high phytochemical content, young wheat leaves were found to have a healing effect on the surgically induced endometriosis rat model.

This study was funded by Van Yüzüncü Yıl University Scientific Research Projects Unit with grant number: TYL-2021-9390. Conflict of interest The authors declare no conflict of interest.

1. Coiplet E, Courbiere B, Agostini A, Boubli L, Bretelle F, Netter A, Endometriosis and environmental factors: A critical review. J Gynecol Obstet Hum Reprod., 2022; 51(7): 102418. 2. Mortlock S, Corona RI, Kho PF, Pharoah P, Seo JH, Freedman ML, Gayther SA, Siedhoff MT, Rogers PAW, Leuchter R, Walsh CS, C ass I, Karlan BY, Rimel BJ, Ovarian Cancer Association Consortium IEGC, Montgomery GW, Lawrenson K, Kar SP, A multi-level investigation of the genetic relationship between endometriosis and ovarian cancer histotypes. Cell Rep Med., 2022; 3(3): 100542. 3. Giudice LC, Clinical practice. Endometriosis. N Engl J Med., 2010; 362(25): 2389-2398. 4. Brilhante AV, Augusto KL, Portela MC, Sucupira LC, Oliveira LA, Pouchaim AJ, Nobrega LR, Magalhaes TF, Sobreira LR, Endometriosis and ovarian cancer: An integrat ive review (Endometriosis and ovarian cancer). Asian Pac J Cancer Prev. , 2017; 18(1): 11-16. 5. Slopien R, Meczekalski B, Aromatase inhibitors in the treatment of endometriosis. Prz Menopauzalny., 2016; 15(1): 43-47. 6. Stochino-Loi E, Major AL, Gillon TER, Ayou bi JM, Feki A, Bouquet de Joliniere J, Metformin, the Rise of a New Medical Therapy for Endometriosis? A Systematic Review of the Literature. Front Med., 2021; 8: 581311. 7. Bina F, Soleymani S, Toliat T, Hajimahmoodi M, Tabarrai M, Abdollahi M, Rahimi R, Pla nt-derived medicines for treatment of endometriosis: a comprehensive review of molecular mechanisms. Pharmacol Res., 2019; 139: 76-90. 8. Meresman GF, Götte M, Laschke MW, Plants as source of new therapies for endometriosis: a review of preclinical and clinical studies. Hum Reprod Updat., 2021; 27(2): 367-392. 9. Ben-Arye E, Goldin E, Wengrower D, Stamper A, Kohn R, Berry E, Wheat grass juice in the treatment of active distal ulcerative colitis: A randomized double- blind placebo-controlled trial. Scand J Gastroenterol., 2002; 37(4): 444-449. 10. Kulkarni SD, Tilak JC, Acharya R, Rajurkar NS, Devasagayam TP, Reddy AV, Evaluation of the antioxidant activity of wheatgrass (Triticum aestivum L.) as a function of growth under different conditions. Phytother Res., 2006; 20(3): 218-227. 11. Lai CN, Dabney BJ, Shaw CR, Inhibition of in vitro metabolic activation of carcinogens by wheat sprout extracts. Nutr Cancer, 1978; 1: 27-30. 12. Marawaha RK, Bansal D, Kaur S, Trehan A, Wheat grass juice reduces transfusion requirement in patients with thalassemia major: a pilot study. Indian Pediatr., 2004; 41(7): 716-720. 13. Nenonen MT, Helve TA, Rauma AL, Hanninen OO, Uncooked, lactobacilli-rich, vegan food and rheumatoid arthritis. Br J Rheumatol., 1998; 37(3): 274-281. 14. Worwood VA, Stonehouse J, The endometriosis natural treatment program: A complete self-help plan for improving health and well -being. New World Library: California, USA, 2011; 288. 15. Lim TK, Triticum aestivum . In Edible Medicinal And Non-Medicinal Plants, Lim TK, Ed.; Springer: New York, London, 2013; 5; 385-415. 16. Hanninen O, Rauma AL, Kaartinen K, Nenonen M, Vegan diet in physiological health promotion. Acta Physiol Hung., 1999; 86(3-4): 171-180. 17. Balan A, Moga MA, Dima L, Dinu CG, Martinescu CC, Panait DE, Irimie CA, Anastasiu CV, An overview on the conservative management of endometriosis from a naturopathic perspective: Phytochemicals and medicinal plants. Plants, 2021; 10(3): 587. 18. Hoagland DR, Arnon DI, The Water-Culture Method for Growing Plants Without Soil. Circular., 1950; 347: 32. 19. Vernon MW, Wilson EA, Studies on the surgical induction of endometriosis in the rat. Fertil Steril., 1985; 44(5): 684-694. 20. Bina F, Daglia M, Santarcangelo C, Baeeri M, Abdollahi M, Nabavi SM, Tabarrai M, Rahimi R, Phytochemical profiling and ameliorative effects of Achillea cretica L. on rat model of endometriosis. J Ethnoparmacol., 2020; 254: 112747. 21. Blauer KL, Collins RL, The effect of intraperitoneal progesterone on postoperative adhesion formation in rabbits. Fertil Steril., 1988; 49(1): 144-149. 22. Altintas D, Kokcu A, Tosun M, Cetinkaya MB, Kandemir B, Comparison of the effects of cetrorelix, a GnRH antagonist, and leuprolide, a GnRH agonist, on experimental endometriosis. J Obstet Gynaecol., 2008; 34(6): 1014-1019. 23. Machado DE, Berardo PT, Palmero CY, Nasciutti LE, Higher expression of vascular endothelial growth factor (VEGF) and its receptor VEGFR -2 (Flk -1) FARMACIA, 2023, Vol. 71, 2 278 and metalloproteinase-9 (MMP-9) in a rat model of peritoneal endometriosis is similar to cancer diseases. J Exp Clin Cancer Res., 2010; 29: 1-9. 24. Yilmaz MA, Simultaneous quantitative screening of 53 phytochemicals in 33 species of medicinal and aromatic plants: A detailed, robust and comprehensive LC–MS/MS method validation. Ind Crops Prod., 2020; 149: 112347. 25. Wang PH, Yang ST, Chang WH, Liu CH, Lee FK, Lee WL, Endometriosis: part I. basic concept. Taiwan J Obstet Gynecol., 2022; 61(6): 927-934. 26. Laganà AS, Garzon S, Götte M, Viganò P, Franchi M, Ghezzi F, Martin DC, The pathogenesis of endometriosis: molecular and cell biology insights. Int J Mol Sci., 2019; 20(22): 5615. 27. Ruszała M, Dłuski DF, Winkler I, Kotarski J, Rechberger T, Gogacz M, The state of health and the quality of life in women suffering from endometriosis. J Clin Med., 2022; 11(7): 2059. 28. Flower A, Liu JP, Lewith G, Little P, Li Q, Chinese herbal medicine for endometriosis. Cochrane Database Syst Rev., 2012; 16(5): CD006568. 29. Ashrafizaveh A, Fard HS, Azmoudeh E, Application of medicinal plants, acupuncture, massage therapy and transcutaneous electric nerve stimulation in treatment of endometriosis: review study. Iran J Obstet Gynecol Infertil., 2019; 22(5): 90-100. 30. Rana S, Kamboj JK, Gandhi V, Living life the natural way–Wheatgrass and Health. Funct Foods Health Dis., 2011; 1(11): 444-456. 31. Ilhan M, Ali Z, Khan IA, Taştan H, Akkol EK, Bioactivity-guided isolation of flavonoids from Urtica dioica L. and their effect on endometriosis rat model. J Ethnopharmacol., 2019; 243: 112100. 32. Demirel MA, Suntar I, Ilhan M, Keles H, Akkol EK, Experimental endometriosis remission in rats treated with Achillea biebersteinii Afan.: Histopathological evaluation and determination of cytokine levels. Eur J Obstet Gynecol Reprod Biol., 2014; 175: 172-177. 33. Küpeli Akkol E, Demirel MA, Bahadır Acıkara O, Süntar I, Ergene B, Ilhan M, Ozbilgin S, Saltan G, Keleş H, Tekin M, Phytochemical analyses and effects of Alchemilla mollis (Buser) Rothm. and Alchemilla persica Rothm. in rat endometriosis model. Arch Gynecol Obstet., 2015; 292: 619-628. 34. Kang YJ, Jeung IC, Park A, Park YJ, Jung H, Kim TD, Lee HG, Choi I, Yoon SR, An increased level of IL -6 suppresses NK cell activity i n peritoneal fluid of patients with endometriosis via regulation of SHP-2 expression. Hum Reprod., 2014; 29(10): 2176-2189. 35. Takehara M, Ueda M, Yamashita Y, Terai Y, Hung YC, Ueki M, Vascular endothelial growth factor A and C gene expression in endometriosis. Hum Pathol., 2004; 35(11): 1369-1375. 36. Eisermann J, Gast MJ, Pineda J, Odem RR, Collins JL, Tumor necrosis factor in peritoneal fluid of women undergoing laparoscopic surgery. Fertil Steril., 1988; 50(4): 573-579. 37. Neto JN, Coelho TM, Aguiar GC, Carvalho LR, de Araújo AGP, Girão MJB, Schor E, Experimental endometriosis reduction in rats treated with Uncaria tomentosa (cat's claw) extract. Eur J Obstet Gynecol Reprod Biol., 2011; 154(2): 205-208. 38. Wu MY, Ho HN, The rol e of cytokines in endometriosis. Am J Reprod Immunol., 2003; 49(5): 285-296. 39. Konno R, Fujiwara H, Netsu S, Odagiri K, Shimane M, Nomura H, Suzuki M, Gene expression profiling of the rat endometriosis model. Am J Reprod Immunol., 2007; 58(4): 330-343. 40. Ueda M, Yamashita Y, Takehara M, Terai Y, Kumagai K, Ueki K, Kanda K, Hung Y, Ueki M, Gene expression of adhesion molecules and matrix metalloproteinases in endometriosis. Gynecol Endocrinol., 2002; 16(5): 391-402. 41. Orioli GA, Thompson JF, Aconitate accumulation in wheat seedlings. Bot Gaz., 1990; 151(1): 30-37. 42. Bruni GO, Klasson KT, Aconitic acid recovery from renewable feedstock and review of chemical and biological applications. Foods, 2022; 11(4): 573. 43. Lampropoulou V, Sergushichev A, Bambouskova M, Nair S, Vincent EE, Loginicheva E, Cervantes-Barragan L, Ma X, Huang SCC, Griss T, Weinheimer CJ, Khader S, Randolph GJ, Pearce EJ, Jones RG, Diwan A, Diamond MS, Artyomov MN, Itaconate links inhibition of succinate dehydrogenase with macrophage metabolic remodeling and regulation of inflammation. Cell Metab., 2016; 24(1): 158-166. 44. Frieler RA, Vigil TM, Song J, Leung C, Goldstein DR, Lumeng CN, Mortensen RM, Aconitate decarboxylase 1 regulates glucose homeostasis and obesity in mice. Obesity, 2022; 30(9): 1818-1830. 45. de Faria Garcia E, de Oliveira MA, Dourado LPA, de Souza DG, Teixeira MM, Braga FC, In vitro TNF-α inhibition elicited by extracts from Echinodorus grandiflorus leaves and correlation with their phytochemical composition. Planta Med. , 2016; 82(04): 337-343. 46. Kido T, Murata H, Nishigaki A, Tsubokura H, Komiya S, Kida N, Kakita-Kobayashi M, Hisamatsu Y, Tsuzuki T, Hashimoto Y, Okada H, Glucose transporter 1 is important for the glycolytic metabolism of human endometrial stromal cells in hypoxic environment. Heliyon, 2020; 6(6): e03985. 47. Lu J, Ling X, Liu L, Jiang A, Ren C, Lu C, Yu Z, Emerging hallmarks of endometriosis metabolism: A promising target for the treatment of endometriosis. Biochim Biophys Acta Mol Ce ll Res BBA -Mol Cell Res., 2022; 119381. 48. Donmez F, Dogan A, Investigation of the effects of three different generations of fluoroquinolone derivatives on antioxidant and immunotoxic enzyme levels in different rat tissues. Drug Chem Toxicol. , 2022; 45(6): 2686-2698. 49. Harlev A, Gupta S, Agarwal A, Targeting oxidative stress to treat endometriosis. Expert Opin Ther Targets, 2015; 19(11): 1447-1464. 50. Vukajlović JT, Kosanić M, Ranković B, Stanojković T, Marković A, G rujičić D, D jelić N, Radaković M, M ilošević-Djordjević O, Evaluation of biological activities of acetone extract of the mushroom Leccinum scabrum . Farmacia, 20 21; 69(5): 974-979. 51. Petean CC, Ferriani RA, dos Reis RM, de Moura MD, Jordao Jr AA, Navarro PAdAS, Lipid peroxidation and vitamin E in serum and follicular fluid of infertile women with peritoneal endometriosis submitted to FARMACIA, 2023, Vol. 71, 2 279 controlled ovarian hyperstimulation: a pilot study. Fertil Steril., 2008; 90(6): 2080-2085. 52. Amini L, Chekini R, Nateghi MR, Haghani H, Jamialahmadi T, Sathyapalan T, Sahebkar A, The effect of combined vitamin C and vitamin E supplementation on oxidative stress markers in women with endometriosis: a randomized, triple-blind placebo-controlled clinical trial. Pain Res Manag., 2021: 5529741. 53. Darling AM, Cha varro JE, Malspeis S, Harris HR, Missmer SA, A prospective cohort study of Vitamins B, C, E, and multivitamin intake and endometriosis. J Endometr Pelvic Pain Disord., 2013; 5(1): 17-26. 54. Mier-Cabrera J, Genera-García M, De la Jara-Díaz J, Perichart-Perera O, Vadillo -Ortega F, Hernández - Guerrero C, Effect of vitamins C and E supplementation on peripheral oxidative stress markers and pregnancy rate in women with endometriosis. Int J Gynecol Obstet., 2008; 100(3): 252-256. 55. Erten OU, Ensari TA, Dilbaz B, Cakiro glu H, Altinbas SK, Çaydere M, Goktolga U, Vitamin C is effective for the prevention and regression of endometriotic implants in an experimentally induced rat model of endometriosis. Taiwan J Obstet Gynecol., 2016; 55(2): 251-257.