{"paper_id":"a43e643e-0880-4539-b060-52e388d57128","body_text":"FARMACIA, 2023, Vol. 71, 2 \n 271 \nhttps://doi.org/10.31925/farmacia.2023.2.6 ORIGINAL ARTICLE \nEXPLORING OF THE AMELIORATIVE EFFECTS OF ETHANOLIC \nEXTRACT OF THE WHEATGRASS (TRITICUM AESTIVUM L.) ON \nSURGICALLY INDUCED ENDOMETRIOSIS RAT MODEL \n  \nABDULLAH ADIYAMAN 1, ABDULHAMİT BATTAL 2*, MERT İLHAN 3 \n \n1Department of Basic Pharmaceutical Sciences, Institute of Health Sciences, Van Yüzüncü Yıl University, 65080, Tusba, Van, \nTurkey \n2Department of Pharmaceutical Biotechnology, Faculty of Pharmacy, Van Yüzüncü Yıl University, 65080, Tusba, Van, Turkey \n3Department of Pharmacognosy, Faculty of Pharmacy, Düzce University, 81620, Düzce, Turkey \n \n*corresponding author: abdulhamitbattal@yyu.edu.tr \nManuscript received: November 2022 \n \nAbstract  \nThe purpose of this study was to investigate the healing effects of an ethanolic wheatgrass (WG) extract obtained from young \nwheat leaves on a surgically induced endometriosis rat model. 30 female Wistar albino  rats with endometriosis were \nrandomly organized into five groups (N = 6): Control, Letrozole a reference drug for endometriosis (0.2 mg/kg/day), WG -25 \n(25 mg/kg/day WG extract), WG -100 (100 mg/kg/day WG extract) and WG -400 (400 mg/kg/day WG extract). WG -100 \nextract and Letrozole caused a significantly decrease in adhesion sc ore compared to the control. Additionally, treatment with \nWG extracts resulted in a significant reduction of endometrial cyst volumes compared to the control group. IL -6 cytokine \nlevels in peritoneal fluid of WG -100 and Letrozole groups were importantly lo wer than the control. Matrix metallopeptidase \n9, VEGF and kinase insert domain receptor genes were expressed in endometrial cysts. According to LC -MS/MS analysis, \naconitic acid was the major phenolic acid (54.004 mg analyte/g extract) in the WG extract. Ad ditionally, quinic acid (3.687 \nmg analyte/g extract) and protocatechuic acid (0.014 mg analyte/g extract) were determined in the WG extract. Moreover, the \nWG extract had vitamin E (5.49 ± 0.08 mg/g extract) and vitamin C (7.42 ± 0.13 mg/g extract). As conc lusion, WG extract \nobtained from young leaves of wheat has ameliorative effects on surgically induced endometriosis due to its rich \nphytochemical content. \n \nRezumat  \nScopul acestui studiu a fost de a investiga efectele unui extract etanolic de grâu verde (WG) obținut din frunze tinere de grâu, \npe un model de șobolan cu endometrioză indusă chirurgical. 30 de șobolani Albino Wistar de sex feminin cu endometrioză au \nfost împărțiți aleatoriu în cinci grupuri (N  = 6): Martor, Letrozol , un medicament de referință pentru endometrioză (0,2 \nmg/kg/zi), WG -25 (25 mg/kg/zi), WG -100 (100 mg/kg/zi) și WG -400 (400 mg/kg/zi). Extractul WG -100 și letrozolul au \ndeterminat o scădere semnificativă a scorului de aderență în comparație cu grupul control. În plus, tratamentul cu extracte \nWG a condus la o reducere semnificativă a volumelor chisturilor endometriale în comparație cu grupul control. Nivelurile de \ncitokine IL -6 în lichidul peritoneal din grupurile WG -100 și Letrozol au fost semnificativ  mai mici decât controlul. \nMetalopeptidaza matriceală 9, VEGF și genele receptorului domeniului de inserție al kinazei au fost exprimate în chisturile \nendometriale. Conform analizei LC -MS/MS, acidul aconitic a fost acidul fenolic preponderent (54,004 mg an alit/g extract) \ndin extractul WG. În plus, acid ul chinic (3,687 mg analit/g extract) și acid ul protocatecuic (0,014 mg analit/g extract) au fost \ndeterminați în extractul WG. Mai mult, acesta conține vitamina E (5,49 ± 0,08 mg/g extract) și vitamina C (7,42  ± 0,13 mg/g \nextract). În concluzie, extractul WG obținut din frunze tinere de grâu verde are efecte amelioratoare asupra endometriozei \ninduse chirurgical, datorită conținutului său bogat fitochimic. \n \nKeywords: aconitic acid, endometriosis, vitamin C, vitamin E, wheatgrass \n \nIntroduction \nEndometriosis is characterized by the presence of \nendometrial tissue outside of the uterus. One of the \nten women at the reproductive stage was affected \nby endometriosis [1, 2]. Pelvic pain, dysmenorrhea, \ndyspareunia, irregular bleeding, and subfertility ar e \nthe most common symptoms of endometriosis [3]. \nMetastatic tissue behaviour, angiogenesis and reduced \napoptosis occur during endometriosis as well as cancer \n[4]. Endometriosis has become a major social and \neconomic problem because of its complications. \nGonadotropin-releasing hormone (GnRH) agonists, \noral contraceptive pills and aromatase inhibitors are \nused in the treatment of endometriosis [5]. Drugs \nused to treat endometriosis have severe side effects \nsuch as osteoporosis, hot flashes, fatigue and weight \ngain [5, 6]. Thus, scientists focus on alternative \napproaches to endometriosis treatment and the \nimprovement of the daily comfort of women with \nendometriosis. Women pay attention to phytochemically \nrich medicinal plants, especially during the menstrual \n\nFARMACIA, 2023, Vol. 71, 2 \n 272 \ncycle and menopause, to increase their daily comfort. \nAdditionally, plant crude extracts and isolated bioactive \ncompounds have ameliorative effects on endometriosis \n[7, 8]. \nSprouts of bread wheat ( Triticum aestivum L.) also \nknown as  wheatgrass (WG) are obtained from \ngerminating T. aestivum caryopses. WG is consumed \nby people as tablets, capsules and freshly prepared \nwheatgrass juice. WG possesses anti-ulcer, anti-cancer, \nantioxidant and anti-arthritis activities, and it can also \nbe used against thalassemia [9 -13]. Consumption of \nWG juice is advised as a dietary supplement to \nimprove endometriosis treatment [14]. Wheat sprouts \nhave also been shown to have anti-endometrial activity \n[15]. WG is a rich source of vitamins (especially \nvitamin C and vitamin E), -carotene, some amino \nacids and minerals. Additionally, it contains apigenin, \nquercetin, luteolin, abscisic acid, vanillic acid and \nferulic acid [16]. Ap igenin, luteolin and quercetin \npresent in WG are phytochemicals used for the \ntreatment of endometriosis [8, 17]. \nThis study aimed to investigate the healing effects \nof the ethanolic WG extract on a surgically induced \nendometriosis rat model. Additionally, we aimed to \ndetermine the phenolic acid quantities of the WG \nextract by LC-MS/MS and to measure its vitamin C \nand vitamin E contents. \n \nMaterials and Methods \nGrowth of wheat seedlings \nCaryopses of the Tosunbey bread wheat cultivar were \nused to grow seedlings. The caryopses (Serial number: \n6546920, lot number: TR.06.20.1001.0329) were \nobtained from the Turkish Seed Association. Surface \nsterilized caryopses were sown in plastic trays with \nbi-layered tissue paper soaked in Hoagland's medium \n[18]. Plants  were incubated in a controlled growth \nroom for 14 days at a light/dark (16/8) photoperiod \nand 24 ± 1°C. Seedlings were separated from their \nroots and used to make an ethanolic extract.  \nThe preparation of the extract \nThe young leaves of T. aestivum were cut into small \npieces and extracted with 80 percent ethanol. Ethanol \nwas removed from the solution by using a rotavapor \n(Rotavapor R-300, BUCHI) at 40°C under reduced \npressure. The residue was frozen at -22°C and the \naqueous part was evaporated by the lyoph ilization \nprocess using a freeze dryer (Alpha 1-2 LD, Christ). \nFinally, the lyophilized ethanolic WG extract was \nobtained. The yield was calculated as 3.62% for \nethanolic WG extract. \nAnimals \nThirty female rats were supplied by Van Yüzüncü \nYıl University Experimental Animal Research Unit. \nWistar albino  rats (150 - 200 g weight and 2 - 3 \nmonths old) were used in the present study. All rats \nwere housed in 25 ± 2ºC, 12/12 hours light/dark \ncycle. Rats were fed ad libitum with standard pellet \nfood and tap water. This study was conducted according \nto ARRIVE guidelines and the protocol was approved \nby the Van Yuzuncu Yil University Animal Researches \nLocal Ethic Committee. \nExperimental design \nThe endometriosis rat model was induced by surgery \naccording to the auto -transplantation method with \nsome modifications [19]. This model is composed \nof two stages, the first was the induction and \nconfirmation of the endometriosis model stage (28 \ndays) and the second was the treatment stage (28 days). \nThe experiment duration was a total of 56 days. \nEndometriosis model induction and confirmation: at \nthis stage, a surgically induced endometriosis model \nwas created under aseptic conditions. The rats in the \npre-oestrous phase were anesthetized with ketamine \nHCl and xylazine HCl. The abdomens of the rats were \nshaved, and the same region was disinfected with \nan iodine solution. A three cm incision was created \non the abdomen (the first operation). The right \nendometrium was removed and separated from the \nmyometrium. A 15 mm piece was trimmed, and \nthis cleaned part was opened longitudinally. The \nendometrium part was ligated to the peryton, and \nthe incision was sutured. Rats were fed ad libitum  \nwith standard pellet food and tap water for 28 days \nwithout any treatment. At the end of the 28 days, rats \nwere labelled, and induction of the endometriosis model \nwas confirmed by the second operation. Induction \nof endometrial cysts was achieved on the peryton of \nall rats. \nTreatment stage: Rats were treated with WG extract \nand letrozole, an aromatase inhibitor drug, in this \nstage. Carboxymethyl cellulose 0.5% (CMC)  was \nused as a vehicle for WG extract and letrozole. Rats \nwere fed ad libitum  with standard pellet food and \ntap water during this stage (28 days). Thirty female \nrats with endometrial cysts were randomly organized \ninto five groups (N = 6). \nGroup I (Control): Rats with endometrial cysts were \ntreated with 0.5% CMC for 2 mL/day via gavage for \n28 days after the second operation. \nGroup II (Letrozole): Rats with endometrial cysts \nwere treated with letrozole, a reference drug, 0.2 \nmg/kg/day [20] via gavage for 28 days after the \nsecond operation. \nGroup III (WG-25): Rats with endometrial cysts were \ntreated with ethanolic WG extract 25 mg/kg/day via \ngavage for 28 days after the second operation. \nGroup IV (WG-100): Rats with endometrial cysts were \ntreated with ethanolic WG extract 100 mg/kg/day \nvia gavage for 28 days after the second operation. \nGroup V (WG-400): Rats with endometrial cysts were \ntreated with ethanolic WG extract 400 mg/kg/day via \ngavage for 28 days after the second operation. \nAt the end of the treatment stage, rats were sacrificed \nby cardiac puncture under anesthetized with ketamine \n\nFARMACIA, 2023, Vol. 71, 2 \n 273 \nHCl and xylazine HCl. Tissues were remove d and \nstored in an ultra-freezer. \nObservation of adhesion scores and measurement \nof endometriotic cyst volume \nIntra-abdominal adhesion scores both before and after \ntreatment were evaluated according to Blauer's scoring \nsystem (No adhesion: 0; Thin adhesions: 1; Thick \nadhesion in one area: 2; Spread thick adhesion: 3; \nAdhesion including internal organs: 4) [21]. Length, \nheight and width of endometrial cysts were measured \nto calculate the endometriotic cyst volume before \n(CVB) and after (CVA) treatment using the equation: \n(/6 x length x height x width) [22]. \nThe endometriotic cyst volume change (%) was \ncalculated according to the formula: \n(CVA - CVB)/CVB x 100. \nDetermination of cytokine levels \nInterleukin-6 (IL-6) levels, vascular endothelial growth \nfactor (VEGF) and tumour necrosis factor-alpha (TNF-\nα) levels were measured in peritoneal fluid collected \nbefore and after treatment. Elabscience (USA) provided \ncommercially available ELISA kits to measure IL -6 \n(E-EL-R0015), VEGF (E-EL-R2603) and TNF-α (E-\nEL-R2856). Cytokine levels were measured according \nto kit procedures. \nRNA isolation and semi-quantitative gene expression \nAll equipment was treated with diethylpyrocarbonate \nto prevent RNase activity. RNA was isolated from \nendometrial cysts (0.1 g) using a Gene Jet RNA \nPurification kit (K0731, Thermo Scientific). Isolated \nRNAs were quantified and run on agarose gel electro-\nphoresis. RNAs were treated with DNAse I (EN0521, \nThermo Scientific) to avoid DNA contamination before \nthe construction of the cDNA library. cDNA libraries \nwere constructed according to the protocol of the \nHigh-Capacity cDNA Reverse Transcription Kit \npurchased from Applied Biosystems™ (Catalog number: \n4368814). cDNA synthesis was confirmed by PCR \nwith glyceraldehyde -3-phosphate dehydrogenase \n(GAPDH) gene -specific primers (Table I). Semi -\nquantitative gene expression in endometrial cysts was \nperformed using gene -specific primers for MMP -9, \nVEGF and Flk-1 genes. AMPIGENE® qPCR Green \nMix (ENZ-NUC104-0200) was supplied by Enzo Life \nSciences (Switzerland) for the PCR reaction mixture. \nAn equal amount of cDNA was added to the PCR \nreaction. The PCR reaction conditions were optimized \nas initial denaturation at 95°C for 2 min, denaturation \nat 95°C for 5 sec, annealing and extension at 50°C \nfor VEGF, 54°C for Flk-1 and 60°C for MMP-9 for 2 \nmin for 40 cycles. PCR products (10µL) were run in \nan agarose gel electrophoresis system and monitored \nusing a UV transilluminator bioimaging system. Bands \nwere evaluated by using the ImageJ application, and \nthe GAPDH gene was used as a housekeeping gene \n(Table I). \nTable I \nPrimer sequences for semi-quantitative gene expression assay [23] \nPrimer Id Sequence  Base length \nVEGF-RT-F 5’ACCATGAACTTTCTGCTC3’ 18 \nVEGF-RT-R 5’GGACGGCTTGAAGATATA3’ 18 \nFlk-1_RT_F 5’GCACTGAATTATGGGAGA3’ 18 \nFlk-1_RT_R 5’ATGTGATTTTCTTCTTGATG3’ 20 \nMMP-9_RT_F 5’GTTTCTGCCCCAGTGAGAATCTC3’ 23 \nMMP-9_RT_R 5’TGCTGGATGTCTTTTATGTCG3’ 21 \nGAPDH_RT_F 5’CACCACCATGGAGAAGGC3’ 18 \nGAPDH_RT_R 5’CCATCCACAGTCTTCTGA3’ 18 \n \nPhytochemical analysis of the WG extract \nPhenolic bioactive compounds in WG extract were \nscreened and quantitatively measured by LC-MS/MS \n(liquid chromatography-mass spectrometry) validated \nfor 56 compounds [24]. Additionally, the vitamin C \nand vitamin E content of the WG extract were \ndetermined according to procedures of commercially \navailable kits. Vitamin C and vitamin E content were \ndetermined according to the protocol of commercially \navailable kits (E-BC-K034 for vitamin C and E-BC-\nK033 for vitamin E). \nStatistical analysis \nGraphPad Prism 8 was used for statistical analyses. \nData were presented as mean ± standard error of the \nmean (SEM) or standard deviation (SD). Kolmogorov-\nSmirnov or Shapiro -Wilk tests were carried out to \ncontrol whether the distribution is normal or not. \nKruskal-Wallis test was performed for the evaluation \nof the adhesion scores. For the other parameters, one-\nway ANOVA-Dunnett’s post hoc test was performed. \nAll groups were compared to the control group. p < \n0.05 was considered statistically significant. \n \nResults and Discussion \nEctopic endometrial tissue that has been placed out -\nside of the uterus and exhibits pain sensations and \ninfertility is known as endometriosis, a chronic \ninflammatory disease [25]. Proliferation, apoptosis, \ninflammation and angiogenesis are key  biological \nprocesses that are crucial for the development and \nsurvival of endometriotic lesions at ectopic locations \n[26]. Endometriosis is an important worldwide health \n\nFARMACIA, 2023, Vol. 71, 2 \n 274 \nconcern because of its prevalence in women of \nreproductive age (10%) [27]. The use of medicinal \nplants and phytochemicals in natural alternative therapies \nmay present new possibilities for the treatment of \nendometriosis [17]. Numerous natural products with \nvarious medicinal effects have demonstrated a reduction \nin the size of endometriotic lesions, a reduction in \npelvic adhesions, and an improvement in pelvic \ndiscomfort and ovarian function [28]. Medicinal plants \nand their phytochemicals are increasingly being used \nto treat endometriosis due to their anti -angiogenic, \nanti-oxidative, sedative and pain-alleviating characteristics \n[29]. Young leaves of wheat have antioxidant, anti -\ninflammatory, immunomodulatory, anticarcinogenic, \ndiuretic, anti-aging and antibacterial effects because \nof their bioactive compounds [30]. \nAdhesion scoring is widely used for the evaluation \nof endometriotic cysts [31]. Adhesion scores were \nevaluated before and after treatment. According to the \nadhesion scores, there were no significant differences \nbetween groups before treatment. Adhesion scores \nwere between 3.125 ± 0.398 (Control) and 3.417 ± \n0.193 (WG-100) (Table II). Letrozole and WG caused \na decrease in adhesion scores after treatment. The \nlowest adhesion score was in the Letrozole  group \n(1.417 ± 0.452) and statistically significant (p < 0.01) \ncompared to the control group (3.667 ± 0.224). While \nthe adhesion score of WG -100 treatment (2.000 ± \n0.302) was statistically important (p < 0.05) according \nto the control, WG-25 (2.750 ± 0.509) and WG-400 \n(2.833 ± 0.474) adhesion scores after treatment were \nnot significant compared to the control group (Table \nII). Methanolic fraction of the Urtica dioica L. extract \nand its fraction C caused a decrease in adhesion \nscores of endometrial cysts ac cording to the control \ngroup [31]. Treatment of the ethyl acetate fraction of \nthe Achillea biebersteinii Afan. extract in rats with \nendometriosis resulted in the decrease in adhesion \nscore compared to the control [32]. WG ethanolic \nextract (100 mg/kg) had a similar effect, according \nto adhesion score results. \nTable II \nAdhesion scores of endometrial implants before \nand after treatment \n Before treatment After treatment \nControl 3.125 ± 0.398 3.667 ± 0.224 \nLetrozole  3.167 ± 0.322 1.417 ± 0.452** \nWG-25 3.250 ± 0.279 2.750 ± 0.509 \nWG-100 3.417 ± 0.193 2.000 ± 0.302* \nWG-400 3.250 ± 0.329 2.833 ± 0.474 \nData were presented as mean ± SEM. * for p < 0.05 and ** for p \n< 0.01 compared to control in the same column \n \nAccording to endometriotic cyst volume change results, \nLetrozole which was used as a reference drug and \nWG extracts caused significant decreases compared \nto the control group (p < 0.0001) (Figure 1). The most \neffective treatment was determined in the Letrozole \ngroup (84.4% decrease). Endometriotic cyst volume \npercent was increased in the control group (32.2% \nincrease). WG -100, WG -25 and WG -400 extracts \ncaused 74.5%, 65.8% and 52.2% decrease in endo -\nmetriotic cyst volume, respectively (Figure 1). \n \n \nFigure 1. \nEndometriotic volume change percent \n**** indicates p < 0.0001 according to Control \n \nMethanolic extract of Urtica dioica L. and its fraction \nC caused a decrease in the volume of endometrial cysts \n[31]. Additionally, endometrial cyst volume was \ndecreased in the reference group compared to the \ncontrol in the same study. Hydro-methanolic extracts \nof the aerial parts of Alchemilla mollis  (Buser) \nRothm. and Alchemilla persica Rothm. plants caused \na decrease in endometrial cyst volumes [33]. Ethyl \nacetate fraction of the Achillea biebersteinii  Afan. \nextract-treated rats with endometriosis had less \nendometrial cyst volume than the control rats [32]. \nSimilarly, ethanolic WG extract caused a decrease \nin endometrial cyst volume in the current study. \nIl-6 levels increase peritoneal fluid in women with \nendometriosis [34]. VEGF is an important factor in \nthe regulation of both normal and abnormal angio -\ngenesis [35]. Cytokines including IL -6, TNF-α and \nVEGF were evaluated. They present valuable data to \nevaluate endometriosis pathogenesis [36, 37]. High \nlevels of those cytokines were reported in the peritoneal \nfluid of women with endometriosis [38]. IL -6 and \nTNF-α levels in letrozole and WG extract -treated \ngroups were not significantly different compared to \nthe control group. Decreases in IL-6 levels in Letrozole \nand WG -100 groups after treatment were found \nstatistically important compared to control (p < 0.05) \n(Figure 2). While the VEGF level of WG -400 was \nsignificantly higher than the control before treatment, \nit was not different from the control after treatment. \nWhile hydro -methanolic extract of the aerial p arts \nof Alchemilla mollis (Buser) Rothm. caused decreases \nin levels of IL-6, TNF-α and VEGF, their levels were \nnot affected by Alchemilla persica Rothm. aerial extract \neven if it reduced endometrial cyst volume [33]. \n \n\n\nFARMACIA, 2023, Vol. 71, 2 \n 275 \n \nFigure 2. \nCytokine levels before and after treatment \nAsterix (*) on the columns indicates p < 0.05 according to Control \n \nIn a gene expression profiling study, it was reported \nthat the expression of 71 genes was upregulated and \nthat 45 genes were downregulated in the endometriosis \ntissue according to normal uterine [39]. Expression \nof VEGF, Flk-1 and MMP-9 genes in endometriosis \ntissue was high and similar to cancer disease [23]. \nAdditionally, an increase in MMP-9 gene expression \nwas determined in women with endometriosis [40]. \nThe expression of VEGF, MMP -9 and Flk -1 genes \nwas determined in the endometrial cyst tissue in the \ncurrent study (Figure 3). According to semi-quantitative \ngene expression results, expression of the Flk-1 gene \nin the Letrozole group was lower than the control \ngroup. \nPhenolic acids were determined and quantified by \nLC-MS/MS. Wheat seedlings have aconitic acid in \ntheir leaves [41]. Aconitic acid was determined to be \nthe major phenolic acid in WG extract (54.004 mg \nanalyte/g extract) (Table III). Quinic acid (3.687 mg \nanalyte/g extract) and protocatechuic acid (0.014 mg \nanalyte/g extract) were other phenolics in the WG \nextract. Aconitic acid, an organic acid produced by \nhigher plants, has two isomers in nature; cis-aconitic \nacid and trans-aconitic acid [42]. Cis-aconitic acid is \nconverted to itaconate by the cis-aconitate decarboxylase \nenzyme one of the most highly upregulated genes \nduring proinflammatory [43]. Antioxidant and anti -\ninflammatory effects of itaconate have been reported \n[44]. Hydro-alcoholic extract of Echinodorus grandiflorus \nleaves having trans-aconitic acid as a major compound \nhad TNF-α inhibition [45]. Metabolic changes in human \nendometrial stromal cells were induced in oxygen \ndeficiency conditions by reducing the isocitric acid \nand suppressing cis-aconitic and citric acid [46]. \n \n\n\nFARMACIA, 2023, Vol. 71, 2 \n 276 \n \nFigure 3. \nExpression levels of MMP-9, Flk-1 and VEGF genes \nAsterix (*) on the columns indicates p < 0.05 according to Control. Gel figure definitions: 1: Control. 2: Letrozole. \n3: WG-25. 4: WG-100. 5: WG-400 \n \nTable III \nPhytochemicals in the WG extract \nBioactive compound Quantity \nAconitic acid (mg analyte/g extract) 54.004  \nQuinic acid (mg analyte/g extract) 3.687 \nProtocatechuic acid (mg analyte/g extract) 0.014 \nVitamin C (mg/g extract) 7.42 ± 0.13  \nVitamin E (mg/g extract) 5.49 ± 0.08 \n \nVitamin E and vitamin C content of the WG extract \nwere detected at 5.49 ± 0.08 mg/g and 7.42 ± 0.13 \nmg/g, respectively (Table III). Vitamins are essential \nfor human met abolism and disruptions in vitamin \nmetabolism, especially those of vitamin A, vitamin C, \nvitamin D and vitamin E, are related to endometriosis \n[47]. Oxidative stress, characterized by an imbalance \nbetween oxidants and antioxidants [48], occurs during \nendometriosis [49]. Macromolecules that are highly \nimportant for biological activities such as lipids, proteins \nand nucleic acids are targets for oxidants both of \nreactive oxygen and nitrogen species [5 0]. Vitamin \nC and vitamin E are powerful antioxidants to prevent \noxidative stress in endometriosis [47]. Women with \nendometriosis had a low level of vitamin E in their \nserum [51]. Vitamin C and E supplements effectively \nminimized the severity of dysmenorrhea and improved \ndyspareunia and the intensity of pelvic inflammation \n[52]. Additionally, the consumption of nutrients with \nhigh amounts of vitamin C, vitamin E, folate and \nthiamine had a protective role against endometriosis \n[53]. Therefore, supplementation with vitamins C and \nE was linked to a reduction in the levels of oxidative \nstress indicators in endometriosis patients [54]. Intra-\nvenous vitamin C treatment prevented implant induction \nand endometrial cyst volumes in a surgically induced \nendometriosis r at model [55]. In the current study, \nsimilarly, treatments of WG extract rich in vitamin \nC and vitamin E caused a decrease in endometrial \ncysts and adhesions in rats with endometriosis. \n \n \n\n\nFARMACIA, 2023, Vol. 71, 2 \n 277 \nConclusions \nAlthough the WG-25 and WG-400 treatments reduced \nendometriotic cyst volume, they did not reduce \nadhesion scores. Letrozole and WG-100 therapies, on \nthe other hand, reduced both adhesion scores and \nendometriotic cyst volume. Additionally, IL-6 levels \nwere discovered to decrease in Letrozole and WG -\n100 treatments, according to the cytokine findings. \nFurthermore, molecular biology findings (decrease \nin Flk-1 gene expression) suggest that Letrozole is \nmore effective than wheatgrass in healing endometriosis. \nAconitic acid was the major compound in the WG \nextract according to LC -MS/MS analysis and WG \nextract was rich with vitamin C and vitamin E. Because \nof their high phytochemical content, young wheat \nleaves were found to have a healing effect on the \nsurgically induced endometriosis rat model. \n \nAcknowledgement \nThis study was funded by Van Yüzüncü Yıl University \nScientific Research Projects Unit with grant number: \nTYL-2021-9390. \n \nConflict of interest \nThe authors declare no conflict of interest. \n \nReferences \n1. Coiplet E, Courbiere B, Agostini A, Boubli L, \nBretelle F, Netter A, Endometriosis and environmental \nfactors: A critical review. J Gynecol Obstet Hum \nReprod., 2022; 51(7): 102418. \n2. Mortlock S, Corona RI, Kho PF, Pharoah P, Seo JH, \nFreedman ML, Gayther SA, Siedhoff MT, Rogers \nPAW, Leuchter R, Walsh CS, C ass I, Karlan BY, \nRimel BJ, Ovarian Cancer Association Consortium \nIEGC, Montgomery GW, Lawrenson K, Kar SP, A \nmulti-level investigation of the genetic relationship \nbetween endometriosis and ovarian cancer histotypes. \nCell Rep Med., 2022; 3(3): 100542. \n3. Giudice LC, Clinical practice. Endometriosis. N Engl \nJ Med., 2010; 362(25): 2389-2398. \n4. Brilhante AV, Augusto KL, Portela MC, Sucupira LC, \nOliveira LA, Pouchaim AJ, Nobrega LR, Magalhaes \nTF, Sobreira LR, Endometriosis and ovarian cancer: \nAn integrat ive review (Endometriosis and ovarian \ncancer). Asian Pac J Cancer Prev. , 2017; 18(1): \n11-16. \n5. Slopien R, Meczekalski B, Aromatase inhibitors in \nthe treatment of endometriosis. Prz Menopauzalny., \n2016; 15(1): 43-47. \n6. Stochino-Loi E, Major AL, Gillon TER, Ayou bi \nJM, Feki A, Bouquet de Joliniere J, Metformin, the \nRise of a New Medical Therapy for Endometriosis? \nA Systematic Review of the Literature. Front Med., \n2021; 8: 581311. \n7. Bina F, Soleymani S, Toliat T, Hajimahmoodi M, \nTabarrai M, Abdollahi M, Rahimi R, Pla nt-derived \nmedicines for treatment of endometriosis: a \ncomprehensive review of molecular mechanisms. \nPharmacol Res., 2019; 139: 76-90. \n8. Meresman GF, Götte M, Laschke MW, Plants as \nsource of new therapies for endometriosis: a review \nof preclinical and clinical studies. Hum Reprod Updat., \n2021; 27(2): 367-392. \n9. Ben-Arye E, Goldin E, Wengrower D, Stamper A, \nKohn R, Berry E, Wheat grass juice in the treatment \nof active distal ulcerative colitis: A randomized double-\nblind placebo-controlled trial. Scand J Gastroenterol., \n2002; 37(4): 444-449. \n10. Kulkarni SD, Tilak JC, Acharya R, Rajurkar NS, \nDevasagayam TP, Reddy AV, Evaluation of the \nantioxidant activity of wheatgrass (Triticum aestivum \nL.) as a function of growth under different conditions. \nPhytother Res., 2006; 20(3): 218-227. \n11. Lai CN, Dabney BJ, Shaw CR, Inhibition of in vitro \nmetabolic activation of carcinogens by wheat sprout \nextracts. Nutr Cancer, 1978; 1: 27-30. \n12. Marawaha RK, Bansal D, Kaur S, Trehan A, Wheat \ngrass juice reduces transfusion requirement in patients \nwith thalassemia major: a pilot study. Indian Pediatr., \n2004; 41(7): 716-720. \n13. Nenonen MT, Helve TA, Rauma AL, Hanninen OO, \nUncooked, lactobacilli-rich, vegan food and rheumatoid \narthritis. Br J Rheumatol., 1998; 37(3): 274-281. \n14. Worwood VA, Stonehouse J, The endometriosis \nnatural treatment program: A complete self-help plan \nfor improving health and well -being. New World \nLibrary: California, USA, 2011; 288. \n15. Lim TK, Triticum aestivum . In Edible Medicinal \nAnd Non-Medicinal Plants, Lim TK, Ed.; Springer: \nNew York, London, 2013; 5; 385-415. \n16. Hanninen O, Rauma AL, Kaartinen K, Nenonen M, \nVegan diet in physiological health promotion. Acta \nPhysiol Hung., 1999; 86(3-4): 171-180. \n17. Balan A, Moga MA, Dima L, Dinu CG, Martinescu \nCC, Panait DE, Irimie CA, Anastasiu CV, An \noverview on the conservative management of \nendometriosis from a naturopathic perspective: \nPhytochemicals and medicinal plants. Plants, 2021; \n10(3): 587. \n18. Hoagland DR, Arnon DI, The Water-Culture Method \nfor Growing Plants Without Soil. Circular., 1950; \n347: 32.  \n19. Vernon MW, Wilson EA, Studies on the surgical \ninduction of endometriosis in the rat. Fertil Steril., \n1985; 44(5): 684-694. \n20. Bina F, Daglia M, Santarcangelo C, Baeeri M, \nAbdollahi M, Nabavi SM, Tabarrai M, Rahimi R, \nPhytochemical profiling and ameliorative effects of \nAchillea cretica L. on rat model of endometriosis. J \nEthnoparmacol., 2020; 254: 112747. \n21. Blauer KL, Collins RL, The effect of intraperitoneal \nprogesterone on postoperative adhesion formation \nin rabbits. Fertil Steril., 1988; 49(1): 144-149. \n22. Altintas D, Kokcu A, Tosun M, Cetinkaya MB, \nKandemir B, Comparison of the effects of cetrorelix, a \nGnRH antagonist, and leuprolide, a GnRH agonist, \non experimental endometriosis. J Obstet Gynaecol., \n2008; 34(6): 1014-1019. \n23. Machado DE, Berardo PT, Palmero CY, Nasciutti \nLE, Higher expression of vascular endothelial growth \nfactor (VEGF) and its receptor VEGFR -2 (Flk -1) \n\nFARMACIA, 2023, Vol. 71, 2 \n 278 \nand metalloproteinase-9 (MMP-9) in a rat model of \nperitoneal endometriosis is similar to cancer diseases. \nJ Exp Clin Cancer Res., 2010; 29: 1-9. \n24. Yilmaz MA, Simultaneous quantitative screening of \n53 phytochemicals in 33 species of medicinal and \naromatic plants: A detailed, robust and comprehensive \nLC–MS/MS method validation. Ind Crops Prod., 2020; \n149: 112347. \n25. Wang PH, Yang ST, Chang WH, Liu CH, Lee FK, \nLee WL, Endometriosis: part I. basic concept. Taiwan \nJ Obstet Gynecol., 2022; 61(6): 927-934. \n26. Laganà AS, Garzon S, Götte M, Viganò P, Franchi \nM, Ghezzi F, Martin DC, The pathogenesis of \nendometriosis: molecular and cell biology insights. \nInt J Mol Sci., 2019; 20(22): 5615. \n27. Ruszała M, Dłuski DF, Winkler I, Kotarski J, \nRechberger T, Gogacz M, The state of health and the \nquality of life in women suffering from endometriosis. \nJ Clin Med., 2022; 11(7): 2059. \n28. Flower A, Liu JP, Lewith G, Little P, Li Q, Chinese \nherbal medicine for endometriosis. Cochrane Database \nSyst Rev., 2012; 16(5): CD006568. \n29. Ashrafizaveh A, Fard HS, Azmoudeh E, Application \nof medicinal plants, acupuncture, massage therapy \nand transcutaneous electric nerve stimulation in \ntreatment of endometriosis: review study. Iran J \nObstet Gynecol Infertil., 2019; 22(5): 90-100. \n30. Rana S, Kamboj JK, Gandhi V, Living life the natural \nway–Wheatgrass and Health. Funct Foods Health \nDis., 2011; 1(11): 444-456. \n31. Ilhan M, Ali Z, Khan IA, Taştan H, Akkol EK, \nBioactivity-guided isolation of flavonoids from Urtica \ndioica L. and their effect on endometriosis rat model. \nJ Ethnopharmacol., 2019; 243: 112100. \n32. Demirel MA, Suntar I, Ilhan M, Keles H, Akkol \nEK, Experimental endometriosis remission in rats \ntreated with Achillea biebersteinii Afan.: Histopathological \nevaluation and determination of cytokine levels. Eur \nJ Obstet Gynecol Reprod Biol., 2014; 175: 172-177. \n33. Küpeli Akkol E, Demirel MA, Bahadır Acıkara O, \nSüntar I, Ergene B, Ilhan M, Ozbilgin S, Saltan G, \nKeleş H, Tekin M, Phytochemical analyses and \neffects of Alchemilla mollis (Buser) Rothm. and \nAlchemilla persica Rothm. in rat endometriosis model. \nArch Gynecol Obstet.,  2015; 292: 619-628. \n34. Kang YJ, Jeung IC, Park A, Park YJ, Jung H, Kim \nTD, Lee HG, Choi I, Yoon SR, An increased level \nof IL -6 suppresses NK cell activity i n peritoneal \nfluid of patients with endometriosis via regulation \nof SHP-2 expression. Hum Reprod., 2014; 29(10): \n2176-2189. \n35. Takehara M, Ueda M, Yamashita Y, Terai Y, Hung \nYC, Ueki M, Vascular endothelial growth factor A \nand C gene expression in endometriosis. Hum Pathol.,  \n2004; 35(11): 1369-1375. \n36. Eisermann J, Gast MJ, Pineda J, Odem RR, Collins \nJL, Tumor necrosis factor in peritoneal fluid of women \nundergoing laparoscopic surgery. Fertil Steril., 1988; \n50(4): 573-579. \n37. Neto JN, Coelho TM, Aguiar GC, Carvalho LR, de \nAraújo AGP, Girão MJB, Schor E, Experimental \nendometriosis reduction in rats treated with Uncaria \ntomentosa (cat's claw) extract. Eur J Obstet Gynecol \nReprod Biol., 2011; 154(2): 205-208. \n38. Wu MY, Ho HN, The rol e of cytokines in \nendometriosis. Am J Reprod Immunol., 2003; 49(5): \n285-296. \n39. Konno R, Fujiwara H, Netsu S, Odagiri K, Shimane \nM, Nomura H, Suzuki M, Gene expression profiling \nof the rat endometriosis model. Am J Reprod Immunol., \n2007; 58(4): 330-343. \n40. Ueda M, Yamashita Y, Takehara M, Terai Y, Kumagai \nK, Ueki K, Kanda K, Hung Y, Ueki M, Gene expression \nof adhesion molecules and matrix metalloproteinases \nin endometriosis. Gynecol Endocrinol., 2002; 16(5): \n391-402. \n41. Orioli GA, Thompson JF, Aconitate accumulation \nin wheat seedlings. Bot Gaz., 1990; 151(1): 30-37. \n42. Bruni GO, Klasson KT, Aconitic acid recovery \nfrom renewable feedstock and review of chemical \nand biological applications. Foods, 2022; 11(4): 573. \n43. Lampropoulou V, Sergushichev A, Bambouskova M, \nNair S, Vincent EE, Loginicheva E, Cervantes-Barragan \nL, Ma X, Huang SCC, Griss T, Weinheimer CJ, Khader \nS, Randolph GJ, Pearce EJ, Jones RG, Diwan A, \nDiamond MS, Artyomov MN, Itaconate links inhibition \nof succinate dehydrogenase with macrophage metabolic \nremodeling and regulation of inflammation. Cell Metab., \n2016; 24(1): 158-166. \n44. Frieler RA, Vigil TM, Song J, Leung C, Goldstein DR, \nLumeng CN, Mortensen RM, Aconitate decarboxylase \n1 regulates glucose homeostasis and obesity in mice. \nObesity, 2022; 30(9): 1818-1830. \n45. de Faria Garcia E, de Oliveira MA, Dourado LPA, de \nSouza DG, Teixeira MM, Braga FC, In vitro TNF-α \ninhibition elicited by extracts from Echinodorus \ngrandiflorus leaves and correlation with their \nphytochemical composition. Planta Med. , 2016; \n82(04): 337-343. \n46. Kido T, Murata H, Nishigaki A, Tsubokura H, Komiya \nS, Kida N, Kakita-Kobayashi M, Hisamatsu Y, Tsuzuki \nT, Hashimoto Y, Okada H, Glucose transporter 1 is \nimportant for the glycolytic metabolism of human \nendometrial stromal cells in hypoxic environment. \nHeliyon, 2020; 6(6): e03985. \n47. Lu J, Ling X, Liu L, Jiang A, Ren C, Lu C, Yu Z, \nEmerging hallmarks of endometriosis metabolism: A \npromising target for the treatment of endometriosis. \nBiochim Biophys Acta Mol Ce ll Res BBA -Mol Cell \nRes., 2022; 119381. \n48. Donmez F, Dogan A, Investigation of the effects of \nthree different generations of fluoroquinolone derivatives \non antioxidant and immunotoxic enzyme levels in \ndifferent rat tissues. Drug Chem Toxicol. , 2022; \n45(6): 2686-2698. \n49. Harlev A, Gupta S, Agarwal A, Targeting oxidative \nstress to treat endometriosis. Expert Opin Ther \nTargets, 2015; 19(11): 1447-1464. \n50. Vukajlović JT, Kosanić M, Ranković B, \nStanojković T, Marković A, G rujičić D, D jelić N, \nRadaković M, M ilošević-Djordjević O, Evaluation \nof biological activities of acetone extract of the \nmushroom Leccinum scabrum . Farmacia, 20 21; \n69(5): 974-979. \n51. Petean CC, Ferriani RA, dos Reis RM, de Moura MD, \nJordao Jr AA, Navarro PAdAS, Lipid peroxidation \nand vitamin E in serum and follicular fluid of infertile \nwomen with peritoneal endometriosis submitted to \n\nFARMACIA, 2023, Vol. 71, 2 \n 279 \ncontrolled ovarian hyperstimulation: a pilot study. \nFertil Steril., 2008; 90(6): 2080-2085. \n52. Amini L, Chekini R, Nateghi MR, Haghani H, \nJamialahmadi T, Sathyapalan T, Sahebkar A, The effect \nof combined vitamin C and vitamin E supplementation \non oxidative stress markers in women with endometriosis: \na randomized, triple-blind placebo-controlled clinical \ntrial. Pain Res Manag., 2021: 5529741. \n53. Darling AM, Cha varro JE, Malspeis S, Harris HR, \nMissmer SA, A prospective cohort study of Vitamins \nB, C, E, and multivitamin intake and endometriosis. \nJ Endometr Pelvic Pain Disord., 2013; 5(1): 17-26. \n54. Mier-Cabrera J, Genera-García M, De la Jara-Díaz J, \nPerichart-Perera O, Vadillo -Ortega F, Hernández -\nGuerrero C, Effect of vitamins C and E supplementation \non peripheral oxidative stress markers and pregnancy \nrate in women with endometriosis. Int J Gynecol \nObstet., 2008; 100(3): 252-256. \n55. Erten OU, Ensari TA, Dilbaz B, Cakiro glu H, \nAltinbas SK, Çaydere M, Goktolga U, Vitamin C is \neffective for the prevention and regression of \nendometriotic implants in an experimentally induced \nrat model of endometriosis. Taiwan J Obstet Gynecol., \n2016; 55(2): 251-257.","source_license":"CC0","license_restricted":false}