Exosomal tRF-Leu-AAG-001 Derived from Mast Cell as a Potential Non-invasive Diagnostic Biomarker for Endometriosis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Exosomal tRF-Leu-AAG-001 Derived from Mast Cell as a Potential Non-invasive Diagnostic Biomarker for Endometriosis Yingxue Li, Shuling Cui, Zemin Xu, Yanping Zhang, Tao Wu, Jing Zhang, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-1126082/v2 This work is licensed under a CC BY 4.0 License Status: Under Review Version 2 posted 8 You are reading this latest preprint version Show more versions Abstract Background: The diagnosis of endometriosis (EMs) is still based on laparoscopic observation. This study tries to verify whether exosomal tRNA-derived fragments (tRFs) in leucorrhea can be used as non-invasive diagnostic markers. Methods: Endometrial tissues and leucorrhea were sampled from women hospitalized in Ningbo University Affiliated Hospital from January 2021 to July 2021 with (n=26) and without endometriosis (n=25). Exosomes were isolated from samples by differential centrifugation. The small RNA sequencing was performed to detect the exosomal tRNA halves (tiRNAs)&tRFs. RNA probe and immunofluorescence antibody were used to localize the origin of tRFs. From mast cell lines infected with tRF-Leu-AAG-001 siRNA, we observed the change in vascular capacity and expression of inflammatory factors. The specificity and sensitivity tRF were determined by receiver operating characteristic analyses. Results: 63 up-regulated and 45 down-regulated tRFs&tiRNAs were identified in ectopic exosomes. We selected tRF-Leu-AAG-001 as a candidate marker through KEGG pathway enrichment and PCR verification. We found that mast cells highly expressed tRF-Leu-AAG-001 in ectopic foci by immunofluorescence staining. We used siRNA to silenced tRF-Leu-AAG-001 expression in luva, qPCR analysis showed IL-6, IL-10, IL-1β, and TNF-α were significantly decreased. Meanwhile, tRF-Leu-AAG-001 siRNA dramatically reduced the angiogenic ability of luva. Finally, we examined the expression of exosomal tRF-Leu-AAG-001 in the leucorrhea. It was found exosomal tRF-Leu-AAG-001 had high specificity and sensitivity for predicting the occurrence of ectopic disease. Conclusions: Exosomal tRF-Leu-AAG-001 derived from mast cells in ectopic foci might promote inflammation and angiogenesis. Meanwhile,leucorrhea exosomal tRF-Leu-AAG-001 could be a potential diagnostic biomarker for endometriosis. Endometriosis Exosomes Leucorrhea Transfer RNA-derived fragment Diagnostic biomarker Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 1. Introduction Endometriosis (EMs) is a common hormone-dependent disease characterized by the growth of endometrial tissue (glands and stroma) outside the uterine cavity and myometrium. EMs can cause dysmenorrhea, infertility, abdominal mass, chronic pelvic pain, and acute abdominal pain, affecting about 10% (190 million women worldwide) of women of reproductive age [ 1 ] , even affecting some postmenopausal women [ 2 ] . Although the pathogenesis of EMs remains unclear, previous studies found that the development of EMs is closely related to multiple processes such as inflammation [ 3 ] , immunity [ 4 ] , endocrine [ 5 ] , and angiogenesis [ 6 ] . Due to the lack of understanding of exact etiology of EMs, currently available clinical treatment and diagnostic approaches are still ineffective for most patients, which is significantly affecting patients' quality of life. tRNA-derived small RNAs(tsRNAs) are the new type of small non-coding RNAs derived from tRNA, which are about 18–40 nucleotides in length. tsRNAs can be divided into two main types: tiRNAs (tRNA halves) and tRFs (tRNA-derived fragments) [ 7 ] . According to studies, the function of tRFs such as miRNAs is considered an essential regulator of various diseases like cancer [ 8 ] , acquired metabolic diseases [ 9 ] , infectious diseases [ 10 ] and neurodegenerative diseases [ 11 ] . Moreover, increasing number of research is starting to show that exosomal tRFs are the potential disease modulators [ 12 ] and circulating diagnostic markers [ 13 ] . Exosomes are small extracellular vesicles(EVs)with a 30-150nm diameter secreted by living cells [ 14 ] . They are widely present in various body fluids such as blood, urine, saliva and breast milk, as well as in tissues and intercellular spaces [ 15 ] . Exosomes can mediate cell-cell communication by transmitting regulatory molecules and genetic information (lipids, proteins, DNA and complex RNA) [ 16 ] . Numerous reports have suggested that exosomes play important regulatory roles in the development of endometriosis. For instance, exosomal lncRNAs and miRNAs are able to accelerate blood vessel regeneration [ 17 ] and even cause infertility [ 18 ] . However, it is rarely reported the role of exosomal tRFs in EMs. In this study, we isolated exosomes from ectopic tissues and sequenced tiRNA&tRFs to screen out the specifically expressed tRF-Leu-AAG-001 in ectopic tissues. We assessed the origin and biological function of tRF-Leu-AAG-001. Finally, the expression of exosomal tRF-Leu-AAG-001 was evaluated in the leucorrhea of EMs patients. The aim of our study is to find a novel biological marker for the non-invasive diagnosis of endometriosis. 2. Materials And Methods 2.1 Ethics Approval and Consent to Participate The written informed consent of each patient participating in the study was obtained. The study protocol and informed consent were approved by the ethics committee of the Affiliated Hospital of Medical School of Ningbo University. All of the methods were carried out in accordance with the Declaration of Helsinki. 2.2 Sample collection All samples (normal/ectopic endometrial tissues and leucorrhea) were collected in the Affiliated Hospital of Medical School of Ningbo University from March 2020 to March 2021. A total of 51 females were enrolled in our study. Among all patients, 26 patients who were diagnosed with EMS through laparoscopy and histopathological examination served as the control group. The remaining 25 patients with non-endometriosis who were admitted to the hospital during the same period included as the control group. Inclusion criteria: 1. No history of treatment with hormones or antibiotics within three months before laparoscopic surgery; 2. No hepatitis, tuberculosis, tumor and other diseases. Exclusion criteria: 1.Treated with hormones and antibiotics recently; 2. With serious organic diseases; 3. Combined with other gynecological diseases such as inflammation of the reproductive system and tumors. (The general information of the enrolled patients was shown in Supplementary table 1). All subjects who had regular menstrual cycles were women of childbearing age who were in non-menstrual period three days before the sample collection. Mast cell line-Luva was generous gift from a laboratory at Zhejiang University. 2.3 Exosomes isolation from tissues and leucorrhea We used differential centrifugation to extract exosomes from tissues and leucorrhea.Briefly: ectopic tissue was disaggregated into a single cell suspension with type IV collagenase (Solarbio, China). Leucorrhea was diluted with PBS to make a mixed solution. The supernatant and leucorrhea solution were centrifuged at 4°C with a high-speed centrifuge (Thermo, USA) at 500g for 10mins to remove living cells, 2000g for 10mins to remove dead cells, and 10,000g for 20mins to eliminate the cell debris. Every step was repeated twice. The supernatant was then centrifuged at 100,000g twice with ultracentrifuge (Beckman, USA) for 70 minutes each time. The exosomes were resuspended or lysed with different reagents for subsequent experiments. 2.4 Exosomal size identification Transmission electron microscopy (TEM) was used to identify the size of exosomes. Briefly, the exosome was dropped on the copper net for 5 mins at room temperature. 3% phosphotungstic acid solution stained the nanoparticles. Then, exosomes were analyzed with a transmission electron microscope (Hitachi H-7650). The diameter distribution of exosomes was examined by nanoparticle Tracking Analysis (NTA) (Malvern NanoSight NS500) 2.5 Immunoblotting for exosomal markers Exosomes were lysed with a RIPA buffer, resuspended in the loading buffer, boiled at 95°C for 5 minutes, and then electrophoresed on SDS-PAGE. Proteins were transferred to polyvinylidene fluoride membrane, which was blocked with 5% non-fat dry milk in TBST. Immunodetection was performed with anti-HSP70 antibody(1:1000,Proteintech, China), anti-Flotillin-1 antibody (1:1000,Proteintech, China), anti-CD63 antibody (1:1000,Proteintech, China) and anti-calnexin antibody (1:1000,Proteintech, China) at a dilution of 1:1000 followed by incubation at 4°C overnight. The next day protein was incubated with appropriate HRP-conjugated secondary antibody (1:5,000, Abcam, USA). Bands were revealed using ECL Plus and then imaged on the electrophoresis gel imaging analysis system (D-Digital, USA) to analyze. 2.6 Library construction and small RNA sequencing ExoRNA was extracted with Trizol reagent (Invitrogen,USA), and purified RNA was sent to Aksomics Biological Engineering Co., Ltd. (Shanghai, China) for performing tRFs & tiRNAs sequencing analysis. The brief steps were as follows: agarose gel electrophoresis was used to detect the integrity of the total RNA sample, and NanoDrop ND-1000 quantitative analyzer (thermos, USA) quantified RNA concentration. TRF&tiRNA-seq library preparation includes: 1).3'-adapter ligation; 2). 5'-adapter ligation; 3). cDNA synthesis; 4). PCR amplification; 5). size selection of 134-160bp PCR amplified fragments (corresponding to ~14-40nt small RNA). The library was quantitatively analyzed with Agilent 2100 bioanalyzer. According to the quantitative results, the library was mixed in equal amounts. The DNA fragments in the mixed library were denatured with 0.1M NaOH to generate single-stranded DNA molecules, which were loaded onto the kit at a concentration of 1.8 pM. According to the manufacturer's instructions, the NextSeq 500/550 V2 kit (#FC-404-2005, Illumina) was used for sequencing with the NextSeq system. R package edgeR software was used to screen the differentially expressed TRFs and tiRNAs based on the count value. 2.7 Quantitative real-time polymerase chain reaction (qRT-PCR) According to the manufacturer's instructions, total RNAs were extracted from purified exosomes and cultured cells using Trizol reagent (Invitrogen, USA). The extracted RNA was stored at -80℃. The cDNAs were synthesized by using a reverse transcription kit, according to manufacturer's instructions (CWbio, Beijing, China). qRT-PCR for cellular and exosomal RNA, including tRF-Leu-AAG-001, tRF-Leu-TAG-015, IL-6, IL-10, IL-1β, TNF-α and GAPDH, were performed using RT-PCR quantitation kit (CWBio, Beijing, China). Briefly, after an initial denaturation step at 95 °C for 10 min, the amplifications were carried out with 40 cycles at a melting temperature of 95 °C for 15 s, and an annealing temperature of 60 °C for 30 s. The relative expression levels of mRNAs were calculated with 2–ΔCt method. PCR productions of tRF-Leu-AAG-001, tRF-Leu-TAG-015 were tested by 3% agarose. The sequences of the specific primers were presented in table 1. 2.8 3D cell culture Ectopic tissues were digested into the single-cell suspension with type IV collagenase (Solarbio, China). After centrifugation to pellet the cells, NanoShuttle (50μl, Greiner bio-one Co., Germany) was added to the cell suspension, and incubated the cell-nano mix suspension was incubated at 37 ℃ for 1hour. After centrifugation to remove the supernatant, the number of cells was adjusted to 8*10 4 /150ul with the medium mix. The cells were inoculated into a 96 well microplate (cell-repellent surface, Greiner bio-one Co., Germany). Then we hold the microplate on a magnetic driver (Greiner bio-one Co., Germany). The cell balls were placed in a 37°C, 5% cell incubator and incubated for 15 minutes, and then the magnetic driver was removed. 2.9 Fluorescence positioning We used immunofluorescence and RNA fluorescence probes for co-localization of tRF-Leu-AAG-001 and mast cells. We purchased the Cy3-labeled tRF-Leu-AAG-001 fluorescence probe from Ruibo Biotech, and purchased the mast cell marker: anti-CD117-FITC antibody from Thermo Fisher. Briefly: 3D primary ectopic cells were inoculated in 96-well plate for 1h, Cy3-labeled tRF-Leu-AAG-001 fluorescence probe was added and incubated overnight at 37°C. The next day, cell balls were washed with PBS for 5 minutes, protected from light, three times, then added anti-CD117-FITC antibody and incubating at 37°C for 1 hour. Aspirated the secondary antibody and washed with PBS in the dark. Finally, added DAPI solution at room temperature for 5 minutes, photograph the fluorescence with Olympus confocal microscope. 2.10 knockdown of tRF-Leu-AAG-001 by Small interfering RNA tRF-Leu-AAG-001 siRNA and negative control (NC) were designed and compounded by Sangon Biotech. Luva was seeded into 6-well plates, and then they were transfected of siRNA by using Lipofectamine 2000(Invitrogen, USA). After 24h, cells were digested and transferred to T75 culture flask, and we collected the cell supernatant for exosomes isolation at 24h and 48h. 2.11 Tube formation assay The 96-well plate was pre-coated by Matrigel. Before the test, human umbilical vein endothelial cells (HUVECs) were cultured with ECM medium containing 100x growth factor and 5%FBS for 24h. HUVECs were co-cultured with four groups for 24 hours, including luva group, luva treated with tRF-Leu-AAG-001 siRNA group, exosomes derived from luva group, and exosomes treated with tRF-Leu-AAG-001 siRNA group. After treatment, HUVECs were added to 96 wells with 2.5*10 4 cells per well. The vascularization phenomenon was observed under the Olympus microscope. ImageJ software was used to measure blood vessel nodes and capillary length. 2.12 Immunofluorescence This assay was performed to identify the internalization of the exosomes from mast cells into HUVECs. Briefly, isolated exosomes were re-suspended in 200 ul of PBS in a 1.5 ml microcentrifuge tube.Then mast cell-derived exosomes were labeled according to the instructions using the PKH67 Green Fluorescent Cell Linker Mini Kit(Umibio Science and Techology,China) and incubated at 37℃ for 1hour without shaking. Labeled exosomes were centrifuged at 10000g for 70 min, and the supernatant was carefully filtered with a 0.22-μm filter. PHK67-labeled exosomes were then co-cultured with HUVECs for 24 h in a 6-well plate. The cells were then prepared for immunofluorescence analysis, and the internalization of exosomes was subsequently observed under a Confocal laser scanning microscope(LEICA TCS SP8,Germany). 2.13 Statistical Analysis The experimental data were statistically analyzed using GraphPadPrism8.0 (GraphPad Software, USA) and SPSS software (version 21.0; IBM, Armonk, NY, USA). Measurement data were expressed as mean ± standard deviation (SD). Statistical comparisons between the two groups were performed using a Two-tailed Student's t-test, and multiple comparisons were performed using a One-Way Analysis of Variance (ANOVA). P value<0.05 indicates statistical significance. 3. Results 3.1 Identification of ectopic tissue and leucorrhea exosomes To identify the characteristics of exosomes derived from different sources of samples, we used transmission electron microscopy (TME) and nanoparticle tracking analysis (NTA) to observe the size of exosomes. Western blotting was used to clarify the protein markers of extracellular vesicles. Exosomes showed the typical cup-shaped structure with an obvious membrane under TME (Figure 1A). The average diameters of EVs particles measured by NTA were 100 nm ± 30nm (Figure 1B). WB results showed exosomal positive marker proteins, flotillion 1, HSP70 and CD63 were expressed in exosomes, which were purified from ectopic tissue and leucorrhea, while the exosomal negative marker protein, calnexin, was expressed in cell (Figure 1C). 3.2 Study on the tRFs & tiRNAs profiles of exosomes in ectopic tissues Exosomal RNAs were extracted from ectopic tissue (n=3) and normal endometrial tissues(n=3). tRFs & tiRNAs sequencing was performed on the exosomal RNAs. By analyzing the original tRFs & tiRNAs expression profile data, 331 differential tRFs or tiRNAs were screened between the control and EMs groups (Figure 2A). Based on the >1.5-fold difference between the two groups, 108 tRFs or tiRNAs (63 up-regulated and 45 down-regulated) were selected (Figure 2B). Next, we selected seven highly expressed tRFs&tiRNAs in ectopic exosomes to perform KEGG pathway analysis (Supplementary table 2) and found that these specifically expressed tRF&tiRNAs were mainly enriched in ten pathways (Figure 2C), of which the VEGF signaling pathway and Fc epsilon IR signaling pathway were the most influential ones. Therefore, we selected two tRFs&tiRNAs that affect both pathways, tRF-Leu-AAG-001 and tRF-Leu-TAG-015, as candidate markers for follow-up studies. 3.3 Exosomal tRF-Leu-AAG-001 is derived from mast cells in ectopic tissues To verify whether tRF is highly expressed in ectopic tissues, we examined the expression of tRF-Leu-AAG-001 and tRF-Leu-TAG-015 in ectopic tissues and normal intimal tissues. The agarose gel electrophoresis result showed that the expression of tRF-Leu-AAG-001 was significantly higher in ectopic tissues(n=6) than in normal endometrial tissues(n=7)(P=0.016), while there was no significant difference in the expression of tRF-Leu-TAG-015 between the two groups(Figure 3A). In order to further explore which cells in the ectopic tissues highly expressed tRF-Leu-AAG-001, we cultured primary ectopic endometrial cells(n=10) and normal endometrial cells(n=10) to detect the expression of tRF-Leu-AAG-001 in those two types of endometrial cells. The results pointed out that there was no significant difference in the expression of tRF-Leu-AAG-001 between these two types of endometrial cells (P>0.05) (Figure 3B). It was considered that tRF-Leu-AAG-001 was mainly enriched in FcεRI signaling pathways. Therefore, we used fluorescence co-localization to detect whether tRF-Leu-AAG-001 was specifically expressed in mast cells. The results showed that tRF-Leu-AAG-001 fluorescent probes were localized in mast cells in the ectopic 3D cell balls while there was almost no expression in the normal endometrial cell spheres. It is therefore suggested that the high expression of tRF-Leu-AAG-001 in ectopic tissues might come from mast cells (Figure 3C). 3.4 tRF-Leu-AAG-001 regulates Inflammatory factors and angiogenesis in mast cell Due to the difficulty in the extraction of primary mast cells from ectopic tissues, we used mast cell lines, HMC1.1 and Luva, to instead of primary mast cells. First, we examined the expression of tRF-Leu-AAG-001 in two mast cell lines, the gel electrophoresis result showed that tRF-Leu-AAG-001 was highly expressed in luva(Figure 4A). We evaluated the mRNA expression of inflammatory factors after tRF-Leu-AAG-001 knockdown in luva and found that the expression of IL-6, IL-10, IL-1β, TNF-α was significantly decreased (Figure 4B). Meanwhile, we extracted the exosomes derived from luva before and after tRF-Leu-AAG-001 was slienced and co-cultured the exosomes with HUVEC. The results of the tube formation showed that the formation of new blood vessels was markedly reduced after tRF-Leu-AAG-001 knockdown (Figure 4C). 3.5 Exosomal tRF-Leu-AAG-001 in leucorrhea is correlated with endometriosis In order to verify whether exosomal tRF-Leu-AAG-001 can be a marker as a non-invasive diagnosis for endometriosis, we extracted exosomes in the vaginal discharge of patients in the EMs group(n=17) and the control group(n=15). qPCR was utilized to quantify the expression of exosomal tRF-Leu-AAG-001, the results manifested the expression of exosomal tRF-Leu-AAG-001 in EMs groups was significantly higher than that in the control group(p=0.0333)(Figure 5A). The formula's sensitivity and specificity were analyzed to evaluate the occurrence of endometriosis through the receiver operating characteristic (ROC) curve analysis. This analysis revealed that the area under the curve (AUC) was 0.808, the cutoff value was 0.3513, meaning the sensitivity and specificity of exosomal tRF-Leu-AAG-001 were significantly higher (p = 0.003)(Figure 5B). It was suggested that the expression of tRF-Leu-AAG-001 could be used as a potential indicator for the non-invasive diagnosis of endometriosis. 4. Discussion Currently, laparoscopy is still the gold standard for the diagnosis of endometriosis. Although there have been updates on the diagnostic approaches of endometriosis, few studies focus on non-invasive diagnoses. In this study, to find out a potential non-invasive diagnostic marker, we isolated exosomes from ectopic tissue, and the tRNA chip was used to analyze the expression profiles of tRFs & tiRNAs. We obtained 63 tRFs & tiRNAs highly expressed in ectopic tissue-derived exosomes. According to KEGG pathway analysis, tRF-Leu-AAG-001 was selected, which is highly enriched in the VEGF and FcεRI signaling pathway, as a candidate marker. We successfully detected the expression of exosomal tRF-Leu-AAG-001 in the leucorrhea of patients with endometriosis. In addition, we proved that the exosomal tRF-Leu-AAG-001 derived from leucorrhea of EMs patients was a particular indicator. In other diseases, specific tRF&tiRNA have also been gradually considered as reliable biomarkers [19] . In breast cancer, Serum tRF-17-79MP9PP, as a biological marker for detecting breast cancer, has a sensitivity of up to 70% [20] . These altogether supported the great potential of exosomal tRFs as biomarkers in the diagnosis of diseases. To explore the origin of exosomal tRF-Leu-AAG-001 in ectopic tissue, we assessed the expression of tRF-Leu-AAG-001 in primary ectopic cells. WB results showed no difference in the protein expression level of tRF-Leu-AAG-001 between the EMs group and the control group, although tRF-Leu-AAG-001 was found to be expressed in primary ectopic cells. Subsequently, we analyzed the KEGG pathway and considered the detection of tRF-Leu-AAG-001 in mast cells of ectopic tissue. However, because of the scarcity of mast cells in the ectopic tissue, we established the primary 3D cell sphere model to simulate the physiological environment in humans. We utilized the co-localization of RNA probes and fluorescent antibodies and observed that mast cells in ectopic tissues express a high level of tRF-Leu-AAG-001. Thus, we concluded that the increased expression of exosomal tRF-Leu-AAG-001 in ectopic tissues might be secreted by mast cells. Mast cells are redient cells and can release abundant cytokines, chemokines, and biologically active mediators [21] . In studies with animals and human tissue, it was found that the numbers of activated mast cells were visibly increased in endometriotic lesions, resulting in inflammation that was caused by mediators and cytokines that were released from activated mast cells [22] . Clinical sample tests demonstrated various cytokines were elevated in the peritoneal fluid of EMs patients, such as IL-6, IL-8, TNF-α, and glycodelin [23] [24] . In porcine and rabbit, EMs models have supported the concept of a central role for mast cells in a "nerve-mast cell-myofibroblast axis" in some inflammatory processes [25] . In addition, there are reports suggested that owing to the specific tryptases and chymases, mast cells exist in ectopic lesions shows the same angiogenic function as macrophages and fibroblasts [26] [27] . However, only a few studies have explored why mast cells become "excited" in ectopic foci. In our experiment, high expression of tRF-Leu-AAG-001 in mast cells in the ectopic foci triggered the mast cells to express more inflammatory factors IL-6, IL-10, IL-1β, TNF-α. It was implied mast cells were involved in the occurrence of inflammation in ectopic foci. In addition, as the VEGF signaling pathway was also an enrichment pathway for tRF-Leu-AAG-001, we verified that the exosomal tRF-Leu-AAG-001 secreted by mast cells was capable of promoting the formation of peripheral blood vessels. These results provide a reasonable explanation for the abnormal biological function of mast cells in endometriosis. In summary, we investigated the biological functions of tRF-Leu-AAG-001 in mast cells and its secreted exosomal tRF-Leu-AAG-001 in ectopic tissues. It was concluded that tRF-Leu-AAG-001 in mast cells had a significant role in promoting inflammation and angiogenesis in EMs. However, we have not deeply studied the molecular mechanism of the abnormal increase of tRF-Leu-AAG-001 in mast cells. At the same time, it cannot be denied that although mast cells are one of the members of antigen-presenting cells, their number in ectopic tissues is incomparable to other APCs. Therefore, additional research needs to be done to examine whether mast cell tRF-Leu-AAG-001 can play a crucial role in the pathological process of EMs in the future. Secondly, we used optimized technology to detect and evaluate the exosomes tRF-Leu-AAG-001 in leucorrhea with EMs. Overall, these results indicated that leucorrhea exosomal tRF-Leu-AAG-001 has high specificity and sensitivity for the differential diagnosis of EMs. Future experiments will be done on more clinical samples to support exosomal tRF-Leu-AAG-001 is reliable as a non-invasive diagnostic marker. Abbreviations EMs:endometriosis tRFs:tRNA-derived fragments tsRNAs:tRNA-derived small RNAs tiRNAs:tRNA halves EVs:extracellular vesicles HUVECs:human umbilical vein endothelial cells TME:transmission electron microscopy NTA:nanoparticle tracking analysis Declarations a. Ethics Approval and Consent to Participate The written informed consent of each patient participating in the study was obtained. The study protocol and informed consent were approved by the ethics committee of the Affiliated Hospital of Medical School of Ningbo University(No.XJS20191212). All of the methods were carried out in accordance with the Declaration of Helsinki. b. Consent for Publication Not applicable. c. Availability of data and materials The datasets generated and analysed during the current study are available in the GEO DataSets repository, https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE185273. d. Competing interest The authors declared no potential coflicts of interest with respect to the research, author- ship, and publication of this article. e. Funding This work was supported by a grant from the National Natural Science Foundation for Youth, China (No.81901459) Zhejiang Province Public Welfare Project, China (No.LGF19H040003) Natural Science Foundation of Zhejiang, China (No. LH18Y040009) Natural Science Foundation of Ningbo, China(No.2019A610293) Natural Science Foundation of Ningbo, China(No.2018A610394) f. Acknowledements We thank the Affiliated Hospital of Medical School of Ningbo University for assistance in specimen collection. We thank Zhejiang University for providing Mast cell line-Luva. g. Authors' contributions YL contributed to the conception of the study,and was a major contributor in writing the manuscript. SC participated in the design of the study and performed the experiment by collecting cases with clinical data.ZX analyzed the data and performed the statistical analysis.YZ carried out investigation and experimental verification.TW helped perform the analysis with constructive discussions.YC and JZ conducted project administration and writing- reviewing.All authors read and approved the final manuscript. h. Publisher ’ s Note All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher. References Kvaskoff M, Mahamat-Saleh Y, Farland L, et al. Endometriosis and cancer: a systematic review and meta-analysis. Human reproduction update, 2021, 27(2):393–420. https://doi.org/10.1093/humupd/dmaa045 Ianieri M, Buca D, Panaccio P, et al. Retroperitoneal endometriosis in postmenopausal woman causing deep vein thrombosis: case report and review of the literature. Clinical and experimental obstetrics & gynecology, 2017, 44(1):148–150 Huang J, Chen X, Lv Y. HMGB1 Mediated Inflammation and Autophagy Contribute to Endometriosis. Frontiers in endocrinology, 2021, 12:616696. https://doi.org/10.3389/fendo.2021.616696 Shen H, Zhang T, Yang H, et al. Ovarian hormones-autophagy-immunity axis in menstruation and endometriosis. Theranostics, 2021, 11(7):3512–3526. https://doi.org/10.7150/thno.55241 Patel B, Lenk E, Lebovic D, et al. Pathogenesis of endometriosis: Interaction between Endocrine and inflammatory pathways. Best practice & research Clinical obstetrics & gynaecology, 2018, 50:50–60. https://doi.org/10.1016/j.bpobgyn.2018.01.006 Nanda A, K T, Banerjee P, et al. Cytokines, Angiogenesis, and Extracellular Matrix Degradation are Augmented by Oxidative Stress in Endometriosis. Annals of laboratory medicine, 2020, 40(5):390–397. https://doi.org/10.3343/alm.2020.40.5.390 Shen Y, Yu X, Zhu L, et al. Transfer RNA-derived fragments and tRNA halves: biogenesis, biological functions and their roles in diseases. Journal of molecular medicine (Berlin, Germany), 2018, 96(11):1167–1176. https://doi.org/10.1007/s00109-018-1693-y Koi Y, Tsutani Y, Nishiyama Y, et al. Predicting the presence of breast cancer using circulating small RNAs, including those in the extracellular vesicles. Cancer science, 2020, 111(6):2104–2115. https://doi.org/10.1111/cas.14393 Chen Q, Yan M, Cao Z, et al. Sperm tsRNAs contribute to intergenerational inheritance of an acquired metabolic disorder. Science (New York, NY), 2016, 351(6271):397–400. https://doi.org/10.1126/science.aad7977 Ohashi K, Tsutsumi M, Nakajima Y, et al. Telomere changes in human hepatocellular carcinomas and hepatitis virus infected noncancerous livers. Cancer, 1996, 77:1747–1751. https://doi.org/10.1002/(sici)1097-0142(19960415)77:83.0.Co;2-w Wu W, Lee I, Spratt H, et al. tRNA-Derived Fragments in Alzheimer's Disease: Implications for New Disease Biomarkers and Neuropathological Mechanisms. Journal of Alzheimer's disease: JAD, 2021, 79(2):793–806. https://doi.org/10.3233/jad-200917 Wang J, Ma G, Li M, et al. Plasma tRNA Fragments Derived from 5' Ends as Novel Diagnostic Biomarkers for Early-Stage Breast Cancer. Molecular therapy Nucleic acids, 2020, 21:954–964. https://doi.org/10.1016/j.omtn.2020.07.026 Zhu L, Li J, Gong Y, et al. Exosomal tRNA-derived small RNA as a promising biomarker for cancer diagnosis. Molecular cancer, 2019, 18(1):74. https://doi.org/10.1186/s12943-019-1000-8 Farooqi A, Desai N, Qureshi M, et al. Exosome biogenesis, bioactivities and functions as new delivery systems of natural compounds. Biotechnology advances, 2018, 36(1):328–334. https://doi.org/10.1016/j.biotechadv.2017.12.010 Lässer C, Alikhani V, Ekström K, et al. Human saliva, plasma and breast milk exosomes contain RNA: uptake by macrophages. Journal of translational medicine, 2011, 9:9. https://doi.org/10.1186/1479-5876-9-9 Edgar J. Q&A: What are exosomes, exactly? BMC biology, 2016, 14:46. https://doi.org/10.1186/s12915-016-0268-z Qiu J, Lin X, Zheng T, et al. The Exosomal Long Noncoding RNA aHIF is Upregulated in Serum From Patients With Endometriosis and Promotes Angiogenesis in Endometriosis. Reproductive sciences (Thousand Oaks, Calif), 2019, 26(12):1590–1602. https://doi.org/10.1177/1933719119831775 Zhou W, Lian Y, Jiang J, et al. Differential expression of microRNA in exosomes derived from endometrial stromal cells of women with endometriosis-associated infertility. Reproductive biomedicine online, 2020, 41(2):170–181. https://doi.org/10.1016/j.rbmo.2020.04.010 Chen B, Liu S, Wang H, et al. Differential Expression Profiles and Function Prediction of Transfer RNA-Derived Fragments in High-Grade Serous Ovarian Cancer. BioMed research international, 2021, 2021:5594081. https://doi.org/10.1155/2021/5594081 Mo D, He F, Zheng J, et al. viatRNA-Derived Fragment tRF-17-79MP9PP Attenuates Cell Invasion and Migration THBS1/TGF-β1/Smad3 Axis in Breast Cancer. Frontiers in oncology, 2021, 11:656078. https://doi.org/10.3389/fonc.2021.656078 Liang Y, Qiao L, Peng X, et al. The chemokine receptor CCR1 is identified in mast cell-derived exosomes. American journal of translational research, 2018, 10(2):352–367 Binda M, Donnez J, Dolmans M. Targeting mast cells: a new way to treat endometriosis. Expert opinion on therapeutic targets, 2017, 21(1):67–75. https://doi.org/10.1080/14728222.2017.1260548 Mosbah A, Nabiel Y, Khashaba E. Interleukin-6, intracellular adhesion molecule-1, and glycodelin A levels in serum and peritoneal fluid as biomarkers for endometriosis. International journal of gynaecology and obstetrics: the official organ of the International Federation of Gynaecology and Obstetrics, 2016, 134(3):247–251. https://doi.org/10.1016/j.ijgo.2016.01.018 Krasnyi A, Sadekova A, Sefihanov T, et al. [The content of cytokines IL-6, IL-8, TNF-α, IL-4 and the level of expression in macrophages CD86 and CD163 in peritoneal fluid has a reverse correlation with the degree of severity of external genital endometriosis]. Biomeditsinskaia khimiia, 2019, 65(5):432–436. https://doi.org/10.18097/pbmc20196505432 Hart D. Curbing Inflammation in Multiple Sclerosis and Endometriosis: Should Mast Cells Be Targeted? International journal of inflammation, 2015, 2015:452095. https://doi.org/10.1155/2015/452095 Sokolov D, Solodovnikova N, Pavlov O, et al. Study of cytokine profile and angiogenic potential of peritoneal fluid in patients with external genital endometriosis. Bulletin of experimental biology and medicine, 2005, 140(5):541–544. https://doi.org/10.1007/s10517-006-0019-1 Novella-Maestre E, Herraiz S, Vila-Vives J, et al. Effect of antiangiogenic treatment on peritoneal endometriosis-associated nerve fibers. Fertility and sterility, 2012, 98(5):1209–1217. https://doi.org/10.1016/j.fertnstert.2012.07.1103 Tables Table1 | The primer sequences of all genes Gene name Forward(5’ to 3’) Reverse(5’ to 3’) tRF-leu-AAG-001 ATCCCACCGCTGCCACCA tRF-leu-TAG-015 ATCCCACCACTGCCACCA IL-6 ACTCACCTCTTCAGAACGAATTG CCATCTTTGGAAGGTTCAGGTTG IL-10 GACTTTAAGGGTTACCTGGGTTG TCACATGCGCCTTGATGTCTG IL-1 β ATGATGGCTTATTACAGTGGCAA GTCGGAGATTCGTAGCTGGA TNF- α CCTCTCTCTAATCAGCCCTCTG GAGGACCTGGGAGTAGATGAG GAPDH GAAGGTGAAGGTCGGAGT GAAGATGGTGATGGGATTTC U6 CGCTTCGGCAGCACATATAC TTCACGAATTTGCGTGTCAT Additional Declarations No competing interests reported. Supplementary Files SupplementaryTable1.docx SupplementaryTable2.docx WBrawdata.pdf Cite Share Download PDF Status: Under Review Version 2 posted Editorial decision: Major revision 04 May, 2022 Reviews received at journal 24 Apr, 2022 Reviewers agreed at journal 18 Apr, 2022 Reviewers invited by journal 17 Feb, 2022 Editor assigned by journal 17 Feb, 2022 Editor invited by journal 14 Feb, 2022 Submission checks completed at journal 11 Feb, 2022 First submitted to journal 30 Dec, 2021 You are reading this latest preprint version Show more versions Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-1126082","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[{"code":1,"date":"2021-12-01 16:40:49","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":85484220,"identity":"3662fcb7-97c8-4975-8f4b-2b7370f4f4d6","order_by":0,"name":"Yingxue Li","email":"","orcid":"","institution":"Ningbo University","correspondingAuthor":false,"prefix":"","firstName":"Yingxue","middleName":"","lastName":"Li","suffix":""},{"id":85484221,"identity":"028fd97d-cb15-400e-9459-6c2470f26767","order_by":1,"name":"Shuling Cui","email":"","orcid":"","institution":"The Affiliated Hospital of Medical School of Ningbo University","correspondingAuthor":false,"prefix":"","firstName":"Shuling","middleName":"","lastName":"Cui","suffix":""},{"id":85484222,"identity":"b7c22c47-c791-41c9-beb7-e7d70e8c8d41","order_by":2,"name":"Zemin Xu","email":"","orcid":"","institution":"Ningbo Kangning Hospital","correspondingAuthor":false,"prefix":"","firstName":"Zemin","middleName":"","lastName":"Xu","suffix":""},{"id":85484223,"identity":"11fd040f-49d4-4e07-ae14-2c39f099cb0c","order_by":3,"name":"Yanping Zhang","email":"","orcid":"","institution":"Ningbo University","correspondingAuthor":false,"prefix":"","firstName":"Yanping","middleName":"","lastName":"Zhang","suffix":""},{"id":85484224,"identity":"530746e4-d978-4b68-b199-cd59ec271988","order_by":4,"name":"Tao Wu","email":"","orcid":"","institution":"The Affiliated Hospital of Medical School of Ningbo University","correspondingAuthor":false,"prefix":"","firstName":"Tao","middleName":"","lastName":"Wu","suffix":""},{"id":85484225,"identity":"4eadae18-cfac-47fb-9bdb-b11f5bb84c95","order_by":5,"name":"Jing Zhang","email":"","orcid":"","institution":"Ningbo Women\u0026Children’s Hospital","correspondingAuthor":false,"prefix":"","firstName":"Jing","middleName":"","lastName":"Zhang","suffix":""},{"id":85484226,"identity":"d70166b4-bea3-429e-a9ae-f9f85b62fc38","order_by":6,"name":"Yichen Chen","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA3klEQVRIiWNgGAWjYLCChAqJen4JMFNChjgtH87YJEjOYGBsAGrhIUoH48yWtASDG2AtDIS18M9IfsDM23A4z/h28/FHN2oseBjYDx/dgE+LxI00A2beHYeLze4cS2zOOQZ0GE9a2g18WgwkchiYec8cZtx2I8ewOYcNqEWCx4wILW2HGTfPAGn5R6QWxpltaYkbJIBactuI0CJx5pkBKJCNgZ5KnJ3bJ8HDRsgv/O3JD0BRKQcMugOfc77VyfGzHz6GVwuDQAL7DxQBNrzKwdYcIKhkFIyCUTAKRjoAAKjgR2wFhXzqAAAAAElFTkSuQmCC","orcid":"","institution":"Ningbo Women\u0026Children’s Hospital","correspondingAuthor":true,"prefix":"","firstName":"Yichen","middleName":"","lastName":"Chen","suffix":""}],"badges":[],"createdAt":"2021-11-30 04:14:09","currentVersionCode":2,"declarations":"","doi":"10.21203/rs.3.rs-1126082/v2","doiUrl":"https://doi.org/10.21203/rs.3.rs-1126082/v2","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":18527135,"identity":"599dbad8-b885-4a40-bcc8-174e30b7dc76","added_by":"auto","created_at":"2022-02-23 15:43:54","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":2056770,"visible":true,"origin":"","legend":"\u003cp\u003eIdentification of isolated EVs in tissues and leucorrhea. \u003cstrong\u003e(A)\u003c/strong\u003e The morphology of EVs was analyzed by TEM (\u0026lt;200nm). \u003cstrong\u003e(B)\u003c/strong\u003e The diameter distribution of EVs was analyzed with a nanoparticle analyzer. \u003cstrong\u003e(C)\u003c/strong\u003e Western blot analysis of exosomal marker protein Flotillion 1, HSP70,CD63 ,Calnexin.Western blot results showed HSP70,flotillion 1 and CD63, three well-known protein markers, were enriched in exosomes from ectopic tissue and leucorrhea but were undetectable in the cells.While the exosomal negative marker protein, calnexin, was expressed in cells.\u003c/p\u003e","description":"","filename":"Fig1..png","url":"https://assets-eu.researchsquare.com/files/rs-1126082/v2/4db210fde4df916319fbf615.png"},{"id":18526415,"identity":"8982f263-ad53-4355-adde-0fa27c49a7d7","added_by":"auto","created_at":"2022-02-23 15:40:54","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1430903,"visible":true,"origin":"","legend":"\u003cp\u003eIdentification of exosomal tRFs\u0026amp; tiRNAs related to EMs.\u003cstrong\u003e(A)\u003c/strong\u003e Generate heat map after hierarchical cluster analysis. The red (up-regulated) and green (down-regulated) tRFs \u0026amp; tiRNAs expression differences were statistically significant (*p\u0026lt;0.05). \u003cstrong\u003e(B)\u003c/strong\u003e The volcano graph compares the fold change in the expression of tRFs \u0026amp; tiRNAs in exosomes from EMs patients and healthy controls. Red dots represent up-regulated tRFs \u0026amp; tiRNAs, and green dots represent down-regulated tRFs \u0026amp; tiRNAs.\u003cstrong\u003e(C)\u003c/strong\u003e Enrichment analysis of candidate target gene KEGG.\u003c/p\u003e","description":"","filename":"Fig2..png","url":"https://assets-eu.researchsquare.com/files/rs-1126082/v2/a5da1c5491bd97f59bc75efa.png"},{"id":18526418,"identity":"51fa27dd-5d1f-4c18-9f57-eedf70612fdd","added_by":"auto","created_at":"2022-02-23 15:40:54","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":4495202,"visible":true,"origin":"","legend":"\u003cp\u003eExosomal tRF-Leu-AAG-001 derived from mast cells in ectopic tissue. \u003c/p\u003e\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e. Nucleic acid electrophoresis showed that tRF-Leu-AAG-001 was highly expressed in ectopic tissues (*p=0.0116), while the expression of tRF-Leu-TAG-015 had no statistically difference between the EMs group (n=6) and the NE group (n=7). Two-tailed Student's t-test was used.\u003cstrong\u003e(B)\u003c/strong\u003e. There was no significant difference in the expression of tRF-Leu-AAG-001 in the primary ectopic endometrial cells (n=10) and the primary normal endometrial cells (n=10).Two-tailed Student's t-test was used. \u003cstrong\u003e(C)\u003c/strong\u003e. In the 3D cell spheroid model, RNA probes and fluorescence immunolocalization showed that tRF-Leu-AAG-001 was highly expressed in mast cells of the ectopic cell spheroid(200*). Anti-CD117 was the marker of mast cells; DAPI was used for nuclear staining. NE group: normal endometrial group; EC group: ectopic cells.\u0026nbsp;\u003c/p\u003e","description":"","filename":"Fig3.png","url":"https://assets-eu.researchsquare.com/files/rs-1126082/v2/872011d6a0064b494c4dd133.png"},{"id":18526420,"identity":"def52b5c-487a-4fde-942b-0c05a68f3b62","added_by":"auto","created_at":"2022-02-23 15:40:54","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":4846683,"visible":true,"origin":"","legend":"\u003cp\u003eRegulation of inflammatory factors and angiogenesis by tRF-Leu-AAG-001.\u003cstrong\u003e(A)\u003c/strong\u003e According to the analysis of gel electrophoresis results, the histogram showed that luva cell line (n=3) highly expresses tRF-Leu-AAG-001 (***p<0.001). Two-tailed Student's t-test was used. \u003cstrong\u003e(B) \u003c/strong\u003eExosomes labeled with PKH67 (Exo-PKH67) were visible in HUVECs after 24 hours of incubation.The exosomes were stained green by PKH67 and the nuclei were stained blue by DAPI.Scale bar = 25μm.\u003cstrong\u003e (C)\u003c/strong\u003eThe expressions of IL-6, IL-10, IL-1β, and TNF-α were significantly decreased luva cell line (n=3) after tRF-Leu-AAG-001 was knockdown by siRNA(**** p<0.0001).Two-tailed Student's t-test was used. \u003cstrong\u003e(D)\u003c/strong\u003e The tube formation displayed after exosomal tRF-Leu-AAG-001 derived from luva was able to induce angiogenesis (**p<0.01, ****p<0.0001).Two-tailed Student's t-test was used.\u003c/p\u003e","description":"","filename":"Fig4..png","url":"https://assets-eu.researchsquare.com/files/rs-1126082/v2/8619eafc6b118153132633f1.png"},{"id":18526416,"identity":"c4107c31-4943-4bf8-85a5-fdb09684644a","added_by":"auto","created_at":"2022-02-23 15:40:54","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":504575,"visible":true,"origin":"","legend":"\u003cp\u003eExosomal tRF-Leu-AAG-001 in leucorrhea is correlated with endometriosis. \u003cstrong\u003e(A)\u003c/strong\u003e The violin chart compares the expression of tRF-Leu-AAG-001 in leucorrhea exosomes between the control group (n=15) and EMs group (n=17) with statistical significance (*P\u0026lt;0.05).Mann-Whitney U test was used. \u003cstrong\u003e(B)\u003c/strong\u003e The ROC curve of leucorrhea exosomal tRF-Leu-AAG-001, the cutoff value was 0.3513,p=0.003.\u003c/p\u003e","description":"","filename":"Fig5.png","url":"https://assets-eu.researchsquare.com/files/rs-1126082/v2/933a8eeb3af4224b8bac433b.png"},{"id":18527137,"identity":"e0cfa33d-a9ee-483c-9a89-33ffe13837a7","added_by":"auto","created_at":"2022-02-23 15:43:57","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":491548,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-1126082/v2/a1af5c10-9eec-444a-a54f-3bb3917012b9.pdf"},{"id":18526413,"identity":"21b19335-daa9-4f7c-8c82-201344ac9165","added_by":"auto","created_at":"2022-02-23 15:40:54","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":14764,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryTable1.docx","url":"https://assets-eu.researchsquare.com/files/rs-1126082/v2/aa1d1496e019acfe53a818a9.docx"},{"id":18526417,"identity":"8d4e296c-32dc-4204-b0b1-b40598795aa8","added_by":"auto","created_at":"2022-02-23 15:40:54","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":13636,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryTable2.docx","url":"https://assets-eu.researchsquare.com/files/rs-1126082/v2/a4f572cf0bcfd1f3031f9d44.docx"},{"id":18527136,"identity":"8780d089-61c2-480e-8b7f-3ef2c0be41d8","added_by":"auto","created_at":"2022-02-23 15:43:54","extension":"pdf","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":68279,"visible":true,"origin":"","legend":"","description":"","filename":"WBrawdata.pdf","url":"https://assets-eu.researchsquare.com/files/rs-1126082/v2/df675324a358a58bab12589e.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"\u003cp\u003eExosomal tRF-Leu-AAG-001 Derived from Mast Cell as a Potential Non-invasive Diagnostic Biomarker for Endometriosis\u003c/p\u003e","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eEndometriosis (EMs) is a common hormone-dependent disease characterized by the growth of endometrial tissue (glands and stroma) outside the uterine cavity and myometrium. EMs can cause dysmenorrhea, infertility, abdominal mass, chronic pelvic pain, and acute abdominal pain, affecting about 10% (190\u0026nbsp;million women worldwide) of women of reproductive age \u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]\u003c/sup\u003e, even affecting some postmenopausal women \u003csup\u003e[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]\u003c/sup\u003e. Although the pathogenesis of EMs remains unclear, previous studies found that the development of EMs is closely related to multiple processes such as inflammation \u003csup\u003e[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]\u003c/sup\u003e, immunity \u003csup\u003e[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]\u003c/sup\u003e, endocrine \u003csup\u003e[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]\u003c/sup\u003e, and angiogenesis\u003csup\u003e[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]\u003c/sup\u003e. Due to the lack of understanding of exact etiology of EMs, currently available clinical treatment and diagnostic approaches are still ineffective for most patients, which is significantly affecting patients' quality of life.\u003c/p\u003e \u003cp\u003etRNA-derived small RNAs(tsRNAs) are the new type of small non-coding RNAs derived from tRNA, which are about 18\u0026ndash;40 nucleotides in length. tsRNAs can be divided into two main types: tiRNAs (tRNA halves) and tRFs (tRNA-derived fragments)\u003csup\u003e[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/sup\u003e. According to studies, the function of tRFs such as miRNAs is considered an essential regulator of various diseases like cancer\u003csup\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]\u003c/sup\u003e, acquired metabolic diseases\u003csup\u003e[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/sup\u003e, infectious diseases\u003csup\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e and neurodegenerative diseases\u003csup\u003e[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]\u003c/sup\u003e. Moreover, increasing number of research is starting to show that exosomal tRFs are the potential disease modulators \u003csup\u003e[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/sup\u003e and circulating diagnostic markers\u003csup\u003e[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eExosomes are small extracellular vesicles(EVs)with a 30-150nm diameter secreted by living cells\u003csup\u003e[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e. They are widely present in various body fluids such as blood, urine, saliva and breast milk, as well as in tissues and intercellular spaces\u003csup\u003e[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/sup\u003e. Exosomes can mediate cell-cell communication by transmitting regulatory molecules and genetic information (lipids, proteins, DNA and complex RNA)\u003csup\u003e[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/sup\u003e. Numerous reports have suggested that exosomes play important regulatory roles in the development of endometriosis. For instance, exosomal lncRNAs and miRNAs are able to accelerate blood vessel regeneration\u003csup\u003e[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e and even cause infertility\u003csup\u003e[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/sup\u003e. However, it is rarely reported the role of exosomal tRFs in EMs.\u003c/p\u003e \u003cp\u003eIn this study, we isolated exosomes from ectopic tissues and sequenced tiRNA\u0026amp;tRFs to screen out the specifically expressed tRF-Leu-AAG-001 in ectopic tissues. We assessed the origin and biological function of tRF-Leu-AAG-001. Finally, the expression of exosomal tRF-Leu-AAG-001 was evaluated in the leucorrhea of EMs patients. The aim of our study is to find a novel biological marker for the non-invasive diagnosis of endometriosis.\u003c/p\u003e"},{"header":"2. Materials And Methods","content":"\u003cp\u003e\u003cstrong\u003e2.1 Ethics Approval and Consent to Participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe written informed consent of each patient participating in the study was obtained. The study protocol and informed consent were approved by the ethics committee of the Affiliated Hospital of Medical School of Ningbo University. All of the methods were carried out in accordance with the Declaration of Helsinki.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.2 \u003c/strong\u003e\u003cstrong\u003eSample collection\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll samples (normal/ectopic endometrial tissues and leucorrhea) were collected in the Affiliated Hospital of Medical School of Ningbo University from March 2020 to March 2021. A total of 51 females were enrolled in our study. Among all patients, 26 patients who were diagnosed with EMS through laparoscopy and histopathological examination served as the control group. The remaining 25 patients with non-endometriosis who were admitted to the hospital during the same period included as the control group. Inclusion criteria: 1. No history of treatment with hormones or antibiotics within three months before laparoscopic surgery; 2. No hepatitis, tuberculosis, tumor and other diseases. Exclusion criteria: 1.Treated with hormones and antibiotics recently; 2. With serious organic diseases; 3. Combined with other gynecological diseases such as inflammation of the reproductive system and tumors. (The general information of the enrolled patients was shown in Supplementary table 1). All subjects who had regular menstrual cycles were women of childbearing age who were in non-menstrual period three days before the sample collection. Mast cell line-Luva was generous gift from a laboratory at Zhejiang University. \u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.3 Exosomes isolation from tissues and leucorrhea\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe used differential centrifugation to extract exosomes from tissues and leucorrhea.Briefly: ectopic tissue was disaggregated into a single cell suspension with type IV collagenase (Solarbio, China). Leucorrhea was diluted with PBS to make a mixed solution. The supernatant and leucorrhea solution were centrifuged at 4\u0026deg;C with a high-speed centrifuge (Thermo, USA) at 500g for 10mins to remove living cells, 2000g for 10mins to remove dead cells, and 10,000g for 20mins to eliminate the cell debris. Every step was repeated twice. The supernatant was then centrifuged at 100,000g twice with ultracentrifuge (Beckman, USA) for 70 minutes each time. The exosomes were resuspended or lysed with different reagents for subsequent experiments. \u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.4 Exosomal size identification\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTransmission electron microscopy (TEM) was used to identify the size of exosomes. Briefly, the exosome was dropped on the copper net for 5 mins at room temperature. 3% phosphotungstic acid solution stained the nanoparticles. Then, exosomes were analyzed with a transmission electron microscope (Hitachi H-7650). The diameter distribution of exosomes was examined by nanoparticle Tracking Analysis (NTA) (Malvern NanoSight NS500) \u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.5 Immunoblotting for exosomal markers\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eExosomes were lysed with a RIPA buffer, resuspended in the loading buffer, boiled at 95\u0026deg;C for 5 minutes, and then electrophoresed on SDS-PAGE. Proteins were transferred to polyvinylidene fluoride membrane, which was blocked with 5% non-fat dry milk in TBST. Immunodetection was performed with anti-HSP70 antibody(1:1000,Proteintech, China), anti-Flotillin-1 antibody (1:1000,Proteintech, China), anti-CD63 antibody (1:1000,Proteintech, China) and anti-calnexin antibody (1:1000,Proteintech, China) at a dilution of 1:1000 followed by incubation at 4\u0026deg;C overnight. The next day protein was incubated with appropriate HRP-conjugated secondary antibody (1:5,000, Abcam, USA). Bands were revealed using ECL Plus and then imaged on the electrophoresis gel imaging analysis system (D-Digital, USA) to analyze. \u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.6 Library construction and small RNA sequencing\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eExoRNA was extracted with Trizol reagent (Invitrogen,USA), and purified RNA was sent to Aksomics Biological Engineering Co., Ltd. (Shanghai, China) for performing tRFs \u0026amp; tiRNAs sequencing analysis. The brief steps were as follows: agarose gel electrophoresis was used to detect the integrity of the total RNA sample, and NanoDrop ND-1000 quantitative analyzer (thermos, USA) quantified RNA concentration. TRF\u0026amp;tiRNA-seq library preparation includes: 1).3\u0026apos;-adapter ligation; 2). 5\u0026apos;-adapter ligation; 3). cDNA synthesis; 4). PCR amplification; 5). size selection of 134-160bp PCR amplified fragments (corresponding to ~14-40nt small RNA). The library was quantitatively analyzed with Agilent 2100 bioanalyzer. According to the quantitative results, the library was mixed in equal amounts. The DNA fragments in the mixed library were denatured with 0.1M NaOH to generate single-stranded DNA molecules, which were loaded onto the kit at a concentration of 1.8 pM. According to the manufacturer\u0026apos;s instructions, the NextSeq 500/550 V2 kit (#FC-404-2005, Illumina) was used for sequencing with the NextSeq system. R package edgeR software was used to screen the differentially expressed TRFs and tiRNAs based on the count value. \u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.7 Quantitative real-time polymerase chain reaction (qRT-PCR)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAccording to the manufacturer\u0026apos;s instructions, total RNAs were extracted from purified exosomes and cultured cells using Trizol reagent (Invitrogen, USA). The extracted RNA was stored at -80℃. The cDNAs were synthesized by using a reverse transcription kit, according to manufacturer\u0026apos;s instructions (CWbio, Beijing, China). qRT-PCR for cellular and exosomal RNA, including tRF-Leu-AAG-001, tRF-Leu-TAG-015, IL-6, IL-10, IL-1\u0026beta;, TNF-\u0026alpha; and GAPDH, were performed using RT-PCR quantitation kit (CWBio, Beijing, China). Briefly, after an initial denaturation step at 95 \u0026deg;C for 10 min, the amplifications were carried out with 40 cycles at a melting temperature of 95 \u0026deg;C for 15 s, and an annealing temperature of 60 \u0026deg;C for 30 s. The relative expression levels of mRNAs were calculated with 2\u0026ndash;\u0026Delta;Ct method. PCR productions of tRF-Leu-AAG-001, tRF-Leu-TAG-015 were tested by 3% agarose. The sequences of the specific primers were presented in table 1. \u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.8 3D cell culture \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eEctopic tissues were digested into the single-cell suspension with type IV collagenase (Solarbio, China). After centrifugation to pellet the cells, NanoShuttle (50\u0026mu;l, Greiner bio-one Co., Germany) was added to the cell suspension, and incubated the cell-nano mix suspension was incubated at 37 ℃ for 1hour. After centrifugation to remove the supernatant, the number of cells was adjusted to 8*10\u003csup\u003e4\u003c/sup\u003e/150ul with the medium mix. The cells were inoculated into a 96 well microplate (cell-repellent surface, Greiner bio-one Co., Germany). Then we hold the microplate on a magnetic driver (Greiner bio-one Co., Germany). The cell balls were placed in a 37\u0026deg;C, 5% cell incubator and incubated for 15 minutes, and then the magnetic driver was removed.\u003cstrong\u003e \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.9 Fluorescence positioning\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe used immunofluorescence and RNA fluorescence probes for co-localization of tRF-Leu-AAG-001 and mast cells. We purchased the Cy3-labeled tRF-Leu-AAG-001 fluorescence probe from Ruibo Biotech, and purchased the mast cell marker: anti-CD117-FITC antibody from Thermo Fisher. Briefly: 3D primary ectopic cells were inoculated in 96-well plate for 1h, Cy3-labeled tRF-Leu-AAG-001 fluorescence probe was added and incubated overnight at 37\u0026deg;C. The next day, cell balls were washed with PBS for 5 minutes, protected from light, three times, then added anti-CD117-FITC antibody and incubating at 37\u0026deg;C for 1 hour. Aspirated the secondary antibody and washed with PBS in the dark. Finally, added DAPI solution at room temperature for 5 minutes, photograph the fluorescence with Olympus confocal microscope. \u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.10 knockdown of tRF-Leu-AAG-001 by Small interfering RNA\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003etRF-Leu-AAG-001 siRNA and negative control (NC) were designed and compounded by Sangon Biotech. Luva was seeded into 6-well plates, and then they were transfected of siRNA by using Lipofectamine 2000(Invitrogen, USA). After 24h, cells were digested and transferred to T75 culture flask, and we collected the cell supernatant for exosomes isolation at 24h and 48h. \u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.11 Tube formation assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe 96-well plate was pre-coated by Matrigel. Before the test, human umbilical vein endothelial cells (HUVECs) were cultured with ECM medium containing 100x growth factor and 5%FBS for 24h. HUVECs were co-cultured with four groups for 24 hours, including luva group, luva treated with tRF-Leu-AAG-001 siRNA group, exosomes derived from luva group, and exosomes treated with tRF-Leu-AAG-001 siRNA group. After treatment, HUVECs were added to 96 wells with 2.5*10\u003csup\u003e4\u003c/sup\u003e cells per well. The vascularization phenomenon was observed under the Olympus microscope. ImageJ software was used to measure blood vessel nodes and capillary length. \u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.12 Immunofluorescence \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis assay was performed to identify the internalization of the exosomes from mast cells into HUVECs. Briefly, isolated exosomes were re-suspended in 200 ul of PBS in a 1.5 ml microcentrifuge tube.Then mast cell-derived exosomes were labeled according to the instructions using the PKH67 Green Fluorescent Cell Linker Mini Kit(Umibio Science and Techology,China) and incubated at 37℃ for 1hour without shaking. Labeled exosomes were centrifuged at 10000g for 70 min, and the supernatant was carefully filtered with a 0.22-\u0026mu;m filter. PHK67-labeled exosomes were then co-cultured with HUVECs for 24 h in a 6-well plate. The cells were then prepared for immunofluorescence analysis, and the internalization of exosomes was subsequently observed under a Confocal laser scanning microscope(LEICA TCS SP8,Germany). \u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.13 Statistical Analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe experimental data were statistically analyzed using GraphPadPrism8.0 (GraphPad Software, USA) and SPSS software (version 21.0; IBM, Armonk, NY, USA). Measurement data were expressed as mean \u0026plusmn; standard deviation (SD). Statistical comparisons between the two groups were performed using a Two-tailed Student\u0026apos;s t-test, and multiple comparisons were performed using a One-Way Analysis of Variance (ANOVA). P value\u0026lt;0.05 indicates statistical significance.\u003c/p\u003e"},{"header":"3. Results","content":"\u003cp\u003e\u003cstrong\u003e3.1 Identification of ectopic tissue and leucorrhea exosomes\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo identify the characteristics of exosomes derived from different sources of samples, we used transmission electron microscopy (TME) and nanoparticle tracking analysis (NTA) to observe the size of exosomes. Western blotting was used to clarify the protein markers of extracellular vesicles. Exosomes showed the typical cup-shaped structure with an obvious membrane under TME (Figure 1A). The average diameters of EVs particles measured by NTA were 100 nm \u0026plusmn; 30nm (Figure 1B). WB results showed exosomal positive marker proteins, flotillion 1, HSP70 and CD63 were expressed in exosomes, which were purified from ectopic tissue and leucorrhea, while the exosomal negative marker protein, calnexin, was expressed in cell (Figure 1C).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.2 Study on the tRFs \u0026amp; tiRNAs profiles of exosomes in ectopic tissues \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eExosomal RNAs were extracted from ectopic tissue (n=3) and normal endometrial tissues(n=3). tRFs \u0026amp; tiRNAs sequencing was performed on the exosomal RNAs. By analyzing the original tRFs \u0026amp; tiRNAs expression profile data, 331 differential tRFs or tiRNAs were screened between the control and EMs groups (Figure 2A). Based on the \u0026gt;1.5-fold difference between the two groups, 108 tRFs or tiRNAs (63 up-regulated and 45 down-regulated) were selected (Figure 2B). Next, we selected seven highly expressed tRFs\u0026amp;tiRNAs in ectopic exosomes to perform KEGG pathway analysis (Supplementary table 2) and found that these specifically expressed tRF\u0026amp;tiRNAs were mainly enriched in ten pathways (Figure 2C), of which the VEGF signaling pathway and Fc epsilon IR signaling pathway were the most influential ones. Therefore, we selected two tRFs\u0026amp;tiRNAs that affect both pathways, tRF-Leu-AAG-001 and tRF-Leu-TAG-015, as candidate markers for follow-up studies.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.3 Exosomal tRF-Leu-AAG-001 is derived from mast cells in ectopic tissues \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo verify whether tRF is highly expressed in ectopic tissues, we examined the expression of tRF-Leu-AAG-001 and tRF-Leu-TAG-015 in ectopic tissues and normal intimal tissues. The agarose gel electrophoresis result showed that the expression of tRF-Leu-AAG-001 was significantly higher in ectopic tissues(n=6) than in normal endometrial tissues(n=7)(P=0.016), while there was no significant difference in the expression of tRF-Leu-TAG-015 between the two groups(Figure 3A). In order to further explore which cells in the ectopic tissues highly expressed tRF-Leu-AAG-001, we cultured primary ectopic endometrial cells(n=10) and normal endometrial cells(n=10) to detect the expression of tRF-Leu-AAG-001 in those two types of endometrial cells. The results pointed out that there was no significant difference in the expression of tRF-Leu-AAG-001 between these two types of endometrial cells (P\u0026gt;0.05) (Figure 3B). It was considered that tRF-Leu-AAG-001 was mainly enriched in Fc\u0026epsilon;RI signaling pathways. Therefore, we used fluorescence co-localization to detect whether tRF-Leu-AAG-001 was specifically expressed in mast cells. The results showed that tRF-Leu-AAG-001 fluorescent probes were localized in mast cells in the ectopic 3D cell balls while there was almost no expression in the normal endometrial cell spheres. It is therefore suggested that the high expression of tRF-Leu-AAG-001 in ectopic tissues might come from mast cells (Figure 3C).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.4 tRF-Leu-AAG-001 regulates Inflammatory factors and angiogenesis in mast cell\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDue to the difficulty in the extraction of primary mast cells from ectopic tissues, we used mast cell lines, HMC1.1 and Luva, to instead of primary mast cells. First, we examined the expression of tRF-Leu-AAG-001 in two mast cell lines, the gel electrophoresis result showed that tRF-Leu-AAG-001 was highly expressed in luva(Figure 4A). We evaluated the mRNA expression of inflammatory factors after tRF-Leu-AAG-001 knockdown in luva and found that the expression of IL-6, IL-10, IL-1\u0026beta;, TNF-\u0026alpha; was significantly decreased (Figure 4B). Meanwhile, we extracted the exosomes derived from luva before and after tRF-Leu-AAG-001 was slienced and co-cultured the exosomes with HUVEC. The results of the tube formation showed that the formation of new blood vessels was markedly reduced after tRF-Leu-AAG-001 knockdown (Figure 4C).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.5 Exosomal tRF-Leu-AAG-001 in leucorrhea is correlated with endometriosis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn order to verify whether exosomal tRF-Leu-AAG-001 can be a marker as a non-invasive diagnosis for endometriosis, we extracted exosomes in the vaginal discharge of patients in the EMs group(n=17) and the control group(n=15). qPCR was utilized to quantify the expression of exosomal tRF-Leu-AAG-001, the results manifested the expression of exosomal tRF-Leu-AAG-001 in EMs groups was significantly higher than that in the control group(p=0.0333)(Figure 5A). The formula\u0026apos;s sensitivity and specificity were analyzed to evaluate the occurrence of endometriosis through the receiver operating characteristic (ROC) curve analysis. This analysis revealed that the area under the curve (AUC) was 0.808, the cutoff value was 0.3513, meaning the sensitivity and specificity of exosomal tRF-Leu-AAG-001 were significantly higher (p =\u0026thinsp;0.003)(Figure 5B). It was suggested that the expression of tRF-Leu-AAG-001 could be used as a potential indicator for the non-invasive diagnosis of endometriosis.\u003c/p\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eCurrently, laparoscopy is still the gold standard for the diagnosis of endometriosis. Although there have been updates on the diagnostic approaches of endometriosis, few studies focus on non-invasive diagnoses. In this study, to find out a potential non-invasive diagnostic marker, we isolated exosomes from ectopic tissue, and the tRNA chip was used to analyze the expression profiles of tRFs \u0026amp; tiRNAs. We obtained 63 tRFs \u0026amp; tiRNAs highly expressed in ectopic tissue-derived exosomes. According to KEGG pathway analysis, tRF-Leu-AAG-001 was selected, which is highly enriched in the VEGF and Fc\u0026epsilon;RI signaling pathway, as a candidate marker. We successfully detected the expression of exosomal tRF-Leu-AAG-001 in the leucorrhea of patients with endometriosis. In addition, we proved that the exosomal tRF-Leu-AAG-001 derived from leucorrhea of EMs patients was a particular indicator. In other diseases, specific tRF\u0026amp;tiRNA have also been gradually considered as reliable biomarkers\u003csup\u003e[19]\u003c/sup\u003e. In breast cancer, Serum tRF-17-79MP9PP, as a biological marker for detecting breast cancer, has a sensitivity of up to 70%\u003csup\u003e[20]\u003c/sup\u003e. These altogether supported the great potential of exosomal tRFs as biomarkers in the diagnosis of diseases.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTo explore the origin of exosomal tRF-Leu-AAG-001 in ectopic tissue, we assessed the expression of tRF-Leu-AAG-001 in primary ectopic cells. WB results showed no difference in the protein expression level of tRF-Leu-AAG-001 between the EMs group and the control group, although tRF-Leu-AAG-001 was found to be expressed in primary ectopic cells. Subsequently, we analyzed the KEGG pathway and considered the detection of tRF-Leu-AAG-001 in mast cells of ectopic tissue. However, because of the scarcity of mast cells in the ectopic tissue, we established the primary 3D cell sphere model to simulate the physiological environment in humans. We utilized the co-localization of RNA probes and fluorescent antibodies and observed that mast cells in ectopic tissues express a high level of tRF-Leu-AAG-001. Thus, we concluded that the increased expression of exosomal tRF-Leu-AAG-001 in ectopic tissues might be secreted by mast cells.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eMast cells are redient cells and can release abundant cytokines, chemokines, and biologically active mediators\u003csup\u003e[21]\u003c/sup\u003e. In studies with animals and human tissue, it was found that the numbers of activated mast cells were visibly increased in endometriotic lesions, resulting in inflammation that was caused by mediators and cytokines that were released from activated mast cells\u003csup\u003e[22]\u003c/sup\u003e. Clinical sample tests demonstrated various cytokines were elevated in the peritoneal fluid of EMs patients, such as IL-6, IL-8, TNF-\u0026alpha;, and glycodelin\u003csup\u003e[23]\u003c/sup\u003e \u003csup\u003e[24]\u003c/sup\u003e. In porcine and rabbit, EMs models have supported the concept of a central role for mast cells in a \u0026quot;nerve-mast cell-myofibroblast axis\u0026quot; in some inflammatory processes\u003csup\u003e[25]\u003c/sup\u003e. In addition, there are reports suggested that owing to the specific tryptases and chymases, mast cells exist in ectopic lesions shows the same angiogenic function as macrophages and fibroblasts \u003csup\u003e[26]\u003c/sup\u003e \u003csup\u003e[27]\u003c/sup\u003e. However, only a few studies have explored why mast cells become \u0026quot;excited\u0026quot; in ectopic foci. In our experiment, high expression of tRF-Leu-AAG-001 in mast cells in the ectopic foci triggered the mast cells to express more inflammatory factors IL-6, IL-10, IL-1\u0026beta;, TNF-\u0026alpha;. It was implied mast cells were involved in the occurrence of inflammation in ectopic foci. In addition, as the VEGF signaling pathway was also an enrichment pathway for tRF-Leu-AAG-001, we verified that the exosomal tRF-Leu-AAG-001 secreted by mast cells was capable of promoting the formation of peripheral blood vessels. These results provide a reasonable explanation for the abnormal biological function of mast cells in endometriosis.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn summary, we investigated the biological functions of tRF-Leu-AAG-001 in mast cells and its secreted exosomal tRF-Leu-AAG-001 in ectopic tissues. It was concluded that tRF-Leu-AAG-001 in mast cells had a significant role in promoting inflammation and angiogenesis in EMs. However, we have not deeply studied the molecular mechanism of the abnormal increase of tRF-Leu-AAG-001 in mast cells. At the same time, it cannot be denied that although mast cells are one of the members of antigen-presenting cells, their number in ectopic tissues is incomparable to other APCs. Therefore, additional research needs to be done to examine whether mast cell tRF-Leu-AAG-001 can play a crucial role in the pathological process of EMs in the future. Secondly, we used optimized technology to detect and evaluate the exosomes tRF-Leu-AAG-001 in leucorrhea with EMs. Overall, these results indicated that leucorrhea exosomal tRF-Leu-AAG-001 has high specificity and sensitivity for the differential diagnosis of EMs. Future experiments will be done on more clinical samples to support exosomal tRF-Leu-AAG-001 is reliable as a non-invasive diagnostic marker.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eEMs:endometriosis\u003c/p\u003e\n\u003cp\u003etRFs:tRNA-derived fragments \u003c/p\u003e\n\u003cp\u003etsRNAs:tRNA-derived small RNAs\u003c/p\u003e\n\u003cp\u003etiRNAs:tRNA halves\u003c/p\u003e\n\u003cp\u003eEVs:extracellular vesicles\u003c/p\u003e\n\u003cp\u003eHUVECs:human umbilical vein endothelial cells \u003c/p\u003e\n\u003cp\u003eTME:transmission electron microscopy \u003c/p\u003e\n\u003cp\u003eNTA:nanoparticle tracking analysis \u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003ea. Ethics Approval and Consent to Participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe written informed consent of each patient participating in the study was obtained. The study protocol and informed consent were approved by the ethics committee of the Affiliated Hospital of Medical School of Ningbo University(No.XJS20191212). All of the methods were carried out in accordance with the Declaration of Helsinki.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eb. Consent for Publication \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ec. \u003c/strong\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets generated and analysed during the current study are available in the GEO DataSets repository, https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE185273.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ed.\u003c/strong\u003e \u003cstrong\u003eCompeting interest \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declared no potential coflicts of interest with respect to the research, author- ship, and publication of this article.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ee. \u003c/strong\u003e\u003cstrong\u003eFunding \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by a grant from the National Natural Science Foundation for Youth, China (No.81901459)\u003c/p\u003e\n\u003cp\u003eZhejiang Province Public Welfare Project, China (No.LGF19H040003)\u003c/p\u003e\n\u003cp\u003eNatural Science Foundation of Zhejiang, China (No. LH18Y040009)\u003c/p\u003e\n\u003cp\u003eNatural Science Foundation of Ningbo, China(No.2019A610293)\u003c/p\u003e\n\u003cp\u003eNatural Science Foundation of Ningbo, China(No.2018A610394)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ef. Acknowledements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank the Affiliated Hospital of Medical School of Ningbo University for assistance in specimen collection. We thank Zhejiang University for providing Mast cell line-Luva.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eg. Authors\u0026apos; contributions \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eYL contributed to the conception of the study,and was a major contributor in writing the manuscript. SC participated in the design of the study and performed the experiment by collecting cases with clinical data.ZX analyzed the data and performed the statistical analysis.YZ carried out investigation and experimental verification.TW helped perform the analysis with constructive discussions.YC and JZ conducted project administration and writing- reviewing.All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eh. Publisher\u003c/strong\u003e\u003cstrong\u003e\u0026rsquo;\u003c/strong\u003e\u003cstrong\u003es Note \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eKvaskoff M, Mahamat-Saleh Y, Farland L, et al. Endometriosis and cancer: a systematic review and meta-analysis. Human reproduction update, 2021, 27(2):393\u0026ndash;420.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/humupd/dmaa045\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIanieri M, Buca D, Panaccio P, et al. Retroperitoneal endometriosis in postmenopausal woman causing deep vein thrombosis: case report and review of the literature. Clinical and experimental obstetrics \u0026amp; gynecology, 2017, 44(1):148\u0026ndash;150\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang J, Chen X, Lv Y. HMGB1 Mediated Inflammation and Autophagy Contribute to Endometriosis. Frontiers in endocrinology, 2021, 12:616696.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fendo.2021.616696\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShen H, Zhang T, Yang H, et al. Ovarian hormones-autophagy-immunity axis in menstruation and endometriosis. Theranostics, 2021, 11(7):3512\u0026ndash;3526.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.7150/thno.55241\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePatel B, Lenk E, Lebovic D, et al. Pathogenesis of endometriosis: Interaction between Endocrine and inflammatory pathways. Best practice \u0026amp; research Clinical obstetrics \u0026amp; gynaecology, 2018, 50:50\u0026ndash;60.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.bpobgyn.2018.01.006\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNanda A, K T, Banerjee P, et al. Cytokines, Angiogenesis, and Extracellular Matrix Degradation are Augmented by Oxidative Stress in Endometriosis. Annals of laboratory medicine, 2020, 40(5):390\u0026ndash;397.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3343/alm.2020.40.5.390\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShen Y, Yu X, Zhu L, et al. Transfer RNA-derived fragments and tRNA halves: biogenesis, biological functions and their roles in diseases. Journal of molecular medicine (Berlin, Germany), 2018, 96(11):1167\u0026ndash;1176.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00109-018-1693-y\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKoi Y, Tsutani Y, Nishiyama Y, et al. Predicting the presence of breast cancer using circulating small RNAs, including those in the extracellular vesicles. Cancer science, 2020, 111(6):2104\u0026ndash;2115.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/cas.14393\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen Q, Yan M, Cao Z, et al. Sperm tsRNAs contribute to intergenerational inheritance of an acquired metabolic disorder. Science (New York, NY), 2016, 351(6271):397\u0026ndash;400.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1126/science.aad7977\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOhashi K, Tsutsumi M, Nakajima Y, et al. Telomere changes in human hepatocellular carcinomas and hepatitis virus infected noncancerous livers. Cancer, 1996, 77:1747\u0026ndash;1751.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/(sici)1097-0142(19960415)77:8\u0026lt;1747::Aid-cncr50\u0026gt;3.0.Co;2-w\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu W, Lee I, Spratt H, et al. tRNA-Derived Fragments in Alzheimer's Disease: Implications for New Disease Biomarkers and Neuropathological Mechanisms. Journal of Alzheimer's disease: JAD, 2021, 79(2):793\u0026ndash;806.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3233/jad-200917\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang J, Ma G, Li M, et al. Plasma tRNA Fragments Derived from 5' Ends as Novel Diagnostic Biomarkers for Early-Stage Breast Cancer. Molecular therapy Nucleic acids, 2020, 21:954\u0026ndash;964.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.omtn.2020.07.026\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu L, Li J, Gong Y, et al. Exosomal tRNA-derived small RNA as a promising biomarker for cancer diagnosis. Molecular cancer, 2019, 18(1):74.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12943-019-1000-8\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFarooqi A, Desai N, Qureshi M, et al. Exosome biogenesis, bioactivities and functions as new delivery systems of natural compounds. Biotechnology advances, 2018, 36(1):328\u0026ndash;334.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.biotechadv.2017.12.010\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eL\u0026auml;sser C, Alikhani V, Ekstr\u0026ouml;m K, et al. Human saliva, plasma and breast milk exosomes contain RNA: uptake by macrophages. Journal of translational medicine, 2011, 9:9.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/1479-5876-9-9\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEdgar J. Q\u0026amp;A: What are exosomes, exactly? BMC biology, 2016, 14:46.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12915-016-0268-z\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQiu J, Lin X, Zheng T, et al. The Exosomal Long Noncoding RNA aHIF is Upregulated in Serum From Patients With Endometriosis and Promotes Angiogenesis in Endometriosis. Reproductive sciences (Thousand Oaks, Calif), 2019, 26(12):1590\u0026ndash;1602.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1177/1933719119831775\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou W, Lian Y, Jiang J, et al. Differential expression of microRNA in exosomes derived from endometrial stromal cells of women with endometriosis-associated infertility. Reproductive biomedicine online, 2020, 41(2):170\u0026ndash;181.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.rbmo.2020.04.010\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen B, Liu S, Wang H, et al. Differential Expression Profiles and Function Prediction of Transfer RNA-Derived Fragments in High-Grade Serous Ovarian Cancer. BioMed research international, 2021, 2021:5594081.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1155/2021/5594081\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMo D, He F, Zheng J, et al. viatRNA-Derived Fragment tRF-17-79MP9PP Attenuates Cell Invasion and Migration THBS1/TGF-β1/Smad3 Axis in Breast Cancer. Frontiers in oncology, 2021, 11:656078.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fonc.2021.656078\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiang Y, Qiao L, Peng X, et al. The chemokine receptor CCR1 is identified in mast cell-derived exosomes. American journal of translational research, 2018, 10(2):352\u0026ndash;367\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBinda M, Donnez J, Dolmans M. Targeting mast cells: a new way to treat endometriosis. Expert opinion on therapeutic targets, 2017, 21(1):67\u0026ndash;75.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/14728222.2017.1260548\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMosbah A, Nabiel Y, Khashaba E. Interleukin-6, intracellular adhesion molecule-1, and glycodelin A levels in serum and peritoneal fluid as biomarkers for endometriosis. International journal of gynaecology and obstetrics: the official organ of the International Federation of Gynaecology and Obstetrics, 2016, 134(3):247\u0026ndash;251.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ijgo.2016.01.018\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKrasnyi A, Sadekova A, Sefihanov T, et al. [The content of cytokines IL-6, IL-8, TNF-α, IL-4 and the level of expression in macrophages CD86 and CD163 in peritoneal fluid has a reverse correlation with the degree of severity of external genital endometriosis]. Biomeditsinskaia khimiia, 2019, 65(5):432\u0026ndash;436.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.18097/pbmc20196505432\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHart D. Curbing Inflammation in Multiple Sclerosis and Endometriosis: Should Mast Cells Be Targeted? International journal of inflammation, 2015, 2015:452095.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1155/2015/452095\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSokolov D, Solodovnikova N, Pavlov O, et al. Study of cytokine profile and angiogenic potential of peritoneal fluid in patients with external genital endometriosis. Bulletin of experimental biology and medicine, 2005, 140(5):541\u0026ndash;544.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10517-006-0019-1\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNovella-Maestre E, Herraiz S, Vila-Vives J, et al. Effect of antiangiogenic treatment on peritoneal endometriosis-associated nerve fibers. Fertility and sterility, 2012, 98(5):1209\u0026ndash;1217.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.fertnstert.2012.07.1103\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003e\u003cstrong\u003eTable1\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e|\u0026nbsp;\u003c/strong\u003eThe primer sequences of all genes\u003c/p\u003e\n\u003ctable border=\"1\" cellpadding=\"0\" cellspacing=\"0\" width=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"20.09419152276295%\"\u003e\n \u003cp\u003e\u003cstrong\u003eGene name\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"39.403453689167975%\"\u003e\n \u003cp\u003e\u003cstrong\u003eForward(5\u0026rsquo; to 3\u0026rsquo;)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"40.50235478806908%\"\u003e\n \u003cp\u003e\u003cstrong\u003eReverse(5\u0026rsquo; to 3\u0026rsquo;)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"20.09419152276295%\"\u003e\n \u003cp\u003e\u003cstrong\u003etRF-leu-AAG-001\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"39.403453689167975%\"\u003e\n \u003cp\u003eATCCCACCGCTGCCACCA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"40.50235478806908%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"20.09419152276295%\"\u003e\n \u003cp\u003e\u003cstrong\u003etRF-leu-TAG-015\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"39.403453689167975%\"\u003e\n \u003cp\u003eATCCCACCACTGCCACCA\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"40.50235478806908%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"20.09419152276295%\"\u003e\n \u003cp\u003e\u003cstrong\u003eIL-6\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"39.403453689167975%\"\u003e\n \u003cp\u003eACTCACCTCTTCAGAACGAATTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"40.50235478806908%\"\u003e\n \u003cp\u003eCCATCTTTGGAAGGTTCAGGTTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"20.09419152276295%\"\u003e\n \u003cp\u003e\u003cstrong\u003eIL-10\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"39.403453689167975%\"\u003e\n \u003cp\u003eGACTTTAAGGGTTACCTGGGTTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"40.50235478806908%\"\u003e\n \u003cp\u003eTCACATGCGCCTTGATGTCTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"20.09419152276295%\"\u003e\n \u003cp\u003e\u003cstrong\u003eIL-1\u003c/strong\u003e\u003cstrong\u003e\u0026beta;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"39.403453689167975%\"\u003e\n \u003cp\u003eATGATGGCTTATTACAGTGGCAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"40.50235478806908%\"\u003e\n \u003cp\u003eGTCGGAGATTCGTAGCTGGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"20.09419152276295%\"\u003e\n \u003cp\u003e\u003cstrong\u003eTNF-\u003c/strong\u003e\u003cstrong\u003e\u0026alpha;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"39.403453689167975%\"\u003e\n \u003cp\u003eCCTCTCTCTAATCAGCCCTCTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"40.50235478806908%\"\u003e\n \u003cp\u003eGAGGACCTGGGAGTAGATGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"20.09419152276295%\"\u003e\n \u003cp\u003e\u003cstrong\u003eGAPDH\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"39.403453689167975%\"\u003e\n \u003cp\u003eGAAGGTGAAGGTCGGAGT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"40.50235478806908%\"\u003e\n \u003cp\u003eGAAGATGGTGATGGGATTTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"20.09419152276295%\"\u003e\n \u003cp\u003e\u003cstrong\u003eU6\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"39.403453689167975%\"\u003e\n \u003cp\u003eCGCTTCGGCAGCACATATAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"40.50235478806908%\"\u003e\n \u003cp\u003eTTCACGAATTTGCGTGTCAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"bmc-womens-health","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"bmwh","sideBox":"Learn more about [BMC Women's Health](http://bmcwomenshealth.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/bmwh/default.aspx","title":"BMC Women's Health","twitterHandle":"","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Endometriosis, Exosomes, Leucorrhea, Transfer RNA-derived fragment, Diagnostic biomarker","lastPublishedDoi":"10.21203/rs.3.rs-1126082/v2","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-1126082/v2","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground: \u003c/strong\u003eThe diagnosis of endometriosis (EMs) is still based on laparoscopic observation. This study tries to verify whether exosomal tRNA-derived fragments (tRFs) in leucorrhea can be used as non-invasive diagnostic markers.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eMethods: \u003c/strong\u003eEndometrial tissues and leucorrhea were sampled from women hospitalized in Ningbo University Affiliated Hospital from January 2021 to July 2021 with (n=26) and without endometriosis (n=25). Exosomes were isolated from samples by differential centrifugation. The small RNA sequencing was performed to detect the exosomal tRNA halves (tiRNAs)\u0026amp;tRFs. RNA probe and immunofluorescence antibody were used to localize the origin of tRFs. From mast cell lines infected with tRF-Leu-AAG-001 siRNA, we observed the change in vascular capacity and expression of inflammatory factors. The specificity and sensitivity tRF were determined by receiver operating characteristic analyses.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eResults: \u003c/strong\u003e63 up-regulated and 45 down-regulated tRFs\u0026amp;tiRNAs were identified in ectopic exosomes. We selected tRF-Leu-AAG-001 as a candidate marker through KEGG pathway enrichment and PCR verification. We found that mast cells highly expressed tRF-Leu-AAG-001 in ectopic foci by immunofluorescence staining. We used siRNA to silenced tRF-Leu-AAG-001 expression in luva, qPCR analysis showed IL-6, IL-10, IL-1β, and TNF-α were significantly decreased. Meanwhile, tRF-Leu-AAG-001 siRNA dramatically reduced the angiogenic ability of luva. Finally, we examined the expression of exosomal tRF-Leu-AAG-001 in the leucorrhea. It was found exosomal tRF-Leu-AAG-001 had high specificity and sensitivity for predicting the occurrence of ectopic disease. \u003c/p\u003e\u003cp\u003e\u003cstrong\u003eConclusions:\u003c/strong\u003e Exosomal tRF-Leu-AAG-001 derived from mast cells in ectopic foci might promote inflammation and angiogenesis. Meanwhile,leucorrhea exosomal tRF-Leu-AAG-001 could be a potential diagnostic biomarker for endometriosis.\u003c/p\u003e","manuscriptTitle":"Exosomal tRF-Leu-AAG-001 Derived from Mast Cell as a Potential Non-invasive Diagnostic Biomarker for Endometriosis","msid":"","msnumber":"","nonDraftVersions":[{"code":2,"date":"2022-02-23 15:40:52","doi":"10.21203/rs.3.rs-1126082/v2","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major revision","date":"2022-05-04T08:13:56+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2022-04-24T09:53:51+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"428a1ffe-d274-440d-802a-ab5745dab951","date":"2022-04-18T17:14:19+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2022-02-17T17:53:01+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2022-02-17T17:47:17+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2022-02-14T17:38:26+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2022-02-11T18:53:06+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Women's Health","date":"2021-12-30T07:26:37+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"bmc-womens-health","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"bmwh","sideBox":"Learn more about [BMC Women's Health](http://bmcwomenshealth.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/bmwh/default.aspx","title":"BMC Women's Health","twitterHandle":"","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"86786063-6b9c-4a19-af3b-7ec1d0a375ca","owner":[],"postedDate":"February 23rd, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2022-05-30T09:44:29+00:00","versionOfRecord":[],"versionCreatedAt":"2022-02-23 15:40:52","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v2","identity":"rs-1126082","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-1126082","identity":"rs-1126082","version":["v2"]},"buildId":"0U-iFTyB6qxOgVj8rjrZV","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.