The rs2304256, a Non-Synonymous Polymorphism in Tyrosine Kinase 2 Gene is Associated with the Risk of Endometriosis

The objective of the study was to investigate whether the TYK2 gene influences the risk of developing endometriosis in South In - dian women. The non-synonymous SNP , rs2304256, in exon8 of the TYK2 gene was tested for association in a case–control study of 150 affected women and 150 women with no evidence of disease. The genotype frequencies of the polymorphism were compared using polymerase chain reaction and restriction fragment length poly - morphism. Immunohistochemistry was used to analyze the distri - bution and expression of TYK2 in the endometrium of women with and without endometriosis. According to codominant, dominant, and recessive genotype models, statistically significant differences were observed in the genotype distribution and allele frequency (P=0.0432) between the cases and controls. The distribution and expression of TYK2 did not vary in the endometrium of cases and controls. In the present study, we could establish an association be- tween the TYK2 rs2304256 non-synonymous polymorphism with the risk of endometriosis in South Indian women, indicating that this polymorphism may lead to significant disease susceptibility.

Endometriosis; Tyrosine kinase 2; Polymorphism; South Indian women Abbreviations: CI: Confidence Interval; χ 2: Chi Square; D′: Dis - equilibrium Coefficient; LD: Linkage Disequilibrium; HWE: Hardy– Weinberg Equilibrium; OR: Odds Ratio; TYK2: Tyrosine Kinase 2; IL: Interleukin; STAT: Signal Transducer and Activator of Transcription; PCR: Polymerase Chain Reaction; SNPs: Single Nucleotide Polymor- phisms

Endometriosis is a chronic, endocrine gynecologic disease characterized by the implantation of functional endometrial tis- sue at ectopic positions. It is observed mainly in the pelvic area including the ovaries, peritoneal surfaces and ligaments includ- ing bowel and bladder [10]. It affects 10-15% of women in their reproductive age and is responsible for dysmenorrhea, dyspa - reunia, infertility and chronic pelvic pain. Retrograde menstrual invasion and implantation of endometrial stromal cells into the peritoneum are the widely accepted explanations for this con - dition [17]. Although retrograde menstruation is common in 70- 90% of women, the much lower endometriosis prevalence sug- gests that there must be other variables that may contribute to endometriosis pathogenesis. We previously looked at the corre- lation between genetic variants in multiple candidate genes and endometriosis risk in Indian women [4,13-16,32,33], which sug- gested that the condition is polygenic and multifactorial [31]. Submit your Manuscript | www.austinpublishinggroup.com Austin J Obstet Gynecol 10(2): id1216 (2023) - Page - 02 Austin Publishing GroupBhanoori M A complex network of cytokines mediates the immunomod- ulatory mechanisms leading to pathogenesis of endometriosis [39]. An altered secretion of Th1 and Th2 specific cytokines have been implicated in the pathogenesis of the disease. In the peritoneal fluid of affected women, there has been a shift in the balance of Th1/Th2 cytokines toward the Th2 response, contributing to the derangement of immunologic defense mechanism [28]. Elevated levels of Th2-specific cytokines such as interleukin IL-4, IL-5, IL-10 and IL-13 impairs T-cell cytotoxic- ity, enhancing the endometrial cell implantation and growth at the extra uterine sites [11]. Tyrosine Kinase 2 ( TYK2) is located on chromosome 19p13.2 [9] and is implicated in signaling from Th2 cells, for example, through IL-10 and IL-13 receptors activat- ing STAT3 and STAT6 signaling pathway [21,34]. TYK2 is widely studied in the pathogenesis of several tumors because of its critical role in tumor immunosurveillance [20]. Earlier, few genetic association studies have been conducted on TYK2 locus to study its impact on several autoimmune dis - eases, however, the identification has been duplicated in a large number of recent analyses and TYK2 is now considered to be a molecular marker in a variety of autoimmune and inflamma - tory diseases [12]. A non-synonymous SNP of TYK2rs2304256, is widely studied for its association with diseases like systemic lupus erythematosus, Crohn’s disease, rheumatoid arthritis, type 1 diabetes mellitus, ulcerative colitis, etc. [7,22,26]. This study was undertaken to investigate the association of TYK2 rs2304256 polymorphism with the risk of endometriosis in South Indian women.

Study Population The case-control study was carried out on three hundred women in their reproductive age, recruited at the Infertility In - stitute and Research Center (IIRC), Hyderabad, India. The study subjects were obtained as described earlier [33]. Tissue collection The proliferative phase endometrial tissues were collected and fixed as per the method described by Bhanoori et al (2008) [4]. DNA Extraction Salting out procedure was used to extract the genomic DNA from one milliliter of anticoagulated whole blood. Molecular Analysis of TYK2 Genotyping of TYK2 gene polymorphism was carried out by Polymerase Chain Reaction (PCR) and Restriction Frag - ment Length Polymorphism (RFLP) and the results confirmed by Sanger sequencing method as described earlier [16]. The primers and PCR conditions are summarized in (Table 1). The PCR products of TYK2 gene (385 bp) was digested with restric - tion enzyme ( BsmI at 65°C) for 3 h and the DNA fragments were electrophoresed through a 2% agarose gel, stained with ethidium bromide. For the TYK2BsmI C/A SNP , the A allele was represented by DNA band of size 251 and 134bp, the C allele was represented by DNA bands of sizes 385 bp; whereas, the heterozygotes displayed a combination of both alleles (385, 251 and 134bp) (Figure 1). Table 1: Primers and PCR conditions used for TYK2 genotyping. S.no Gene Primers PCR conditions (35 cycles) Amplicon Size 1 TYK2 F:5′TCACCAGGCACTTGTTGTCC 3′ R:5′CGGCTTCCAGCATGTGTATG3′ 5 min at 95˚C, 40 sec at 94˚C, 30 sec at 59˚C,50 sec at 72˚C and 10min72˚C. 385 PCR*: Polymerase Chain Reaction Figure 1: Restriction digestion of TYK2 polymorphism rs2304256 (C/A) by Bsm I. Immunohistochemical Analysis Immunohistochemical analysis of TYK2 expression was per - formed on the proliferative phase endometrial tissue sections from endometriosis patients (n=5) and healthy controls (n=4), using the method described by Bhanoori et al. (2008) [4]. Af - ter the incubation of sections with rabbit polyclonal antibody against TYK2 (1:1000, Cell signaling technology, USA) and FITC-conjugated goat anti-rabbit secondary antibody (1:1000, Sigma–Aldrich, USA), they were washed and mounted with an anti-fade mounting medium (Vector Lab, USA) then visualized using an Axioplan 2 epifluorescence microscope (Carl Zeiss, Inc., USA). Negative controls were obtained by substituting TYK2 antibody with the non-immune rabbit serum. Statistical Analysis Statistical analysis was performed as per the methods de - scribed in our previous study [33].

All subjects (n=300) were successfully genotyped. The geno- type distributions of individual SNPs, as well as allele system, were all in Hardy-Weinberg equilibrium (P <0.05) in both the cases and controls. The results were analyzed in a blinded fash- ion. Genotyping of TYK2 (rs2304256C/A) Polymorphism Sequence analysis of TYK2rs2304256 non-synonymous SNP is shown in Figure 2. The homozygotes (C/C) and (A/A) mani- fested as a single peak, whereas heterozygote (C/A) as double peaks. The genotype and allele (P=0.0432) distribution of TYK2 rs2304256 C/A polymorphism showed significant difference be- tween cases and controls according to codominant, dominant and recessive model (P< 0.05; Table2). The frequencies of allele ’A’ and genotype AA in patients with endometriosis were sig - nificantly higher than those in controls, suggesting that allele ‘A’ and genotype AA are associated with endometriosis. Submit your Manuscript | www.austinpublishinggroup.com Austin J Obstet Gynecol 10(2): id1216 (2023) - Page - 03 Austin Publishing Group Immunohistochemistry of TYK2 Immunostaining of TYK2 was observed in both glandular epi- thelial and stromal cells of endometrium. In the endometria of women with and without endometriosis, we observed no sig - nificant difference in the expression of TYK2 (Figure 3). Table 2: Genotype and allele frequencies of TYK2 gene polymorphism in endometriosis cases and controls. Genotypes/ Alleles Cases (n=150) Controls (n = 150) P-value Odds ratio 95% CI TYK2 rs2304256/ Genotypes Codominant model CC 57 71 - Reference Reference CA 80 75 0.2353 1.3287 0.8306-2.1256 AA Recessive model AA CA+CC Dominant model CA+AA CC 13 13 137 93 57 4 4 146 79 71 0.01328 0.02461 0.10219 4.0482 3.4635 1.4664 1.2519- 13.0907 1.1025- 10.8802 0.9259-2.3225 Alleles C 194 217 Reference Reference A 106 83 0.0432 0.5901 0.3988-0.8731 CI: Confidence Interval. Figure 2: Genotyping of TYK2 gene polymorphism rs2304256 by sequence analysis of the PCR amplified product using a forward primer. Figure 3: Immunohistochemical analysis of TYK 2 expression in phase-matched (proliferative) endometrium from case (A) and control (B).

Endometriosis is a polygenically inherited and multifactorial disease. A variety of genetic association studies have focused on the association between cytokine (TNF-α, IL-2, IL-4, IL-6, IL-10, or IL-16) gene polymorphisms and endometriosis risk [24,25,36,37,38]. However, the studies on the down-stream signaling molecules like JAKs and STATs are very few. It is evident from the literature that the Th2 immune response is associated with endometriosis. [1]. Interleukin IL13, a typical Th2 cytokine is the key regulator of inflammatory and immune responses, that is central to endometriosis and associated abnormalities [8]. Elevated mRNA and protein levels of IL-13 was reported in the peritoneal fluid of endometriosis patients [35]. The same changes are observed in the ectopic endometrium of affected women which could be responsible for the defective immuno- surveillance leading to endometriotic tissue overgrowth [8]. TYK2 is required for mediating the biological function of IL-13 in processes associated with Th2 immune response [5,21]. IL- 13/TYK2 signaling in B cell proliferation, Ig E and MHC class II expression and Th1-cytokines inhibition are well demonstrated in endometriosis [29]. An aberration in TYK2 can lead to abnor- mal STAT6 signaling, gaining resistance to apoptosis and escap- ing the immune surveillance [6,20]. Therefore, TYK2gene may have the crucial importance in regulating immune and/or in- flammatory responses in endometriosis. In the current study, SNP in TYK2 rs2304256 was examined to ascertain whether the polymorphism is associated with en - dometriosis susceptibility in women from South Indian. The non-synonymous SNP rs2304256, a C to An alteration in exon 8 of TYK2, induces a change of valine to phenylalanine at position 362 in the JAK-homology 4 region of TYK2 [30]. Li et al showed that the allele ‘A’ disrupts a putative exonic splicing enhanc - er binding motif affecting the pre-mRNA processing of TYK2; thus, promoting the inclusion of exon 8 in the mRNA, which is essential for TYK2 binding to cytokine receptor [23]. At the rs2304256 locus, we observed that the allele ‘A’ and genotype AA occurred at significantly higher frequency in cases than in controls, indicating that the mutant allele 'A' could be a genetic risk factor for endometriosis. Of note, Peluso et al found no correlation between the SNP rs2304256 and endometriosis risk in the Brazilian population [27], which is inconsistent with the present finding. Possible reasons for this inconsistency could be: first, ethnic variation seen in the polymorphism analyzed. In point of fact, drastic difference was observed between the two populations in the distribution of the 'A' allele. In the Brazilian population, the mutant allele 'A' was found in 26.4 percent of cases and 23.6 percent of controls, whereas in the South In - dian population, the frequencies were 35.3 percent and 27.6 Submit your Manuscript | www.austinpublishinggroup.com Austin J Obstet Gynecol 10(2): id1216 (2023) - Page - 04 Austin Publishing Group

1. Antsiferova YS, Sotnikova NY , Posiseeva LV, Shor AL. Changes in the T-helper cytokine profile and in lymphocyte activation at the systemic and local levels in women with endometriosis. Fertil Steril. 2005; 84: 1705-11. 2. Bhanoori M, Babu KA, Deenadayal M, Kennedy S, Shivaji S. The interleukin-6 -174G/C promoter polymorphism is not associated with endometriosis in South Indian women. J Soc Gynecol Inves- tig. 2005; 12: 365-9. 3. Bhanoori M, Deenadayal M, Kennedy S, Shivaji S. The G2964A 3'-untranslated region polymorphism of the signal transducer and activator of transcription 6 gene is associated with endome- triosis in South Indian women. Hum Reprod. 2007; 22: 1026-30. 4. Bhanoori M, Kameshwari DB, Zondervan KT, Deenadayal M, Ken- nedy S, et al. The endothelial nitric oxide synthase Glu298Asp polymorphism is not a risk factor for endometriosis in south In - dian women. Eur J Obstet Gynecol Reprod Biol. 2008; 139: 53-8. 5. Bhattacharjee A, Shukla M, Yakubenko VP , Mulya A, Kundu S, et al. IL-4 and IL-13 employ discrete signaling pathways for target gene expression in alternatively activated monocytes/macro - phages. Free Radic Biol Med. 2013; 54:1-16. 6. Borcherding DC, He K, Amin NV, Hirbe AC. TYK2 in Cancer Metas- tases: Genomic and Proteomic Discovery. Cancers (Basel). 2021; 13: 4171. 7. Can G, Tezel A, Gürkan H, Can H, Yılmaz B, et al. Tyrosine ki - nase-2 gene polymorphisms are associated with ulcerative coli- tis and Crohn's disease in Turkish Population. Clin Res Hepatol Gastroenterol. 2015; 39: 489-98. 8. Chegini N, Roberts M, Ripps B. Differential expression of inter - leukins (IL)-13 and IL-15 in ectopic and eutopic endometrium of women with endometriosis and normal fertile women. Am J Reprod Immunol. 2003; 49: 75-83. 9. Cunninghame Graham DS, Akil M, Vyse TJ. Association of poly - morphisms across the tyrosine kinase gene, TYK2 in UK SLE fami- lies. Rheumatology (Oxford). 2007; 46: 927-30. 10. Foti PV, Farina R, Palmucci S, Vizzini IAA, Libertini N, et al. Endo- metriosis: clinical features, MR imaging findings and pathologic correlation. Insights Imaging. 2018; 9: 149-172. 11. Gallinelli A, Chiossi G, Giannella L, Marsella T, Genazzani AD, Vol- pe A. Different concentrations of interleukins in the peritoneal fluid of women with endometriosis: relationships with lympho - percent in the current study. The second possible reason could be due to the difference in the sample size used in the study. However, larger population studies may require validating the exact role of this mutation in endometriosis. The expression of TYK2 in the eutopic endometrium of wom- en with and without endometriosis did not differ significantly in our study. Although there are conflicting results on TYK2 expression in various cancers, the majority of research found higher expression in tumor tissues when compared to controls [18,19]. Additionally, a strong correlation between TYK2 over- expression and late-stage tumors was observed, indicating that TYK2 over-expression contributes to the aggressiveness of tumors. However, we found no significant difference in TYK2 expression between eutopic endometria of women with and without endometriosis in the current study. To validate the role of TYK2 expression in the pathophysiology of endometriosis, more research with a bigger sample size is needed. The minor allelic frequency for the SNP evaluated was com - pared with the mutation frequency data from populations of different ethnic origins, obtained from HapMap, 1000Genomes, Genome Aggregation Database (GnomAD) and EXAC database (dbSNP) (Supplementary Table 1). In the cases with the poly - morphism under study, we observed that the minor allelic fre - quency was close to the values reported for Asian populations in the 1000 Genome Database. The frequency of 'A' allele is more common in Asians, Europeans, and Americans than it is in Africans for the TYK2 gene polymorphism rs2304256. Since Indians are a part of Asian ethnic group, the allelic frequency for the SNP rs2304256 found in the cases were very close with the Asians represented in 1000 Genomes, however, further confir - mation requires studies with large sample sizes. JAK-STAT signaling mediates immune regulatory processes that are central in endometriosis development and progression. We believe that the combined effect of various JAK-STAT media- tor polymorphisms may disrupt immune homeostasis leading to the establishment and maintenance of endometrial cells at ectopic locations, as illustrated previously by our team consid - ering IL6 and STAT6 [2,3]. The Discovery of how these genetic polymorphisms interact on endometriosis development may be a crucial step in understanding the pathophysiology of endo - metriosis. In conclusion, our study shows that the TYK2 gene polymor- phism rs2304256 is significantly associated with endometriosis in South Indian women. Analysis of this polymorphism might help to identify patients at high risk for endometriosis devel - opment. Although further work is necessary to understand the molecular mechanism, our findings may lead to new insights into the disease pathogenesis. Author Statements

This work was supported in part by grants from the SERB (DST), India (Lr. No: SR/FT/LS-188/2009) and OU-DST PURSE Programme-II (DST Sanction No. SR/PURSE Phase 2/32(G)), De- partment of Science and Technology (DST), India to Prof. Man - jula Bhanoori. Conflict of Interests The authors declare that there is no conflict of interests. Ethical Approval The study was approved by the ethical committee and re - view board of Centre of Cellular and Molecular biology (CCMB), Hyderabad. In the study all the participants were of South In - dian origin (Dravidian linguistic group). Informed Consent Informed written consent form was obtained from all sub - jects prior to participation in this study. Author’s Contribution KVV: execution of experiments, analysis and interpretation of data, statistical analysis and drafting of manuscript. MLM: Data collection. MD: acquisition of data. SS: analysis and inter - pretation of data, drafting of manuscript. MB: conception and design of study, analysis and interpretation of data, statistical analysis, drafting of manuscript. All authors will have seen and agreed to the ‘Author Contribution’ statement. Submit your Manuscript | www.austinpublishinggroup.com Austin J Obstet Gynecol 10(2): id1216 (2023) - Page - 05 Austin Publishing Group cyte subsets. Gynecol Endocrinol. 2004; 18: 144-51. 12. Gonciarz M, Pawlak-Buś K, Leszczyński P , Owczarek W. TYK2 as a therapeutic target in the treatment of autoimmune and inflam- matory diseases. Immunotherapy. 2021; 13: 1135-1150. 13. Govatati S, Challa K, Reddy SB, Pramod K, Deenadayal M, et al. BRCA1 alterations are associated with endometriosis, but BRCA2 alterations show no detectable endometriosis risk: a study in In- dian population. J Assist Reprod Genet. 2015; 32: 277-85. 14. Govatati S, Deenadayal M, Shivaji S, Bhanoori M. Mitochondrial NADH:ubiquinone oxidoreductase alterations are associated with endometriosis. Mitochondrion. 2013; 13: 782-90. 15. Govatati S, Kodati VL, Deenadayal M, Chakravarty B, Shivaji S, et al. Mutations in the PTEN tumor gene and risk of endometriosis: a case-control study. Hum Reprod. 2014; 29: 324-36. 16. Govatati S, Tangudu NK, Deenadayal M, Chakravarty B, Shivaji S, et al. Association of E-cadherin single nucleotide polymorphisms with the increased risk of endometriosis in Indian women. Mol Hum Reprod. 2012; 18: 280-7. 17. Hill CJ, Fakhreldin M, Maclean A, Dobson L, Nancarrow L, et al. Endometriosis and the Fallopian Tubes: Theories of Origin and Clinical Implications. J Clin Med. 2020; 9: 1905. 18. Ide H, Nakagawa T, Terado Y , Kamiyama Y , Muto S, Horie S. Tyk2 expression and its signaling enhances the invasiveness of pros - tate cancer cells. BiochemBiophys Res Commun. 2008; 369: 292-6. 19. Jia X, Huang C, Hu Y , Wu Q, Liu F, et al. Cirsiliol targets tyrosine kinase 2 to inhibit esophageal squamous cell carcinoma growth in vitro and in vivo. J Exp Clin Cancer Res. 2021; 40: 105. 20. Karjalainen A, Shoebridge S, Krunic M, Simonović N, Tebb G, et al. TYK2 in Tumor Immunosurveillance. Cancers (Basel). 2020; 12: 150. 21. Kelly-Welch AE, Hanson EM, Boothby MR, Keegan AD. Interleu- kin-4 and interleukin-13 signaling connections maps. Science. 2003; 300: 1527-8. 22. Lee YH, Bae SC. Association between TYK2 polymorphisms and susceptibility to autoimmune rheumatic diseases: a meta-analy- sis. Lupus. 2016; 25: 1307-14. 23. Li Z, Rotival M, Patin E, Michel F, Pellegrini S. Two common dis - ease-associated TYK2 variants impact exon splicing and TYK2 dosage. PLoS One. 2020; 15: e0225289. 24. Malutan AM, Drugan C, Drugan T, Ciortea R, Mihu D. The as - sociation between interleukin-4 -590C/T genetic polymorphism, IL-4 serum level, and advanced endometriosis. Cent Eur J Im - munol. 2016; 41: 176-81. 25. Matalliotakis M, Zervou MI, Eliopoulos E, Matalliotaki C, Rah - mioglu N, et al. The role of IL 16 gene polymorphisms in endo - metriosis. Int J Mol Med. 2018; 41: 1469-1476. 26. Pellenz FM, Dieter C, Duarte GCK, Canani LH, de Souza BM, et al. The rs2304256 Polymorphism in TYK2 Gene Is Associated with Protection for Type 1 Diabetes Mellitus. Diabetes Metab J. 2021; 45: 899-908. 27. Peluso C, Christofolini DM, Goldman CS, Mafra FA, Cavalcanti V, et al. TYK2 rs34536443 polymorphism is associated with a de - creased susceptibility to endometriosis-related infertility. Hum Immunol. 2013; 74: 93-7. 28. Podgaec S, Abrao MS, Dias JA Jr, Rizzo LV, de Oliveira RM, et al. Endometriosis: an inflammatory disease with a Th2 immune re- sponse component. Hum Reprod. 2007; 22: 1373-9. 29. Roberts M, Luo X, Chegini N. Differential regulation of interleu - kins IL-13 and IL-15 by ovarian steroids, TNF-alpha and TGF-beta in human endometrial epithelial and stromal cells. Mol Hum Re- prod. 2005; 11: 751-60. 30. Tao JH, Zou YF, Feng XL, Li J, Wang F, et al. Meta-analysis of TYK2 gene polymorphisms association with susceptibility to autoim - mune and inflammatory diseases. Mol Biol Rep. 2011; 38: 4663- 72. 31. Tempfer CB, Simoni M, Destenaves B, Fauser BC. Functional ge- netic polymorphisms and female reproductive disorders: part II- -endometriosis. Hum Reprod Update. 2009; 15: 97-118. 32. Veena KV, Siddamalla S, Deenadayal M, Shivaji S, BhanooriM . DNMT1 and DNMT3B gene variants and their association with endometriosis in South Indian women. Mol Biol Rep. 2022a; 49: 321-329. 33. Veena KV, Siddamalla S, Deenadayal M, Sisinthy S, Bhanoori M. Histone deacetylase 1, Sirtuin 1, and Sirtuin 3 single-nucleotide polymorphisms and the risk of endometriosis in South Indian women. J Obstet Gynaecol. 2022b; 42: 3230-3235. 34. Verma R, Balakrishnan L, Sharma K, Khan AA, Advani J, et al. A network map of Interleukin-10 signaling pathway. J Cell Com - mun Signal. 2016; 10: 61-7. 35. Wang XM, Ma ZY , Song N. Inflammatory cytokines IL-6, IL-10, IL-13, TNF-α and peritoneal fluid flora were associated with in - fertility in patients with endometriosis. Eur Rev Med Pharmacol Sci. 2018; 22: 2513-2518. 36. Wang XQ, Hu M, Chen JM, Sun W, Zhu MB. Effects of gene poly- morphism and serum levels of IL-2 and IL-6 on endometriosis. Eur Rev Med Pharmacol Sci. 2020; 24: 4635-4641. 37. Yasri S, Wiwanitkit V. Tumor necrosis factor-α gene-1031T/C promoter polymorphism and endometriosis. Horm Mol Biol Clin Investig. 2020; 41. 38. Zhang X, Hei P , Deng L, Lin J. Interleukin-10 gene promoter poly- morphisms and their protein production in peritoneal fluid in patients with endometriosis. Mol Hum Reprod. 2007; 13: 135- 40. 39. Zhou WJ, Yang HL, Shao J, Mei J, Chang KK, et al. Anti-inflam - matory cytokines in endometriosis. Cell Mol Life Sci. 2019; 76: 2111-2132.