{"paper_id":"8b8f6715-2b92-4b1c-b554-b5e0500a8919","body_text":"Research Article\nThe rs2304256, a Non-Synonymous Polymorphism in  \nTyrosine Kinase 2 Gene is Associated with the Risk of  \nEndometriosis\nKV Veena1, Madhavi Latha Manolla1, Mamata Deena-\ndayal2, Sisinthy Shivaji3,4 and Manjula Bhanoori1*\n1Department of Biochemistry, Osmania University, India\n2Infertility Institute and Research Centre (IIRC), India\n3Centre for Cellular and Molecular Biology (CCMB), India\n4Presently at: Director of Research, Brien Holden Eye \nResearch Centre, L V Prasad Eye Institute, India\n*Corresponding author: Manjula Bhanoori\nProfessor, Department of Biochemistry, Osmania Univer-\nsity, 500007, Hyderabad, India\nEmail: bhanoorim@yahoo.co.in\nbhanoori@osmania.ac.in\nReceived: February 02, 2023\nAccepted: March 27, 2023\nPublished: April 03, 2023\n \n \nCitation: Savitha MR and Thanuja B. Food Allergens and Aero Allergens Sensitisation. Austin J Asthma Open \nAccess. 2020; 2(1): 1004. \nAustin J Asthma Open Access - Volume 2 Issue 1 - 2020 \nSubmit your Manuscript | www.austinpublishinggroup.com \nSavitha et al. © All rights are reserved \nAustin Journal of Obstetrics and Gynecology\nVolume 10, Issue 2 (2023) \nwww.austinpublishinggroup.com \nBhanoori M © All rights are reserved\nCitation: KV Veena, Manolla ML, Deenadayal M, Shivaji S, Bhanoori M. The rs2304256, a \nNon-Synonymous Polymorphism in Tyrosine Kinase 2 Gene is Associated with the Risk of \nEndometriosis. Austin J Obstet Gynecol. 2023; 10(2): 1216.\nAustin Journal of Obstetrics and Gynecology\nOpen Access\nAbstract\nThe objective of the study was to investigate whether the TYK2 \ngene influences the risk of developing endometriosis in South In -\ndian women. The non-synonymous SNP , rs2304256, in exon8 of the \nTYK2 gene was tested for association in a case–control study of 150 \naffected women and 150 women with no evidence of disease. The \ngenotype frequencies of the polymorphism were compared using \npolymerase chain reaction and restriction fragment length poly -\nmorphism. Immunohistochemistry was used to analyze the distri -\nbution and expression of TYK2 in the endometrium of women with \nand without endometriosis. According to codominant, dominant, \nand recessive genotype models, statistically significant differences \nwere observed in the genotype distribution and allele frequency \n(P=0.0432) between the cases and controls. The distribution and \nexpression of TYK2 did not vary in the endometrium of cases and \ncontrols. In the present study, we could establish an association be-\ntween the TYK2 rs2304256 non-synonymous polymorphism with \nthe risk of endometriosis in South Indian women, indicating that \nthis polymorphism may lead to significant disease susceptibility.\nKeywords: Endometriosis; Tyrosine kinase 2; Polymorphism; \nSouth Indian women\nAbbreviations: CI: Confidence Interval; χ 2: Chi Square; D′: Dis -\nequilibrium Coefficient; LD: Linkage Disequilibrium; HWE: Hardy–\nWeinberg Equilibrium; OR: Odds Ratio; TYK2: Tyrosine Kinase 2; IL: \nInterleukin; STAT: Signal Transducer and Activator of Transcription; \nPCR: Polymerase Chain Reaction; SNPs: Single Nucleotide Polymor-\nphisms\nIntroduction\nEndometriosis is a chronic, endocrine gynecologic disease \ncharacterized by the implantation of functional endometrial tis-\nsue at ectopic positions. It is observed mainly in the pelvic area \nincluding the ovaries, peritoneal surfaces and ligaments includ-\ning bowel and bladder [10]. It affects 10-15% of women in their \nreproductive age and is responsible for dysmenorrhea, dyspa -\nreunia, infertility and chronic pelvic pain. Retrograde menstrual \ninvasion and implantation of endometrial stromal cells into the \nperitoneum are the widely accepted explanations for this con -\ndition [17]. Although retrograde menstruation is common in 70-\n90% of women, the much lower endometriosis prevalence sug-\ngests that there must be other variables that may contribute to \nendometriosis pathogenesis. We previously looked at the corre-\nlation between genetic variants in multiple candidate genes and \nendometriosis risk in Indian women [4,13-16,32,33], which sug-\ngested that the condition is polygenic and multifactorial [31].\n\nSubmit your Manuscript | www.austinpublishinggroup.com Austin J Obstet Gynecol 10(2): id1216 (2023) - Page - 02\nAustin Publishing GroupBhanoori M\nA complex network of cytokines mediates the immunomod-\nulatory mechanisms leading to pathogenesis of endometriosis \n[39]. An altered secretion of Th1 and Th2 specific cytokines \nhave been implicated in the pathogenesis of the disease. In \nthe peritoneal fluid of affected women, there has been a shift  \nin the balance of Th1/Th2 cytokines toward the Th2 response, \ncontributing to the derangement of immunologic defense \nmechanism [28]. Elevated levels of Th2-specific cytokines such \nas interleukin IL-4, IL-5, IL-10 and IL-13 impairs T-cell cytotoxic-\nity, enhancing the endometrial cell implantation and growth at \nthe extra uterine sites [11]. Tyrosine Kinase 2 ( TYK2) is located \non chromosome 19p13.2 [9] and is implicated in signaling from \nTh2 cells, for example, through IL-10 and IL-13 receptors activat-\ning STAT3 and STAT6 signaling pathway [21,34]. TYK2 is widely \nstudied in the pathogenesis of several tumors because of its \ncritical role in tumor immunosurveillance [20].\nEarlier, few genetic association studies have been conducted \non TYK2 locus to study its impact on several autoimmune dis -\neases, however, the identification has been duplicated in a large \nnumber of recent analyses and TYK2 is now considered to be a \nmolecular marker in a variety of autoimmune and inflamma -\ntory diseases [12]. A non-synonymous SNP of TYK2rs2304256, \nis widely studied for its association with diseases like systemic \nlupus erythematosus, Crohn’s disease, rheumatoid arthritis, \ntype 1 diabetes mellitus, ulcerative colitis, etc. [7,22,26]. This \nstudy was undertaken to investigate the association of TYK2 \nrs2304256 polymorphism with the risk of endometriosis in \nSouth Indian women.\nMaterials and Methods\nStudy Population\nThe case-control study was carried out on three hundred \nwomen in their reproductive age, recruited at the Infertility In -\nstitute and Research Center (IIRC), Hyderabad, India. The study \nsubjects were obtained as described earlier [33].\nTissue collection\nThe proliferative phase endometrial tissues were collected \nand fixed as per the method described by Bhanoori et al (2008) \n[4].\nDNA Extraction\nSalting out procedure was used to extract the genomic DNA \nfrom one milliliter of anticoagulated whole blood.\nMolecular Analysis of TYK2\nGenotyping of TYK2 gene polymorphism was carried out \nby Polymerase Chain Reaction (PCR) and Restriction Frag -\nment Length Polymorphism (RFLP) and the results confirmed \nby Sanger sequencing method as described earlier [16]. The \nprimers and PCR conditions are summarized in (Table 1). The \nPCR products of TYK2 gene (385 bp) was digested with restric -\ntion enzyme ( BsmI at 65°C) for 3 h and the DNA fragments \nwere electrophoresed through a 2% agarose gel, stained with \nethidium bromide. For the TYK2BsmI C/A SNP , the A allele was \nrepresented by DNA band of size 251 and 134bp, the C allele \nwas represented by DNA bands of sizes 385 bp; whereas, the \nheterozygotes displayed a combination of both alleles (385, 251 \nand 134bp) (Figure 1).\nTable 1: Primers and PCR conditions used for TYK2 genotyping.\nS.no Gene Primers PCR conditions\n(35 cycles)\nAmplicon\nSize\n1\nTYK2 F:5′TCACCAGGCACTTGTTGTCC 3′\nR:5′CGGCTTCCAGCATGTGTATG3′\n5 min at 95˚C, 40 \nsec at 94˚C, 30 \nsec at 59˚C,50 \nsec at 72˚C\nand 10min72˚C.\n385\nPCR*: Polymerase Chain Reaction\nFigure 1: Restriction digestion of TYK2 polymorphism rs2304256 \n(C/A) by Bsm I.\nImmunohistochemical Analysis\nImmunohistochemical analysis of TYK2 expression was per -\nformed on the proliferative phase endometrial tissue sections \nfrom endometriosis patients (n=5) and healthy controls (n=4), \nusing the method described by Bhanoori et al. (2008) [4]. Af -\nter the incubation of sections with rabbit polyclonal antibody \nagainst TYK2 (1:1000, Cell signaling technology, USA) and \nFITC-conjugated goat anti-rabbit secondary antibody (1:1000, \nSigma–Aldrich, USA), they were washed and mounted with an \nanti-fade mounting medium (Vector Lab, USA) then visualized \nusing an Axioplan 2 epifluorescence microscope (Carl Zeiss, \nInc., USA). Negative controls were obtained by substituting  \nTYK2 antibody with the non-immune rabbit serum.\nStatistical Analysis\nStatistical analysis was performed as per the methods de -\nscribed in our previous study [33].\nResults\nAll subjects (n=300) were successfully genotyped. The geno-\ntype distributions of individual SNPs, as well as allele system, \nwere all in Hardy-Weinberg equilibrium (P <0.05) in both the \ncases and controls. The results were analyzed in a blinded fash-\nion.\nGenotyping of TYK2 (rs2304256C/A) Polymorphism\nSequence analysis of TYK2rs2304256 non-synonymous SNP \nis shown in Figure 2. The homozygotes (C/C) and (A/A) mani-\nfested as a single peak, whereas heterozygote (C/A) as double \npeaks. The genotype and allele (P=0.0432) distribution of TYK2 \nrs2304256 C/A polymorphism showed significant difference be-\ntween cases and controls according to codominant, dominant \nand recessive model (P< 0.05; Table2). The frequencies of allele \n’A’ and genotype AA in patients with endometriosis were sig -\nnificantly higher than those in controls, suggesting that allele ‘A’ \nand genotype AA are associated with endometriosis. \n\nSubmit your Manuscript | www.austinpublishinggroup.com Austin J Obstet Gynecol 10(2): id1216 (2023) - Page - 03\nAustin Publishing Group\nImmunohistochemistry of TYK2\nImmunostaining of TYK2 was observed in both glandular epi-\nthelial and stromal cells of endometrium. In the endometria of \nwomen with and without endometriosis, we observed no sig -\nnificant difference in the expression of TYK2 (Figure 3).\nTable 2: Genotype and allele frequencies of TYK2 gene polymorphism \nin endometriosis cases and controls.\nGenotypes/\nAlleles\nCases\n(n=150)\nControls\n(n = 150) P-value Odds ratio 95% CI\nTYK2\nrs2304256/\nGenotypes\nCodominant \nmodel\nCC 57 71 - Reference Reference\nCA 80 75 0.2353 1.3287 0.8306-2.1256\nAA\nRecessive \nmodel\nAA\nCA+CC\nDominant \nmodel\nCA+AA\nCC\n13\n13\n137\n93\n57\n4\n4\n146\n79\n71\n0.01328\n0.02461\n0.10219\n4.0482\n3.4635\n1.4664\n1.2519-\n13.0907\n1.1025-\n10.8802\n0.9259-2.3225\nAlleles\nC 194 217 Reference Reference\nA 106 83 0.0432 0.5901 0.3988-0.8731\nCI: Confidence Interval.\nFigure 2: Genotyping of TYK2 gene polymorphism rs2304256 by \nsequence analysis of the PCR amplified product using a forward \nprimer.\nFigure 3: Immunohistochemical analysis of TYK 2  expression in \nphase-matched (proliferative) endometrium from case (A) and \ncontrol (B).\nDiscussion\nEndometriosis is a polygenically inherited and multifactorial \ndisease. A variety of genetic association studies have focused \non the association between cytokine (TNF-α, IL-2, IL-4, IL-6, \nIL-10, or IL-16)  gene polymorphisms and endometriosis risk \n[24,25,36,37,38]. However, the studies on the down-stream \nsignaling molecules like JAKs and STATs are very few. It is evident \nfrom the literature that the Th2 immune response is associated \nwith endometriosis. [1]. Interleukin IL13, a typical Th2 cytokine \nis the key regulator of inflammatory and immune responses, \nthat is central to endometriosis and associated abnormalities \n[8]. Elevated mRNA and protein levels of IL-13 was reported in \nthe peritoneal fluid of endometriosis patients [35]. The same \nchanges are observed in the ectopic endometrium of affected \nwomen which could be responsible for the defective immuno-\nsurveillance leading to endometriotic tissue overgrowth [8]. \nTYK2 is required for mediating the biological function of IL-13 \nin processes associated with Th2 immune response [5,21]. IL-\n13/TYK2 signaling in B cell proliferation, Ig E and MHC class II \nexpression and Th1-cytokines inhibition are well demonstrated \nin endometriosis [29]. An aberration in TYK2 can lead to abnor-\nmal STAT6 signaling, gaining resistance to apoptosis and escap-\ning the immune surveillance [6,20]. Therefore, TYK2gene may \nhave the crucial importance in regulating immune and/or in-\nflammatory responses in endometriosis.\nIn the current study, SNP in TYK2 rs2304256 was examined \nto ascertain whether the polymorphism is associated with en -\ndometriosis susceptibility in women from South Indian. The \nnon-synonymous SNP rs2304256, a C to An alteration in exon 8 \nof TYK2, induces a change of valine to phenylalanine at position \n362 in the JAK-homology 4 region of TYK2 [30]. Li et al showed \nthat the allele ‘A’ disrupts a putative exonic splicing enhanc -\ner binding motif affecting the pre-mRNA processing of TYK2; \nthus, promoting the inclusion of exon 8 in the mRNA, which \nis essential for TYK2 binding to cytokine receptor [23]. At the \nrs2304256 locus, we observed that the allele ‘A’ and genotype \nAA occurred at significantly higher frequency in cases than in \ncontrols, indicating that the mutant allele 'A' could be a genetic \nrisk factor for endometriosis. Of note, Peluso et al found no \ncorrelation between the SNP rs2304256 and endometriosis risk \nin the Brazilian population [27], which is inconsistent with the \npresent finding. Possible reasons for this inconsistency could \nbe: first, ethnic variation seen in the polymorphism analyzed. In \npoint of fact, drastic difference was observed between the two \npopulations in the distribution of the 'A' allele. In the Brazilian \npopulation, the mutant allele 'A' was found in 26.4 percent of \ncases and 23.6 percent of controls, whereas in the South In -\ndian population, the frequencies were 35.3 percent and 27.6 \n\nSubmit your Manuscript | www.austinpublishinggroup.com Austin J Obstet Gynecol 10(2): id1216 (2023) - Page - 04\nAustin Publishing Group\nReferences\n1. Antsiferova YS, Sotnikova NY , Posiseeva LV, Shor AL. Changes in \nthe T-helper cytokine profile and in lymphocyte activation at the \nsystemic and local levels in women with endometriosis. Fertil \nSteril. 2005;  84: 1705-11.\n2. Bhanoori M, Babu KA, Deenadayal M, Kennedy S, Shivaji S. The \ninterleukin-6 -174G/C promoter polymorphism is not associated \nwith endometriosis in South Indian women. J Soc Gynecol Inves-\ntig. 2005; 12: 365-9. \n3. Bhanoori M, Deenadayal M, Kennedy S, Shivaji S. The G2964A \n3'-untranslated region polymorphism of the signal transducer \nand activator of transcription 6 gene is associated with endome-\ntriosis in South Indian women. Hum Reprod. 2007; 22: 1026-30. \n4. Bhanoori M, Kameshwari DB, Zondervan KT, Deenadayal M, Ken-\nnedy S, et al. The endothelial nitric oxide synthase Glu298Asp \npolymorphism is not a risk factor for endometriosis in south In -\ndian women. Eur J Obstet Gynecol Reprod Biol. 2008; 139: 53-8. \n5. Bhattacharjee A, Shukla M, Yakubenko VP , Mulya A, Kundu S, et \nal. IL-4 and IL-13 employ discrete signaling pathways for target \ngene expression in alternatively activated monocytes/macro -\nphages. Free Radic Biol Med. 2013; 54:1-16. \n6. Borcherding DC, He K, Amin NV, Hirbe AC. TYK2 in Cancer Metas-\ntases: Genomic and Proteomic Discovery. Cancers (Basel). 2021; \n13: 4171. \n7. Can G, Tezel A, Gürkan H, Can H, Yılmaz B, et al. Tyrosine ki -\nnase-2 gene polymorphisms are associated with ulcerative coli-\ntis and Crohn's disease in Turkish Population. Clin Res Hepatol \nGastroenterol. 2015; 39: 489-98.\n8. Chegini N, Roberts M, Ripps B. Differential expression of inter -\nleukins (IL)-13 and IL-15 in ectopic and eutopic endometrium \nof women with endometriosis and normal fertile women. Am J \nReprod Immunol. 2003; 49: 75-83. \n9. Cunninghame Graham DS, Akil M, Vyse TJ. Association of poly -\nmorphisms across the tyrosine kinase gene, TYK2 in UK SLE fami-\nlies. Rheumatology (Oxford). 2007; 46: 927-30. \n10. Foti PV, Farina R, Palmucci S, Vizzini IAA, Libertini N, et al. Endo-\nmetriosis: clinical features, MR imaging findings and pathologic \ncorrelation. Insights Imaging. 2018; 9: 149-172. \n11. Gallinelli A, Chiossi G, Giannella L, Marsella T, Genazzani AD, Vol-\npe A. Different concentrations of interleukins in the peritoneal \nfluid of women with endometriosis: relationships with lympho -\npercent in the current study. The second possible reason could \nbe due to the difference in the sample size used in the study. \nHowever, larger population studies may require validating the \nexact role of this mutation in endometriosis.\nThe expression of TYK2 in the eutopic endometrium of wom-\nen with and without endometriosis did not differ significantly \nin our study. Although there are conflicting results on TYK2 \nexpression in various cancers, the majority of research found \nhigher expression in tumor tissues when compared to controls \n[18,19]. Additionally, a strong correlation between TYK2 over-\nexpression and late-stage tumors was observed, indicating \nthat TYK2 over-expression contributes to the aggressiveness \nof tumors. However, we found no significant difference in TYK2 \nexpression between eutopic endometria of women with and \nwithout endometriosis in the current study. To validate the role \nof TYK2 expression in the pathophysiology of endometriosis, \nmore research with a bigger sample size is needed.\nThe minor allelic frequency for the SNP evaluated was com -\npared with the mutation frequency data from populations of \ndifferent ethnic origins, obtained from HapMap, 1000Genomes, \nGenome Aggregation Database (GnomAD) and EXAC database \n(dbSNP) (Supplementary Table 1). In the cases with the poly -\nmorphism under study, we observed that the minor allelic fre -\nquency was close to the values reported for Asian populations \nin the 1000 Genome Database. The frequency of 'A' allele is \nmore common in Asians, Europeans, and Americans than it is \nin Africans for the TYK2 gene polymorphism rs2304256. Since \nIndians are a part of Asian ethnic group, the allelic frequency for \nthe SNP rs2304256 found in the cases were very close with the \nAsians represented in 1000 Genomes, however, further confir -\nmation requires studies with large sample sizes. \nJAK-STAT signaling mediates immune regulatory processes \nthat are central in endometriosis development and progression. \nWe believe that the combined effect of various JAK-STAT media-\ntor polymorphisms may disrupt immune homeostasis leading \nto the establishment and maintenance of endometrial cells at \nectopic locations, as illustrated previously by our team consid -\nering IL6 and STAT6 [2,3]. The Discovery of how these genetic \npolymorphisms interact on endometriosis development may be \na crucial step in understanding the pathophysiology of endo -\nmetriosis.\nIn conclusion, our study shows that the TYK2 gene polymor-\nphism rs2304256 is significantly associated with endometriosis \nin South Indian women. Analysis of this polymorphism might \nhelp to identify patients at high risk for endometriosis devel -\nopment. Although further work is necessary to understand the \nmolecular mechanism, our findings may lead to new insights \ninto the disease pathogenesis.\nAuthor Statements\nAcknowledgements\nThis work was supported in part by grants from the SERB \n(DST), India (Lr. No: SR/FT/LS-188/2009) and OU-DST PURSE \nProgramme-II (DST Sanction No. SR/PURSE Phase 2/32(G)), De-\npartment of Science and Technology (DST), India to Prof. Man -\njula Bhanoori.\nConflict of Interests\nThe authors declare that there is no conflict of interests. \nEthical Approval\nThe study was approved by the ethical committee and re -\nview board of Centre of Cellular and Molecular biology (CCMB), \nHyderabad. In the study all the participants were of South In -\ndian origin (Dravidian linguistic group).\nInformed Consent\nInformed written consent form was obtained from all sub -\njects prior to participation in this study.\nAuthor’s Contribution\nKVV: execution of experiments, analysis and interpretation \nof data, statistical analysis and drafting of manuscript. MLM: \nData collection. MD: acquisition of data. SS: analysis and inter -\npretation of data, drafting of manuscript. MB: conception and \ndesign of study, analysis and interpretation of data, statistical \nanalysis, drafting of manuscript. All authors will have seen and \nagreed to the ‘Author Contribution’ statement.\n\nSubmit your Manuscript | www.austinpublishinggroup.com Austin J Obstet Gynecol 10(2): id1216 (2023) - Page - 05\nAustin Publishing Group\ncyte subsets. Gynecol Endocrinol. 2004; 18: 144-51.\n12. Gonciarz M, Pawlak-Buś K, Leszczyński P , Owczarek W. TYK2 as a \ntherapeutic target in the treatment of autoimmune and inflam-\nmatory diseases. Immunotherapy. 2021; 13: 1135-1150. \n13. Govatati S, Challa K, Reddy SB, Pramod K, Deenadayal M, et al. \nBRCA1 alterations are associated with endometriosis, but BRCA2 \nalterations show no detectable endometriosis risk: a study in In-\ndian population. J Assist Reprod Genet. 2015; 32: 277-85. \n14. Govatati S, Deenadayal M, Shivaji S, Bhanoori M. Mitochondrial \nNADH:ubiquinone oxidoreductase alterations are associated \nwith endometriosis. Mitochondrion. 2013; 13: 782-90. \n15. Govatati S, Kodati VL, Deenadayal M, Chakravarty B, Shivaji S, et \nal. Mutations in the PTEN tumor gene and risk of endometriosis: \na case-control study. Hum Reprod. 2014; 29: 324-36. \n16. Govatati S, Tangudu NK, Deenadayal M, Chakravarty B, Shivaji S, \net al. Association of E-cadherin single nucleotide polymorphisms \nwith the increased risk of endometriosis in Indian women. Mol \nHum Reprod. 2012; 18: 280-7.\n17. Hill CJ, Fakhreldin M, Maclean A, Dobson L, Nancarrow L, et al. \nEndometriosis and the Fallopian Tubes: Theories of Origin and \nClinical Implications. J Clin Med. 2020; 9: 1905. \n18. Ide H, Nakagawa T, Terado Y , Kamiyama Y , Muto S, Horie S. Tyk2 \nexpression and its signaling enhances the invasiveness of pros -\ntate cancer cells. BiochemBiophys Res Commun. 2008; 369: \n292-6. \n19. Jia X, Huang C, Hu Y , Wu Q, Liu F, et al. Cirsiliol targets tyrosine \nkinase 2 to inhibit esophageal squamous cell carcinoma growth \nin vitro and in vivo. J Exp Clin Cancer Res. 2021; 40: 105. \n20. Karjalainen A, Shoebridge S, Krunic M, Simonović N, Tebb G, et \nal. TYK2 in Tumor Immunosurveillance. Cancers (Basel). 2020; \n12: 150.\n21. Kelly-Welch AE, Hanson EM, Boothby MR, Keegan AD. Interleu-\nkin-4 and interleukin-13 signaling connections maps. Science. \n2003; 300: 1527-8. \n22. Lee YH, Bae SC. Association between TYK2 polymorphisms and \nsusceptibility to autoimmune rheumatic diseases: a meta-analy-\nsis. Lupus. 2016; 25: 1307-14. \n23. Li Z, Rotival M, Patin E, Michel F, Pellegrini S. Two common dis -\nease-associated TYK2 variants impact exon splicing and TYK2 \ndosage. PLoS One. 2020; 15: e0225289. \n24. Malutan AM, Drugan C, Drugan T, Ciortea R, Mihu D. The as -\nsociation between interleukin-4 -590C/T genetic polymorphism, \nIL-4 serum level, and advanced endometriosis. Cent Eur J Im -\nmunol. 2016; 41: 176-81.\n25. Matalliotakis M, Zervou MI, Eliopoulos E, Matalliotaki C, Rah -\nmioglu N, et al. The role of IL 16 gene polymorphisms in endo -\nmetriosis. Int J Mol Med. 2018; 41: 1469-1476. \n26. Pellenz FM, Dieter C, Duarte GCK, Canani LH, de Souza BM, et al. \nThe rs2304256 Polymorphism in TYK2 Gene Is Associated with \nProtection for Type 1 Diabetes Mellitus. Diabetes Metab J. 2021; \n45: 899-908.\n27. Peluso C, Christofolini DM, Goldman CS, Mafra FA, Cavalcanti V, \net al. TYK2 rs34536443 polymorphism is associated with a de -\ncreased susceptibility to endometriosis-related infertility. Hum \nImmunol. 2013; 74: 93-7.\n28. Podgaec S, Abrao MS, Dias JA Jr, Rizzo LV, de Oliveira RM, et al. \nEndometriosis: an inflammatory disease with a Th2 immune re-\nsponse component. Hum Reprod. 2007; 22: 1373-9. \n29. Roberts M, Luo X, Chegini N. Differential regulation of interleu -\nkins IL-13 and IL-15 by ovarian steroids, TNF-alpha and TGF-beta \nin human endometrial epithelial and stromal cells. Mol Hum Re-\nprod. 2005; 11: 751-60. \n30. Tao JH, Zou YF, Feng XL, Li J, Wang F, et al. Meta-analysis of TYK2 \ngene polymorphisms association with susceptibility to autoim -\nmune and inflammatory diseases. Mol Biol Rep. 2011; 38: 4663-\n72.\n31. Tempfer CB, Simoni M, Destenaves B, Fauser BC. Functional ge-\nnetic polymorphisms and female reproductive disorders: part II-\n-endometriosis. Hum Reprod Update. 2009; 15: 97-118. \n32. Veena KV, Siddamalla S, Deenadayal M, Shivaji S, BhanooriM . \nDNMT1 and DNMT3B gene variants and their association with \nendometriosis in South Indian women. Mol Biol Rep. 2022a; 49: \n321-329.\n33. Veena KV, Siddamalla S, Deenadayal M, Sisinthy S, Bhanoori M. \nHistone deacetylase 1, Sirtuin 1, and Sirtuin 3 single-nucleotide \npolymorphisms and the risk of endometriosis in South Indian \nwomen. J Obstet Gynaecol. 2022b; 42: 3230-3235. \n34. Verma R, Balakrishnan L, Sharma K, Khan AA, Advani J, et al. A \nnetwork map of Interleukin-10 signaling pathway. J Cell Com -\nmun Signal. 2016; 10: 61-7.\n35. Wang XM, Ma ZY , Song N. Inflammatory cytokines IL-6, IL-10, \nIL-13, TNF-α and peritoneal fluid flora were associated with in -\nfertility in patients with endometriosis. Eur Rev Med Pharmacol \nSci. 2018; 22: 2513-2518. \n36. Wang XQ, Hu M, Chen JM, Sun W, Zhu MB. Effects of gene poly-\nmorphism and serum levels of IL-2 and IL-6 on endometriosis. \nEur Rev Med Pharmacol Sci. 2020; 24: 4635-4641. \n37. Yasri S, Wiwanitkit V. Tumor necrosis factor-α gene-1031T/C \npromoter polymorphism and endometriosis. Horm Mol Biol Clin \nInvestig. 2020; 41.\n38. Zhang X, Hei P , Deng L, Lin J. Interleukin-10 gene promoter poly-\nmorphisms and their protein production in peritoneal fluid in \npatients with endometriosis. Mol Hum Reprod. 2007; 13: 135-\n40.\n39. Zhou WJ, Yang HL, Shao J, Mei J, Chang KK, et al. Anti-inflam -\nmatory cytokines in endometriosis. Cell Mol Life Sci. 2019; 76: \n2111-2132.","source_license":"CC0","license_restricted":false}