Leukaemia Inhibitory Factor (LIF) Gene Mutations in Women Diagnosed with Unexplained Infertility and Endometriosis Have a Negative Impact on the IVF Outcome A Pilot Study

Female conditions of impaired fertility represent a heterogeneous group of disorders. The diagnoses are at- tributed to various anatomic, hormonal and immuno- logical disturbances and the genetic background of im- paired fertility is largely unknown. The leukaemia inhibitory factor (LIF) (OMIM* 159540) is a pluripotent cytokine that plays a role in the control of embryo implantation. So far, the mechanisms of LIF action have not been fully understood. In the en- Received: September 30, 2008. Accepted March 16, 2009. This study was supported by the Internal Grant Agency of the Ministry of Health IGA MZd NR/ 9135-3 (M. Králíčková), by the Institutional Research Concept A V 0Z 50200510 (P. Šíma) and MSM 0021620812 (Z. Ulčová-Gallová). Corresponding author: Milena Králíčková, Charles University in Prague, Faculty of Medicine in Pilsen and University Hospital, Department of Obstetrics and Gynecology, Alej Svobody 80, 301 66 Pilsen, Czech Republic. Phone: (+ 420) 604 724 171 (mo- bile phone), (+ 420) 377 105 229 (office); Fax.: (+420) 377 105 290; e-mail: [email protected] Abbrevations: IVF – in vitro fertilization, LIF – leukaemia in- hibitory factor, LIFR – LIF receptor, NK cells – natural killer cells, PCOS – polycystic ovary syndrome, PR – pregnancy rate, TGGE – temperature gradient gel electrophoresis. V ol. 55 93 dometrium of healthy women, LIF and LIF mRNA are expressed throughout the menstrual cycle with a strik- ing increase in the midsecretory phase, coinciding with a supposed window of implantation. LIF acts on cells by binding to the LIF receptor (LIFR) and gp130, which belongs to the IL-6 receptor family. Human blastocysts express mRNAs for LIFR and gp130, participating ac- tively in establishing contact with the endometrium. In the endometrium, LIFR and gp130 are expressed in the epithelium throughout the cycle, with a strong increase in the midsecretory phase (for review see Aghajanova, 2004; Králíčková et al., 2005). A decrease in production of LIF in the uterine micro- environment was generally found in women in states of impaired fertility. No correlation between LIF in serum and uterine flushing was demonstrated, rendering LIF measurements in serum useless for the diagnosis of im- paired infertility. On the other hand, LIF measurement in uterine flushing seems to be a useful but laborious diagnostic tool in the prediction of unsuccessful implan- tation (Mikołajczyk et al., 2003). The frequency of functionally relevant mutations of the LIF gene in infertile women is significantly enhanced in comparison with fertile controls (Giess et al., 1999; Steck et al., 2004; Králíčková et al., 2006), but these alterations have not yet been characterized. The reason is that in the first two reports (Giess et al., 1999; Steck et al., 2004) there were only one or two women with the same potentially functional mutation identified. The only larger population with identical mutation, the G to A transition at position 3400 of the LIF gene, was stud- ied in 2007 with the aim to characterize the clinical im- pact of this mutation. The study suggested that women with this LIF gene mutation have elevated levels of an- tiphospholipid antibodies in the serum (Králíčková et al., 2007). The authors hypothesized that this is due to the LIF impact on NK cell population, which is func- tionally connected to the presence of antiphospholipid antibodies in the serum (Roussev et al., 1996; Kaider et al., 1999; Sher et al., 2000). Our current population of 15 infertile women with identical mutation is the largest presented in the literature so far. The involvement of changes in humoral as well as cell-mediated immunity in endometriosis and idiopathic infertility has been put forward by numerous investiga- tors (Giudice et al., 2002; Mahutte and Arici, 2002; Ant- siferova et al., 2005). However, the exact role of immu- nity disturbances in the pathophysiology of these diseases still remains controversial. Endometriosis is a chronic inflammatory disease of multifactorial aetiology characterized by the implanta- tion and growth of endometrial glands and stroma out- side the uterine cavity. Reports on the role of LIF in the infertility of endometriosis patients are rather conflict- ing. Peritoneal fluid from women with endometriosis has a detrimental effect on embryo implantation, per- haps by adversely affecting LIF expression as well as uterine receptivity (Illera et al., 2000). LIF staining in- tensity in the glandular epithelium is significantly re- duced in endometriosis patients compared to controls (Dimitriadis et al., 2006). On the other hand, in a recent study in which the uterine flushings and endometrial samples were collected 7–9 days after ovulation (at the time of a supposed implantation window) from both in- fertile patients with endometriosis and fertile, endome- triosis-free controls, LIF was assessed and no statisti- cally significant differences were found. The authors concluded that there is no receptivity defect with regard to LIF secretion by eutopic endometrium in infertile women with endometriosis (Mikołajczyk et al., 2006). The NK and T cells are deregulated in endometriosis patients, too – inhibition of natural killer (NK) and cyto- toxic T-cell function has been proposed as a mechanism of the pathogenesis of endometriosis (Maeda et al., 2002; Antsiferova et al., 2005; Matsuoka et al., 2005; Zhang et al., 2006). According to current knowledge, immune cell inhibition in endometriosis is mediated by factors other than HLA-G (the only MHC antigen ex- pressed on cytotrophoblast cells of placenta) and cy- tokines in general have been suggested. Idiopathic (unexplained) infertility patients suffer from various immunologic disturbances. They represent a heterogeneous group with many different findings – elevated NK-cell activity (Matsubayashi et al., 2001), antiphospholipid antibodies in the serum (Nouza et al., 1992; Ulčová-Gallová et al., 1998), and embryotoxic cytokines to name just a few. For example, sera and cer- vical mucus of idiopathic infertile women demonstrate significantly higher levels of interferon γ and tumour necrosis factor α compared to fertile controls (Naz et al., 1995). The alterations in NK cell numbers and function are exclusive for endometriosis and idiopathic infertility, and the involvement of changes in immunity in other frequent infertility diagnoses (PCOS, tubal factor) only appears in a few studies and is never suggested as a key factor in the pathogenesis of the disease. The objective of this retrospective cohort study was to evaluate the impact of the above-mentioned LIF gene mutations on the outcome of treatment in women with various causes of infertility.

Patients Fifteen women (ages ranging from 24 to 40 years with median age 32 years) with potentially functional LIF gene mutation, the G to A transition at position 3400 leading to valine to methionine exchange at codon 64 (V64M), in the AB loop region of the LIF protein (study group) and 136 infertile women without any LIF gene mutation (con- trol group) were included in this retrospective cohort study. The group of mutation-positive women was divid- ed into two parts: group A was made up of women with diagnoses that are frequently accompanied by various changes in humoral as well as cell-mediated immunity – idiopathic infertility (N = 4) and endometriosis (N = 3). LIF Gene Mutations and Their Impact on the IVF Outcome 94 V ol. 55 Group B comprised patients with PCOS (N = 3), andro- logical factor (N = 3), tubal factor (N = 1) and hyperpro- lactinaemia (N = 1). The control group consisted of 136 infertile women with no LIF gene mutation (ages ranging from 22 to 41 years with median age 31 years). It was made up of 10 patients diagnosed with endometriosis, 27 patients diagnosed with idiopathic infertility (group C), 41 patients diagnosed with male factor, 28 with tubal fac- tor and 30 with PCOS (group D). The endometriosis patients covered all stages of the disease. Patients classified as idiopathically infertile were documented as having patent tubes using laparo- scopy, were free of pelvic adhesions and endometriosis, and were shown to have a normal uterine cavity using hysteroscopy or hysterosalpingography. They had nor- mal ovulation and there was no evidence of male factor, antisperm or zona pellucida antibodies. With regard to both follicular response and days of gonadotropin stimulation, the groups were similar. This study was approved by the Charles University Ethics Committee and informed consent was obtained from all individuals. DNA extraction, polymerase chain reaction (PCR) and mutation status of the LIF gene Peripheral blood leukocytes were used for DNA isola- tion in all cases. DNA was isolated using the DNeasy Tis- sue Kit (QIAgen, Hilden, Germany) according to the manufacturer’s protocol. The coding regions and the exon-intronic junctions were analysed using temperature gradient gel electrophoresis (TGGE). Exon 3 was divided into three parts and the LIF gene was screened and di- vided into five partly overlapping fragments. PCR was performed using five sets of primers (Table 1). Primers were modified using the Poland java script (www.bio- phys.uni-duesseldorf.de/POLAND/poland.html) with the help of GC-clamp addition to create a thermostable do- main suitable for TGGE. The reaction conditions were as follows: 12.5 µl of HotStart Taq PCR Master Mix (QIA- gen), 10 pmol of each primer, 100 ng of DNA and dis- tilled water up to 25 µl. The amplification programme consisted of denaturation at 95 °C for 15 min and then 35 cycles of denaturation at 95 °C for 30 s, annealing at 60 °C for 30 s and extension at 72 °C for 1 min. PCR was completed by a final extension at 72 °C for 7 min. The amplification programme was the same for all analysed exons except exon 1, where the annealing temperature was 50 °C. The length and quality of the PCR products were checked in standard agarose gels. Screening of mutations was performed using heter- oduplex analysis on TGGE (Biometra, Goettingen, Ger- many) on 8% denaturing acrylamide gel (AA : bis-AA [37.5 : 1], 6 mol/l urea, 1x MOPS, 2% glycerol). The TGGE analysis was performed in two steps – firstly, for each exon, electrophoresis conditions for parallel gels had to be optimized using perpendicular gels. Then the parallel gels for patients’ samples were run. The running time was always 1 h 30 min at a temperature gradient shown in Table 1. DNA bands were detected using the silver staining method already used by us previously, again according to a standard protocol (Králíčková et al., 2006). The relevant DNA samples of all the women found to be positive in TGGE analysis were amplified and se- quenced using automated sequencing with the aid of a Big Dye Terminator Sequencing Kit (PE/Applied Bio- systems, Foster City, CA). The samples were run in an automated sequencer ABI Prism 310 Avant (PE/Applied Biosystems) at a constant voltage of 11.3 kV for 20 min. All PCR and sequencing experiments were repeated at least twice in TGGE-positive patients. Statistical methods The results were statistically assessed using the Fish- er’s 2 by 2 exact test; P < 0.05 was considered statisti- cally significant. Z. Novotný et al. Table 1. Table of primers and temperature gradients for parallel TGGE gels. GC clamps in italics Exon Names Sequence 5 ‚→ 3‘ Temperature of the primers gradients E1 E1F-GC CGCCCGCCGCGCCCCGCGCCCGGCCCGCCGCCCCCGCCCG 55 °C–63°C CTATGATGCACCTCAAACAA* E1R GGGGCGGGTGTATTTA* E2 E2F GCCACCCTTTCCTGCCTTTCTAC** 53 °C–65°C E2R-GC CGGGCGGGGGCGGCGGGCCGGGCGCGGGGCGCGGCGGGCG TCCCTGCCATCTCCTGTCAGTATC** E3.1 E3.1F-GC CGCCCGCCGCGCCCCGCGCCCGGCCCGCCGCCCCCGCCCG 58°C–66°C ACAATTCCAGATGCTTACAGGG ** E3.1R-GC GCGGG GCCAAGGTACACGACTATGC** E3.2 E3.2F CCCAACAACCTGGACAAGCTATG** 60 °C–65°C E3.2R-GC CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCC CCGTAGGTCACGTCCACATG** E3.3 E3.3F-GC CCCGC CCTCCTTAGCAACGTGCTGT* 58 °C–62°C E3.3R-GC CGGGCGGGGGCGGCGGGCCGGGCGCGGGGCGCGGCGGGCG ACATCTGGACCCAACTCCTG* * our original primers; ** primers inspired by Giess et al. (1999) V ol. 55 95

In all studied groups (N = 151) there were fifteen positive samples identified by TGGE. All of them were in exon 3.2. By subsequent sequencing all these samples showed an alteration in the DNA sequence that was identical to the previously described potentially func- tional LIF gene point mutation, the G to A transition at position 3400. Seven of the mutation-positive patients were success- fully treated by the first cycle of IVF (Table 2), which means that the pregnancy rate was 47 %. If we then compare mutation-positive women (group A+B) to women with no LIF gene mutation (group C+D) regard- less of their groupings according to their infertility diag- noses, there is no statistically significant difference in pregnancy rates. Of the successfully treated group of seven mutation- positive women, not one had been diagnosed with idio- pathic infertility and there was only one with endome- triosis, which means that there was a statistically significant difference in the pregnancy rates between groups A and B (P = 0.01, Fisher’s 2 by 2 exact test). Comparing the two groups of women with endome- triosis and idiopathic infertility, it was found that the mutation-positive group had a lower pregnancy rate (14 %) than the control group C (pregnancy rate 49 %), but due to the low number of patients in the groups it was not statistically significant (P = 0.11, Fisher’s 2 by 2 exact test). The pregnancy rates of the groups with dif- ferent diagnoses in the control population of our cohort were not significantly different statistically (Table 3).

The frequency of the LIF gene mutations in the popu- lation of infertile women is significantly elevated in comparison with fertile controls. Nevertheless, the LIF gene mutations may be compensated and the treatment can succeed. The compensatory mechanisms for LIF de- fects have not been elucidated yet. The role of the sec- ond LIF gene allele and the hormonal stimulation were hypothesized (Steck et al., 2004), as well as the role of other regulatory molecules, most of them of cytokine nature (Králíčková et al., 2006). Our results suggest that success of the infertility treat- ment in LIF gene mutation-positive women is influenced by the cause of infertility. Idiopathic infertility and en- dometriosis have a negative impact on the outcome of IVF. We suppose that this is due to the difference in NK cell counts and function in these two groups and the in- teraction of NK cells with variants of the LIF molecule. We are aware of the fact that the statistical signifi- cance is not strong and that the compared groups are themselves heterogeneous, which makes our results even more disputable. Nevertheless, the group of 15 mutation-positive women is the largest published so far and the results can contribute to characterization of the influence of LIF and its gene mutations on infertility and its treatment. LIF Gene Mutations and Their Impact on the IVF Outcome Table 2. Overview of all mutation-positive infertile women Groups Age Diagnosis Type of infertility Outcome of the IVF treatment 30 Unexplained infert. Primary No pregnancy 39 Unexplained infert. Primary No pregnancy 40 Unexplained infert. Secondary No pregnancy Group A 34 Unexplained infert. Primary No pregnancy 39 Endometriosis Primary No pregnancy 33 Endometriosis Primary No pregnancy 33 Endometriosis Secondary Pregnancy 27 PCOS Primary No pregnancy 28 PCOS Primary Pregnancy 28 PCOS Secondary Pregnancy Group B 31 Androlog. factor Primary Pregnancy 31 Androlog. factor Primary Pregnancy 24 Androlog. factor Primary Pregnancy 31 Tubal factor Primary No pregnancy 33 Hyperprolactinaemia Secondary Pregnancy Table 3. Overview of control population (LIF gene-negative infertile women) Groups Diagnoses Number Pregnant PR of the individual PR of the of patients after IVF diagnoses group Group C Unexplained infert. 27 14 51 % 49 % mean age 31 ± 4 years Endometriosis 10 4 40 % Group D PCOS 30 15 50 % mean age 30 ± 6 years Androlog. factor 41 23 56 % 52 % Tubal factor 28 14 50 % 136 70 51 % 96 V ol. 55 The high pregnancy rate in group B can be influenced by lower average age of patients as well as by the indi- cations to IVF/ICSI. Some authors (Arici et al., 1996; Omland et al., 2005) report that andrological factor, PCOS or hyperprolactinaemia are usually associated with relatively higher pregnancy rates after therapy than other indications. The question of whether post-treatment pregnancy rates are influenced by the cause of infertility remains controversial. Some authors report a lower pregnancy rate in endometriosis patients (Arici et al., 1996; Om- land et al., 2005; Ahinko-Hakamaa et al., 2007); some others report no differences between the various diag- noses (Burke et al., 2000; Calhaz-Jorge et al., 2004). Human endometrium possesses a unique immuno- logical environment enabling implantation of the semi- allogeneic or allogeneic embryo. Large populations of macrophages and uterine-specific NK cells infiltrate the implantation site, believed to be important modulators of trophoblast invasion and decidualization (Johnson et al., 1999; Croy et al., 2003). However, our knowledge regarding selective recruitment of leukocyte subtypes is not complete. LIF is produced by endometrial NK cells that interact with the invading trophoblast and although its effects on trophoblast are not yet clear, LIF appears to mediate in- teractions between maternal decidual leukocytes and the invading trophoblast. One of the actions of LIF on the endometrium is the regulation of the uterine leukocyte population. The LIF knockout mice have double the percentage of NK cells compared to wild-type mice at the time of the implantation window, indicating that LIF restricts the migration of NK cells to the uterus (Schofield and Kimber, 2005). We are aware of the fact that this is just a pilot study and a larger number of LIF gene mutation-positive in- fertile patients is needed for further investigations. A complete understanding of the complex regulatory mechanism may provide new therapeutic targets in fe- male reproductive tract physiology.

The authors wish to thank Dr. František Šefrna for his supervision of statistical analysis.

Aghajanova, L. (2004) Leukemia inhibitory factor and human embryo implantation. Ann. N. Y. Acad. Sci. 1034, 176-183. Ahinko-Hakamaa, K., Huhtala, H., Tinkanen, H. (2007) Success in intrauterine insemination: the role of etiology. Acta Obstet. Gynecol. Scand. 86, 855-860. Antsiferova, Y . S., Sotnikova, N. Y ., Posiseeva, L. V ., Shor, A. L. (2005) Changes in the T-helper cytokine profile and in lymphocyte activation at the systemic and local levels in women with endometriosis. Fertil. Steril. 84, 1705-1711. Arici, A., Oral, E., Bukulmez, O., Duleba, A., Olive, D. L., Jones, E. E. (1996) The effect of endometriosis on implantation: results from the Yale University in vitro fertilization and embryo transfer program. Fertil. Steril. 65, 603-607. Burke, L. M., Davenport, A. T., Russell, G. B., Deaton, J. L. (2000) Predictors of success after embryo transfer: experience from a single provider. Am. J. Obstet. Gynecol. 182, 1001-1004. Calhaz-Jorge, C., Chaveiro, E., Nunes, J., Costa, A. P. (2004) Implications of the diagnosis of endometriosis on the success of infertility treatment. Clin. Exp. Obstet. Gynecol. 31, 25-30. Croy, B. A., Esadeg, S., Chantakru, S., van den Heuvel, M., Paffaro, V . A., He, H., Black, G. P., Ashkar, A. A., Kiso, Y ., Zhang, J. (2003) Update on pathways regulating the activation of uterine natural killer cells, their interactions with decidual spiral arteries and homing of their precursors to the uterus. J. Reprod. Immunol. 59, 175-191. Dimitriadis, E., Stoikos, C., Stafford-Bell, M., Clark, I., Paiva, P., Kovacs, G., Salamonsen LA. (2006) Interleukin- 11, IL-11 receptor α and leukemia inhibitory factor are dysregulated in endometrium of infertile women with endometriosis during the implantation window. J. Reprod. Immunol. 69, 53-64. Giess, R., Tanasescu, I., Steck, T., Sendtner, M. (1999) Leukaemia inhibitory factor gene mutations in infertile women. Mol. Hum. Reprod. 5, 581-586. Giudice, L. C., Telles, T. L., Lobo, S., Kao, L. (2002) The molecular basis for implantation failure in endometriosis: on the road to discovery. Ann. N. Y. Acad. Sci. 955, 252-264. Illera, M. J., Juan, L., Stewart, C. L., Cullinan, E., Ruman, J., Lessey, B. A. (2000) Effect of peritoneal fluid from women with endometriosis on implantation in the mouse model. Fertil. Steril. 74, 41-48. Johnson, P. M., Christmas, S. E., Vince, G. S. (1999) Immunological aspects of implantation and implantation failure. Hum. Reprod. 14, 26-36 (Suppl 2). Kaider, A. S., Kaider, B. D., Janowicz, P. B., Roussev, R. G. (1999) Immunodiagnostic evaluation in women with reproductive failure. Am. J. Reprod. Immunol. 42, 335- 346. Králíčková, M., Šíma, P., Rokyta, Z. (2005) Role of the leukemia-inhibitory factor (LIF) gene mutations in infertile women: The embryo-endometrial cytokine cross talk during implantation – a delicate homeostatic equilibrium. Folia Microbiol. 50, 179-186. Králíčková, M., Šíma, R., Vaněček,T., Šíma, P., Rokyta Z, Ulčová-Gallová, Z., Suchá, R., Uher, P., Hes, O. (2006) Leukemia inhibitory factor gene mutations in the population of infertile women are not restricted to nulligravid patients. Eur. J. Obstet. Gynecol. Reprod. Biol. 127, 231-235. Králíčková, M., Ulčová-Gallová, Z., Šíma, R., Vaněček, T., Šíma, P., Křižan, J., Suchá, R., Uher, P., Hes, O., Novotný, Z., Rokyta, Z., Větvička, V . (2007) Association of the leukemia inhibitory factor gene mutation and the antiphospholipid antibodies in the peripheral blood of infertile women. Folia Microbiol. 52, 543-548. Maeda, N., Izumiya, C., Oguri, H., Kusume, T., Yamamoto, Y ., Fukaya, T. (2002) Aberrant expression of intercellular adhesion molecule-1 and killer inhibitory receptors induces immune tolerance in women with pelvic endometriosis. Fertil. Steril. 77, 679-683. Z. Novotný et al. V ol. 55 97 Mahutte, N. G., Arici, A. (2002) New advances in the understanding of endometriosis related infertility. J. Reprod. Immunol. 55, 73-83. Matsubayashi, H., Hosaka, T., Sugiyama, Y ., Suzuki, T., Arai, T., Kondo, A., Sugi, T., Izumi, S., Makino, T. (2001) Increased natural killer-cell activity is associated with infertile women. Am. J. Reprod. Immunol. 46, 318-322. Matsuoka, S., Maeda, N., Izumiya, C., Yamashita, C., Nishimori, Y ., Fukaya, T. (2005) Expression of inhibitory- motif killer immunoglobulin-like receptor, KIR2DL1, is increased in natural killer cells from women with pelvic endometriosis. Am. J. Reprod. Immunol. 53, 249-254. Mikołajczyk, M., Skrzypczak, J., Szymanowski, K., Wirstlein, P. (2003) The assessment of LIF in uterine flushing – a possible new diagnostic tool in states of impaired fertility. Reprod. Biol. 3, 259-270. Mikołajczyk, M., Wirstlein, P., Skrzypczak, J. (2006) Leukaemia inhibitory factor and interleukin 11 levels in uterine flushings of infertile patients with endometriosis. Hum. Reprod. 21, 3054-3058. Naz, R. K., Butler, A., Witt, B. R., Barad, D., Menge, A. C. (1995) Levels of interferon-γ and tumor necrosis factor- α in sera and cervical mucus of fertile and infertile women: implication in infertility. J. Reprod. Immunol. 29, 105-117. Nouza, K., Kinský, R., Dimitrov, D. (1992) Immunology and immunopathology of reproduction. Folia Biol. (Praha) 38, 170-194. Omland, A. K., Abyholm, T., Fedorcsák, P., Ertzeid, G., Oldereid, N. B., Bjercke, S., Tanbo, T. (2005) Pregnancy outcome after IVF and ICSI in unexplained, endometriosis- associated and tubal factor infertility. Hum. Reprod. 20, 722-727. Roussev, R. G., Kaider, B. D., Price, D. E., Coulam, C. B. (1996) Laboratory evaluation of women experiencing reproductive failure. Am. J. Reprod. Immunol. 35, 415- 420. Schofield, G., Kimber, S. J. (2005) Leukocyte subpopulations in the uteri of leukemia inhibitory factor knockout mice during early pregnancy. Biol. Reprod. 72, 872-878. Sher, G., Fisch, J. D., Maassarani, G., Matzner, W., Ching, W., Chong, P. (2000) Antibodies to phosphatidylethanolamine and phosphatidylserine are associated with increased natural killer cell activity in non-male factor infertility patients. Hum. Reprod. 15, 1932-1936. Steck, T., Giess, R., Suetterlin, M. W., Bolland, M., Wiest, S., Poehls, U. G., Dietl, J. (2004) Leukaemia inhibitory factor (LIF) gene mutations in women with unexplained infertility and recurrent failure of implantation after IVF and embryo transfer. Eur. J. Obstet. Gynecol. Reprod. Biol. 15, 69-73. Ulčová-Gallová, Z., Krauz, V ., Bouše, V ., Novotný, Z., Rokyta, Z., Fialová, P., V ondráček, J. (1998) Correlation between peritoneal fluid and serum antiphospholipid antibodies in women with primary infertility. Int. J. Fertil. Womens Med. 43, 267-272. Zhang, C., Maeda, N., Izumiya, C., Yamamoto, Y ., Kusume, T., Oguri, H., Yamashita, C., Nishimori, Y ., Hayashi, K., Luo, J., Fukaya, T. (2006) Killer immunoglobulin-like receptor and human leukocyte antigen expression as immunodiagnostic parameters for pelvic endometriosis. Am. J. Reprod. Immunol. 55, 106-114. LIF Gene Mutations and Their Impact on the IVF Outcome