{"paper_id":"1825b7dd-ca7e-4675-aadc-46558ac50e64","body_text":"Folia Biologica (Praha) 55, 92-97 (2009)\nOriginal Article\nLeukaemia Inhibitory Factor (LIF) Gene Mutations in Women \nDiagnosed with Unexplained Infertility and Endometriosis \nHave a Negative Impact on the IVF Outcome \nA Pilot Study\n(leukaemia inhibitory factor (LIF) / mutation / infertility / in vitro fertilization)\nZ. NOVOTNÝ1, J. KŘÍŽAN 2, R. ŠÍMA3, P. ŠÍMA2, P. UHER1,4, N. ZECH5, \nR. HŰTTELOVÁ 4, P. BABOROVÁ4, Z. ULČOVÁ-GALLOVÁ 1, I. ŠUBRT6, \nE. ULMANOVÁ4, Z. HOUDEK4, Z. ROKYTA1, V . BABUŠKA7, M. KRÁLÍČKOVÁ 1,4 \nCharles University in Prague, Faculty of Medicine in Pilsen and University Hospital: 1Department of Obstet-\nrics and Gynecology, 3Department of Pathology, 6Department of Genetics, 7Department of Biochemistry, \nPilsen, Czech Republic\n2Department of Immunology and Gnotobiology, Institute of Microbiology v. v. i., Academy of Sciences \nof the Czech Republic, Prague, Czech Republic\n4Institute of Reproductive Medicine and Endocrinology, Pilsen, Czech Republic\n5Reproductive Genetics Institute, Chicago, Illinois, USA, and Department of Obstetrics and Gynecology, \nUniversity Hospital Zurich, Zurich, Switzerland\nAbstract. The frequency of functionally relevant mu-\ntations of the leukaemia inhibitory factor (LIF) gene \nin infertile women is significantly enhanced in com-\nparison with fertile controls. The objective of this \nretrospective cohort study was to evaluate the impact \nof LIF gene mutations on the outcome of the treat-\nment in women with various causes of infertility. Fif-\nteen infertile women with the G to A transition at \nposition 3400 leading to the valine to methionine ex-\nchange at codon 64 were analysed. Group A was \nmade up of women with diagnoses that are frequent-\nly accompanied by changes in humoral as well as \ncell-mediated immunity – idiopathic infertility and \nendometriosis (N = 7). Group B consisted of patients \nwith polycystic ovary syndrome (PCOS), andrologi-\ncal factor, tubal factor and hyperprolactinaemia (N = \n8). The control group comprised 136 infertile women \nwith no LIF gene mutation diagnosed with idiopathic \ninfertility and endometriosis (N = 37) (group C) and \npatients with PCOS, tubal and andrological factor \n(N = 99) (group D). Seven of the mutation-positive \npatients were successfully treated by in vitro fertili-\nzation (IVF), but nobody in this group was diagnosed \nwith idiopathic infertility and only one with endome-\ntriosis, which means that there is a statistically sig-\nnificant difference in the pregnancy rates between \ngroups A and B (P = 0.01, Fisher’s 2 by 2 exact test) \nbut no statistically significant difference when com-\nparing patients with the LIF gene mutation (group \nA+B) to no LIF gene mutation (group C+D). The re-\nsults suggest that in mutation-positive women the \nidiopathic infertility and endometriosis have a nega-\ntive impact on the outcome of IVF treatment. \nIntroduction\nFemale conditions of impaired fertility represent a \nheterogeneous group of disorders. The diagnoses are at-\ntributed to various anatomic, hormonal and immuno-\nlogical disturbances and the genetic background of im-\npaired fertility is largely unknown.\nThe leukaemia inhibitory factor (LIF) (OMIM* \n159540) is a pluripotent cytokine that plays a role in the \ncontrol of embryo implantation. So far, the mechanisms \nof LIF action have not been fully understood. In the en-\nReceived: September 30, 2008. Accepted March 16, 2009.\nThis study was supported by the Internal Grant Agency of the \nMinistry of Health IGA MZd NR/ 9135-3 (M. Králíčková), by the \nInstitutional Research Concept A V 0Z 50200510 (P. Šíma) and \nMSM 0021620812 (Z. Ulčová-Gallová). \nCorresponding author: Milena Králíčková, Charles University in \nPrague, Faculty of Medicine in Pilsen and University Hospital, \nDepartment of Obstetrics and Gynecology, Alej Svobody 80, \n301 66 Pilsen, Czech Republic. Phone: (+ 420) 604 724 171 (mo-\nbile phone), (+ 420) 377 105 229 (office); Fax.: (+420) \n377 105 290; e-mail: M.Kralickova@seznam.cz\nAbbrevations: IVF – in vitro fertilization, LIF – leukaemia in-\nhibitory factor, LIFR – LIF receptor, NK cells – natural killer \ncells, PCOS – polycystic ovary syndrome, PR – pregnancy rate, \nTGGE – temperature gradient gel electrophoresis.\n\nV ol. 55 93\ndometrium of healthy women, LIF and LIF mRNA are \nexpressed throughout the menstrual cycle with a strik-\ning increase in the midsecretory phase, coinciding with \na supposed window of implantation. LIF acts on cells by \nbinding to the LIF receptor (LIFR) and gp130, which \nbelongs to the IL-6 receptor family. Human blastocysts \nexpress mRNAs for LIFR and gp130, participating ac-\ntively in establishing contact with the endometrium. In \nthe endometrium, LIFR and gp130 are expressed in the \nepithelium throughout the cycle, with a strong increase \nin the midsecretory phase (for review see Aghajanova, \n2004; Králíčková et al., 2005). \nA decrease in production of LIF in the uterine micro-\nenvironment was generally found in women in states of \nimpaired fertility. No correlation between LIF in serum \nand uterine flushing was demonstrated, rendering LIF \nmeasurements in serum useless for the diagnosis of im-\npaired infertility. On the other hand, LIF measurement \nin uterine flushing seems to be a useful but laborious \ndiagnostic tool in the prediction of unsuccessful implan-\ntation (Mikołajczyk et al., 2003).\nThe frequency of functionally relevant mutations of \nthe LIF gene in infertile women is significantly enhanced \nin comparison with fertile controls (Giess et al., 1999; \nSteck et al., 2004; Králíčková et al., 2006), but these \nalterations have not yet been characterized. The reason \nis that in the first two reports (Giess et al., 1999; Steck et \nal., 2004) there were only one or two women with the \nsame potentially functional mutation identified. The \nonly larger population with identical mutation, the G to \nA transition at position 3400 of the LIF gene, was stud-\nied in 2007 with the aim to characterize the clinical im-\npact of this mutation. The study suggested that women \nwith this LIF gene mutation have elevated levels of an-\ntiphospholipid antibodies in the serum (Králíčková et \nal., 2007). The authors hypothesized that this is due to \nthe LIF impact on NK cell population, which is func-\ntionally connected to the presence of antiphospholipid \nantibodies in the serum (Roussev et al., 1996; Kaider et \nal., 1999; Sher et al., 2000). Our current population of \n15 infertile women with identical mutation is the largest \npresented in the literature so far.\nThe involvement of changes in humoral as well as \ncell-mediated immunity in endometriosis and idiopathic \ninfertility has been put forward by numerous investiga-\ntors (Giudice et al., 2002; Mahutte and Arici, 2002; Ant-\nsiferova et al., 2005). However, the exact role of immu-\nnity disturbances in the pathophysiology of these \ndiseases still remains controversial. \nEndometriosis is a chronic inflammatory disease of \nmultifactorial aetiology characterized by the implanta-\ntion and growth of endometrial glands and stroma out-\nside the uterine cavity. Reports on the role of LIF in the \ninfertility of endometriosis patients are rather conflict-\ning. Peritoneal fluid from women with endometriosis \nhas a detrimental effect on embryo implantation, per-\nhaps by adversely affecting LIF expression as well as \nuterine receptivity (Illera et al., 2000). LIF staining in-\ntensity in the glandular epithelium is significantly re-\nduced in endometriosis patients compared to controls \n(Dimitriadis et al., 2006). On the other hand, in a recent \nstudy in which the uterine flushings and endometrial \nsamples were collected 7–9 days after ovulation (at the \ntime of a supposed implantation window) from both in-\nfertile patients with endometriosis and fertile, endome-\ntriosis-free controls, LIF was assessed and no statisti-\ncally significant differences were found. The authors \nconcluded that there is no receptivity defect with regard \nto LIF secretion by eutopic endometrium in infertile \nwomen with endometriosis (Mikołajczyk et al., 2006).\nThe NK and T cells are deregulated in endometriosis \npatients, too – inhibition of natural killer (NK) and cyto-\ntoxic T-cell function has been proposed as a mechanism \nof the pathogenesis of endometriosis (Maeda et al., \n2002; Antsiferova et al., 2005; Matsuoka et al., 2005; \nZhang et al., 2006). According to current knowledge, \nimmune cell inhibition in endometriosis is mediated by \nfactors other than HLA-G (the only MHC antigen ex-\npressed on cytotrophoblast cells of placenta) and cy-\ntokines in general have been suggested. \nIdiopathic (unexplained) infertility patients suffer \nfrom various immunologic disturbances. They represent \na heterogeneous group with many different findings – \nelevated NK-cell activity (Matsubayashi et al., 2001), \nantiphospholipid antibodies in the serum (Nouza et al., \n1992; Ulčová-Gallová et al., 1998), and embryotoxic \ncytokines to name just a few. For example, sera and cer-\nvical mucus of idiopathic infertile women demonstrate \nsignificantly higher levels of interferon γ and tumour \nnecrosis factor α compared to fertile controls (Naz et al., \n1995). \nThe alterations in NK cell numbers and function are \nexclusive for endometriosis and idiopathic infertility, \nand the involvement of changes in immunity in other \nfrequent infertility diagnoses (PCOS, tubal factor) only \nappears in a few studies and is never suggested as a key \nfactor in the pathogenesis of the disease. \nThe objective of this retrospective cohort study was \nto evaluate the impact of the above-mentioned LIF gene \nmutations on the outcome of treatment in women with \nvarious causes of infertility.\nMaterial and Methods\nPatients\nFifteen women (ages ranging from 24 to 40 years with \nmedian age 32 years) with potentially functional LIF gene \nmutation, the G to A transition at position 3400 leading to \nvaline to methionine exchange at codon 64 (V64M), in \nthe AB loop region of the LIF protein (study group) and \n136 infertile women without any LIF gene mutation (con-\ntrol group) were included in this retrospective cohort \nstudy. The group of mutation-positive women was divid-\ned into two parts: group A was made up of women with \ndiagnoses that are frequently accompanied by various \nchanges in humoral as well as cell-mediated immunity – \nidiopathic infertility (N = 4) and endometriosis (N = 3). \nLIF Gene Mutations and Their Impact on the IVF Outcome\n\n94 V ol. 55\nGroup B comprised patients with PCOS (N = 3), andro-\nlogical factor (N = 3), tubal factor (N = 1) and hyperpro-\nlactinaemia (N = 1). The control group consisted of 136 \ninfertile women with no LIF gene mutation (ages ranging \nfrom 22 to 41 years with median age 31 years). It was \nmade up of 10 patients diagnosed with endometriosis, 27 \npatients diagnosed with idiopathic infertility (group C), \n41 patients diagnosed with male factor, 28 with tubal fac-\ntor and 30 with PCOS (group D).\nThe endometriosis patients covered all stages of the \ndisease. Patients classified as idiopathically infertile \nwere documented as having patent tubes using laparo-\nscopy, were free of pelvic adhesions and endometriosis, \nand were shown to have a normal uterine cavity using \nhysteroscopy or hysterosalpingography. They had nor-\nmal ovulation and there was no evidence of male factor, \nantisperm or zona pellucida antibodies. \nWith regard to both follicular response and days of \ngonadotropin stimulation, the groups were similar. This \nstudy was approved by the Charles University Ethics \nCommittee and informed consent was obtained from all \nindividuals. \nDNA extraction, polymerase chain reaction \n(PCR) and mutation status of the LIF gene\nPeripheral blood leukocytes were used for DNA isola-\ntion in all cases. DNA was isolated using the DNeasy Tis-\nsue Kit (QIAgen, Hilden, Germany) according to the \nmanufacturer’s protocol. The coding regions and the \nexon-intronic junctions were analysed using temperature \ngradient gel electrophoresis (TGGE). Exon 3 was divided \ninto three parts and the LIF gene was screened and di-\nvided into five partly overlapping fragments. PCR was \nperformed using five sets of primers (Table 1). Primers \nwere modified using the Poland java script (www.bio-\nphys.uni-duesseldorf.de/POLAND/poland.html) with the \nhelp of GC-clamp addition to create a thermostable do-\nmain suitable for TGGE. The reaction conditions were as \nfollows: 12.5 µl of HotStart Taq PCR Master Mix (QIA-\ngen), 10 pmol of each primer, 100 ng of DNA and dis-\ntilled water up to 25 µl. The amplification programme \nconsisted of denaturation at 95 °C for 15 min and then 35 \ncycles of denaturation at 95 °C for 30 s, annealing at 60 \n°C for 30 s and extension at 72 °C for 1 min. PCR was \ncompleted by a final extension at 72 °C for 7 min. The \namplification programme was the same for all analysed \nexons except exon 1, where the annealing temperature \nwas 50 °C. The length and quality of the PCR products \nwere checked in standard agarose gels.\nScreening of mutations was performed using heter-\noduplex analysis on TGGE (Biometra, Goettingen, Ger-\nmany) on 8% denaturing acrylamide gel (AA : bis-AA \n[37.5 : 1], 6 mol/l urea, 1x MOPS, 2% glycerol). The \nTGGE analysis was performed in two steps – firstly, for \neach exon, electrophoresis conditions for parallel gels \nhad to be optimized using perpendicular gels. Then the \nparallel gels for patients’ samples were run. The running \ntime was always 1 h 30 min at a temperature gradient \nshown in Table 1. DNA bands were detected using the \nsilver staining method already used by us previously, \nagain according to a standard protocol (Králíčková et \nal., 2006). \nThe relevant DNA samples of all the women found to \nbe positive in TGGE analysis were amplified and se-\nquenced using automated sequencing with the aid of a \nBig Dye Terminator Sequencing Kit (PE/Applied Bio-\nsystems, Foster City, CA). The samples were run in an \nautomated sequencer ABI Prism 310 Avant (PE/Applied \nBiosystems) at a constant voltage of 11.3 kV for 20 min. \nAll PCR and sequencing experiments were repeated at \nleast twice in TGGE-positive patients. \nStatistical methods\nThe results were statistically assessed using the Fish-\ner’s 2 by 2 exact test; P < 0.05 was considered statisti-\ncally significant.\nZ. Novotný et al.\nTable 1. Table of primers and temperature gradients for parallel TGGE gels. GC clamps in italics\nExon Names  Sequence 5 ‚→ 3‘ Temperature\n of the primers  gradients\nE1 E1F-GC CGCCCGCCGCGCCCCGCGCCCGGCCCGCCGCCCCCGCCCG  55 °C–63°C\n  CTATGATGCACCTCAAACAA*\n E1R GGGGCGGGTGTATTTA*\nE2 E2F GCCACCCTTTCCTGCCTTTCTAC** 53 °C–65°C\n E2R-GC CGGGCGGGGGCGGCGGGCCGGGCGCGGGGCGCGGCGGGCG\n  TCCCTGCCATCTCCTGTCAGTATC**\nE3.1 E3.1F-GC CGCCCGCCGCGCCCCGCGCCCGGCCCGCCGCCCCCGCCCG 58°C–66°C\n  ACAATTCCAGATGCTTACAGGG **\n E3.1R-GC GCGGG GCCAAGGTACACGACTATGC**\nE3.2 E3.2F CCCAACAACCTGGACAAGCTATG** 60 °C–65°C\n E3.2R-GC CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCC\n  CCGTAGGTCACGTCCACATG**\nE3.3 E3.3F-GC CCCGC CCTCCTTAGCAACGTGCTGT* 58 °C–62°C\n E3.3R-GC CGGGCGGGGGCGGCGGGCCGGGCGCGGGGCGCGGCGGGCG\n  ACATCTGGACCCAACTCCTG*\n* our original primers; ** primers inspired by Giess et al. (1999)\n\nV ol. 55 95\nResults\nIn all studied groups (N = 151) there were fifteen \npositive samples identified by TGGE. All of them were \nin exon 3.2. By subsequent sequencing all these samples \nshowed an alteration in the DNA sequence that was \nidentical to the previously described potentially func-\ntional LIF gene point mutation, the G to A transition at \nposition 3400. \nSeven of the mutation-positive patients were success-\nfully treated by the first cycle of IVF (Table 2), which \nmeans that the pregnancy rate was 47 %. If we then \ncompare mutation-positive women (group A+B) to \nwomen with no LIF gene mutation (group C+D) regard-\nless of their groupings according to their infertility diag-\nnoses, there is no statistically significant difference in \npregnancy rates. \nOf the successfully treated group of seven mutation-\npositive women, not one had been diagnosed with idio-\npathic infertility and there was only one with endome-\ntriosis, which means that there was a statistically \nsignificant difference in the pregnancy rates between \ngroups A and B (P = 0.01, Fisher’s 2 by 2 exact test). \nComparing the two groups of women with endome-\ntriosis and idiopathic infertility, it was found that the \nmutation-positive group had a lower pregnancy rate \n(14 %) than the control group C (pregnancy rate 49 %), \nbut due to the low number of patients in the groups it \nwas not statistically significant (P = 0.11, Fisher’s 2 by 2 \nexact test). The pregnancy rates of the groups with dif-\nferent diagnoses in the control population of our cohort \nwere not significantly different statistically (Table 3). \nDiscussion\nThe frequency of the LIF gene mutations in the popu-\nlation of infertile women is significantly elevated in \ncomparison with fertile controls. Nevertheless, the LIF \ngene mutations may be compensated and the treatment \ncan succeed. The compensatory mechanisms for LIF de-\nfects have not been elucidated yet. The role of the sec-\nond LIF gene allele and the hormonal stimulation were \nhypothesized (Steck et al., 2004), as well as the role of \nother regulatory molecules, most of them of cytokine \nnature (Králíčková et al., 2006).\nOur results suggest that success of the infertility treat-\nment in LIF gene mutation-positive women is influenced \nby the cause of infertility. Idiopathic infertility and en-\ndometriosis have a negative impact on the outcome of \nIVF. We suppose that this is due to the difference in NK \ncell counts and function in these two groups and the in-\nteraction of NK cells with variants of the LIF molecule.\nWe are aware of the fact that the statistical signifi-\ncance is not strong and that the compared groups are \nthemselves heterogeneous, which makes our results \neven more disputable. Nevertheless, the group of 15 \nmutation-positive women is the largest published so far \nand the results can contribute to characterization of the \ninfluence of LIF and its gene mutations on infertility and \nits treatment.\nLIF Gene Mutations and Their Impact on the IVF Outcome\nTable 2. Overview of all mutation-positive infertile women \nGroups Age Diagnosis Type of infertility Outcome of the IVF treatment\n 30 Unexplained infert. Primary No pregnancy\n 39 Unexplained infert. Primary No pregnancy\n 40 Unexplained infert. Secondary No pregnancy\nGroup A 34 Unexplained infert. Primary No pregnancy\n 39 Endometriosis Primary No pregnancy\n 33 Endometriosis Primary No pregnancy\n 33 Endometriosis Secondary Pregnancy\n 27 PCOS Primary No pregnancy\n 28 PCOS Primary Pregnancy\n 28 PCOS  Secondary Pregnancy\nGroup B 31 Androlog. factor Primary Pregnancy\n 31 Androlog. factor Primary Pregnancy\n 24 Androlog. factor Primary Pregnancy\n 31 Tubal factor Primary No pregnancy\n 33 Hyperprolactinaemia Secondary Pregnancy\nTable 3. Overview of control population (LIF gene-negative infertile women)\nGroups Diagnoses Number  Pregnant  PR of the individual  PR of the\n  of patients after IVF diagnoses group\nGroup C Unexplained infert. 27 14 51 % 49 %\nmean age 31 ± 4 years  Endometriosis 10 4 40 %\n \nGroup D PCOS 30 15 50 % \nmean age 30 ± 6 years Androlog. factor 41 23 56 % 52 %\n Tubal factor 28 14 50 %\n \n  136 70  51 %\n\n96 V ol. 55\nThe high pregnancy rate in group B can be influenced \nby lower average age of patients as well as by the indi-\ncations to IVF/ICSI. Some authors (Arici et al., 1996; \nOmland et al., 2005) report that andrological factor, \nPCOS or hyperprolactinaemia are usually associated \nwith relatively higher pregnancy rates after therapy than \nother indications. \nThe question of whether post-treatment pregnancy \nrates are influenced by the cause of infertility remains \ncontroversial. Some authors report a lower pregnancy \nrate in endometriosis patients (Arici et al., 1996; Om-\nland et al., 2005; Ahinko-Hakamaa et al., 2007); some \nothers report no differences between the various diag-\nnoses (Burke et al., 2000; Calhaz-Jorge et al., 2004). \nHuman endometrium possesses a unique immuno-\nlogical environment enabling implantation of the semi-\nallogeneic or allogeneic embryo. Large populations of \nmacrophages and uterine-specific NK cells infiltrate the \nimplantation site, believed to be important modulators \nof trophoblast invasion and decidualization (Johnson et \nal., 1999; Croy et al., 2003). However, our knowledge \nregarding selective recruitment of leukocyte subtypes is \nnot complete. \nLIF is produced by endometrial NK cells that interact \nwith the invading trophoblast and although its effects on \ntrophoblast are not yet clear, LIF appears to mediate in-\nteractions between maternal decidual leukocytes and the \ninvading trophoblast. One of the actions of LIF on the \nendometrium is the regulation of the uterine leukocyte \npopulation. The LIF knockout mice have double the \npercentage of NK cells compared to wild-type mice at \nthe time of the implantation window, indicating that LIF \nrestricts the migration of NK cells to the uterus (Schofield \nand Kimber, 2005). \nWe are aware of the fact that this is just a pilot study \nand a larger number of LIF gene mutation-positive in-\nfertile patients is needed for further investigations. \nA complete understanding of the complex regulatory \nmechanism may provide new therapeutic targets in fe-\nmale reproductive tract physiology.\nAcknowledgement\nThe authors wish to thank Dr. František Šefrna for his \nsupervision of statistical analysis. \nReferences\nAghajanova, L. (2004) Leukemia inhibitory factor and human \nembryo implantation. Ann. N. Y. Acad. Sci. 1034, 176-183.\nAhinko-Hakamaa, K., Huhtala, H., Tinkanen, H. (2007) \nSuccess in intrauterine insemination: the role of etiology. \nActa Obstet. Gynecol. Scand. 86, 855-860. \nAntsiferova, Y . S., Sotnikova, N. Y ., Posiseeva, L. V ., Shor, A. \nL. (2005) Changes in the T-helper cytokine profile and in \nlymphocyte activation at the systemic and local levels in \nwomen with endometriosis. Fertil. Steril. 84, 1705-1711. \nArici, A., Oral, E., Bukulmez, O., Duleba, A., Olive, D. \nL., Jones, E. E. (1996) The effect of endometriosis on \nimplantation: results from the Yale University in vitro \nfertilization and embryo transfer program. Fertil. Steril. \n65, 603-607.\nBurke, L. M., Davenport, A. T., Russell, G. B., Deaton, J. \nL. (2000) Predictors of success after embryo transfer: \nexperience from a single provider. Am. J. Obstet. Gynecol. \n182, 1001-1004. \nCalhaz-Jorge, C., Chaveiro, E., Nunes, J., Costa, A. P. (2004) \nImplications of the diagnosis of endometriosis on the \nsuccess of infertility treatment. Clin. Exp. Obstet. Gynecol. \n31, 25-30.\nCroy, B. A., Esadeg, S., Chantakru, S., van den Heuvel, M., \nPaffaro, V . A., He, H., Black, G. P., Ashkar, A. A., Kiso, \nY ., Zhang, J. (2003) Update on pathways regulating the \nactivation of uterine natural killer cells, their interactions \nwith decidual spiral arteries and homing of their precursors \nto the uterus. J. Reprod. Immunol. 59, 175-191.\nDimitriadis, E., Stoikos, C., Stafford-Bell, M., Clark, I., \nPaiva, P., Kovacs, G., Salamonsen LA. (2006) Interleukin-\n11, IL-11 receptor α and leukemia inhibitory factor are \ndysregulated in endometrium of infertile women with \nendometriosis during the implantation window. J. Reprod. \nImmunol. 69, 53-64.\nGiess, R., Tanasescu, I., Steck, T., Sendtner, M. (1999) \nLeukaemia inhibitory factor gene mutations in infertile \nwomen. Mol. Hum. Reprod. 5, 581-586. \nGiudice, L. C., Telles, T. L., Lobo, S., Kao, L. (2002) The \nmolecular basis for implantation failure in endometriosis: on \nthe road to discovery. Ann. N. Y. Acad. Sci. 955, 252-264.\nIllera, M. J., Juan, L., Stewart, C. L., Cullinan, E., Ruman, J., \nLessey, B. A. (2000) Effect of peritoneal fluid from women \nwith endometriosis on implantation in the mouse model. \nFertil. Steril. 74, 41-48.\nJohnson, P. M., Christmas, S. E., Vince, G. S. (1999) \nImmunological aspects of implantation and implantation \nfailure. Hum. Reprod. 14, 26-36 (Suppl 2).\nKaider, A. S., Kaider, B. D., Janowicz, P. B., Roussev, R. \nG. (1999) Immunodiagnostic evaluation in women with \nreproductive failure. Am. J. Reprod. Immunol.  42, 335-\n346.\nKrálíčková, M., Šíma, P., Rokyta, Z. (2005) Role of the \nleukemia-inhibitory factor (LIF) gene mutations in infertile \nwomen: The embryo-endometrial cytokine cross talk \nduring implantation – a delicate homeostatic equilibrium. \nFolia Microbiol. 50, 179-186. \nKrálíčková, M., Šíma, R., Vaněček,T., Šíma, P., Rokyta Z, \nUlčová-Gallová, Z., Suchá, R., Uher, P., Hes, O. (2006) \nLeukemia inhibitory factor gene mutations in the population \nof infertile women are not restricted to nulligravid patients. \nEur. J. Obstet. Gynecol. Reprod. Biol. 127, 231-235.\nKrálíčková, M., Ulčová-Gallová, Z., Šíma, R., Vaněček, T., \nŠíma, P., Křižan, J., Suchá, R., Uher, P., Hes, O., Novotný, Z., \nRokyta, Z., Větvička, V .\n (2007) Association of the leukemia \ninhibitory factor gene mutation and the antiphospholipid \nantibodies in the peripheral blood of infertile women. Folia \nMicrobiol. 52, 543-548. \nMaeda, N., Izumiya, C., Oguri, H., Kusume, T., Yamamoto, \nY ., Fukaya, T. (2002) Aberrant expression of intercellular \nadhesion molecule-1 and killer inhibitory receptors induces \nimmune tolerance in women with pelvic endometriosis. \nFertil. Steril. 77, 679-683.\nZ. Novotný et al.\n\nV ol. 55 97\nMahutte, N. G., Arici, A. (2002) New advances in the \nunderstanding of endometriosis related infertility. J. \nReprod. Immunol. 55, 73-83.\nMatsubayashi, H., Hosaka, T., Sugiyama, Y ., Suzuki, T., \nArai, T., Kondo, A., Sugi, T., Izumi, S., Makino, T. (2001) \nIncreased natural killer-cell activity is associated with \ninfertile women. Am. J. Reprod. Immunol. 46, 318-322.\nMatsuoka, S., Maeda, N., Izumiya, C., Yamashita, C., \nNishimori, Y ., Fukaya, T. (2005) Expression of inhibitory-\nmotif killer immunoglobulin-like receptor, KIR2DL1, is \nincreased in natural killer cells from women with pelvic \nendometriosis. Am. J. Reprod. Immunol. 53, 249-254.\nMikołajczyk, M., Skrzypczak, J., Szymanowski, K., Wirstlein, \nP. (2003) The assessment of LIF in uterine flushing – a \npossible new diagnostic tool in states of impaired fertility. \nReprod. Biol. 3, 259-270. \nMikołajczyk, M., Wirstlein, P., Skrzypczak, J. (2006) \nLeukaemia inhibitory factor and interleukin 11 levels in \nuterine flushings of infertile patients with endometriosis. \nHum. Reprod. 21, 3054-3058.\nNaz, R. K., Butler, A., Witt, B. R., Barad, D., Menge, A. C. \n(1995) Levels of interferon-γ and tumor necrosis factor- α \nin sera and cervical mucus of fertile and infertile women: \nimplication in infertility. J. Reprod. Immunol. 29, 105-117. \nNouza, K., Kinský, R., Dimitrov, D. (1992) Immunology and \nimmunopathology of reproduction. Folia Biol. (Praha) 38, \n170-194. \nOmland, A. K., Abyholm, T., Fedorcsák, P., Ertzeid, G., \nOldereid, N. B., Bjercke, S., Tanbo, T. (2005) Pregnancy \noutcome after IVF and ICSI in unexplained, endometriosis-\nassociated and tubal factor infertility. Hum. Reprod. 20, \n722-727. \nRoussev, R. G., Kaider, B. D., Price, D. E., Coulam, C. B. \n(1996) Laboratory evaluation of women experiencing \nreproductive failure. Am. J. Reprod. Immunol.  35, 415-\n420.\nSchofield, G., Kimber, S. J. (2005) Leukocyte subpopulations \nin the uteri of leukemia inhibitory factor knockout mice \nduring early pregnancy. Biol. Reprod. 72, 872-878.\nSher, G., Fisch, J. D., Maassarani, G., Matzner, W., Ching, W., \nChong, P. (2000) Antibodies to phosphatidylethanolamine \nand phosphatidylserine are associated with increased \nnatural killer cell activity in non-male factor infertility \npatients. Hum. Reprod. 15, 1932-1936.\nSteck, T., Giess, R., Suetterlin, M. W., Bolland, M., Wiest, \nS., Poehls, U. G., Dietl, J. (2004) Leukaemia inhibitory \nfactor (LIF) gene mutations in women with unexplained \ninfertility and recurrent failure of implantation after IVF \nand embryo transfer. Eur. J. Obstet. Gynecol. Reprod. Biol. \n15, 69-73.\nUlčová-Gallová, Z., Krauz, V ., Bouše, V ., Novotný, Z., Rokyta, \nZ., Fialová, P., V ondráček, J. (1998) Correlation between \nperitoneal fluid and serum antiphospholipid antibodies in \nwomen with primary infertility. Int. J. Fertil. Womens Med. \n43, 267-272. \nZhang, C., Maeda, N., Izumiya, C., Yamamoto, Y ., Kusume, \nT., Oguri, H., Yamashita, C., Nishimori, Y ., Hayashi, K., \nLuo, J., Fukaya, T. (2006) Killer immunoglobulin-like \nreceptor and human leukocyte antigen expression as \nimmunodiagnostic parameters for pelvic endometriosis. \nAm. J. Reprod. Immunol. 55, 106-114.\nLIF Gene Mutations and Their Impact on the IVF Outcome","source_license":"CC0","license_restricted":false}