Vitamin D receptor gene polymorphism in women with genital endometriosis, type 1 diabetes mellitus, and in the population

In: Journal of obstetrics and women's diseases · 2021 · vol. 70(4) , pp. 25–33 · doi:10.17816/jowd70796 · W3203552795
article OA: bronze CC0 ⤵ 1 in-corpus citation
AI-generated summary by claude@2026-06, 2026-06-06

The vitamin D receptor gene's BsmI G allele and G/G genotype were more frequent in women with genital endometriosis, while the TaqI t allele and T/t or t/t genotypes were more common in type 1 diabetes mellitus patients.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

AI-generated deep summary by claude@2026-06, 2026-06-06 · read from full text

This case-control study examined whether vitamin D receptor (VDR) gene polymorphisms are associated with the risk of genital endometriosis and type 1 diabetes mellitus by genotyping rs1544410 (BsmI), rs731236 (TaqI), and rs2228570 (FokI) using PCR-RFLP in 129 women with confirmed stage I–IV genital endometriosis, 71 with type 1 diabetes, and 82 population controls. The rs1544410 G allele and G/G genotype were more frequent in women with genital endometriosis than in controls, with an odds ratio of about 1.9, while the A/A plus G/A genotype combination was more common in women with type 1 diabetes and in controls than in those with genital endometriosis. The rs731236 t allele and T/t plus t/t genotype combination were increased in type 1 diabetes compared with genital endometriosis. The paper does not explicitly state limitations in the provided text, but it uses a relatively small sample and focuses on selected VDR SNPs. This paper is centrally about endometriosis — it tests VDR gene polymorphisms as potential genetic risk markers for genital endometriosis.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

AIM: The aim of this study was to analyze the association between the vitamin D receptor gene polymorphism and the risk of developing genital endometriosis and type 1 diabetes mellitus. MATERIALS AND METHODS: The frequency of allelic variants of the VDR gene was studied by PCR-RFLP analysis in 282 women, including 129 patients with genital endometriosis (stages IIV), 71 patients with type 1 diabetes mellitus, and 82 women of the control group represented by the population sample. RESULTS: It was found that the frequency of the allele G polymorphic variant of rs1544410 (BsmI) in the VDR gene was significantly higher in the group of patients with genital endometriosis compared to the population sample (p = 0.048). Significant differences for the G / G genotype in patients with genital endometriosis relative to the control group (p 0.05) and the group of patients with type 1 diabetes mellitus (p 0.05) were revealed. According to the odds ratio, the risk of developing genital endometriosis was 1.9 times higher for this genotype (OR = 1.93 CI = 1.0823.450; OR = 1.892 CI = 1.0223.430). The combination of the A / A and G / A genotypes was significantly more common in patients with type 1 diabetes mellitus (p = 0.040) and in the population (p = 0.025), when compared to the patients with genital endometriosis. A significant increase in the t allele of the rs731236 polymorphism (TaqI) of the VDR gene was found in the group of patients with type 1 diabetes mellitus (p 0.05). The combination of the T / t and t / t genotypes of the rs731236 polymorphism (TaqI) of the VDR gene in patients with type 1 diabetes mellitus were significantly more common than in the group of patients with genital endometriosis (p = 0.017). CONCLUSIONS: The data obtained may be important for risk assessment of genital endometriosis and type 1 diabetes mellitus development and for developing new strategies for the prevention and treatment of these diseases.
Full text 28,148 characters · extracted from oa-doi-fallback · 8 sections · click to expand

Abstract

AIM: The aim of this study was to analyze the association between the vitamin D receptor gene polymorphism and the risk of developing genital endometriosis and type 1 diabetes mellitus.

Materials and methods

The frequency of allelic variants of the VDR gene was studied by PCR-RFLP analysis in 282 women, including 129 patients with genital endometriosis (stages I–IV), 71 patients with type 1 diabetes mellitus, and 82 women of the control group represented by the population sample.

Results

It was found that the frequency of the allele G polymorphic variant of rs1544410 (BsmI) in the VDR gene was significantly higher in the group of patients with genital endometriosis compared to the population sample (p = 0.048). Significant differences for the G / G genotype in patients with genital endometriosis relative to the control group (p < 0.05) and the group of patients with type 1 diabetes mellitus (p < 0.05) were revealed. According to the odds ratio, the risk of developing genital endometriosis was 1.9 times higher for this genotype (OR = 1.93 CI = 1.082–3.450; OR = 1.892 CI = 1.022–3.430). The combination of the A / A and G / A genotypes was significantly more common in patients with type 1 diabetes mellitus (p = 0.040) and in the population (p = 0.025), when compared to the patients with genital endometriosis. A significant increase in the t allele of the rs731236 polymorphism (TaqI) of the VDR gene was found in the group of patients with type 1 diabetes mellitus (p < 0.05). The combination of the T / t and t / t genotypes of the rs731236 polymorphism (TaqI) of the VDR gene in patients with type 1 diabetes mellitus were significantly more common than in the group of patients with genital endometriosis (p = 0.017).

Conclusions

The data obtained may be important for risk assessment of genital endometriosis and type 1 diabetes mellitus development and for developing new strategies for the prevention and treatment of these diseases. Full Text

Background

The term “vitamin D” represents a group of chemically similar substances. Contemporary research showed that vitamin D is not only essential for the normal development and functioning of the bone tissue but is also a hormone that causes various changes in many tissues and organs. The active hormonal form of vitamin D, calcitriol (1,25[OH]2D, 1,25-dihydroxy vitamin D, 1,25-dihydroxy vitamin D3) is formed as a result of two successive hydroxylation reactions and binds to specific vitamin D receptors (VDR), with various biological effects, such as hypotensive, lipolytic, normoglycemic, anabolic, antidepressant, analgesic, anti-inflammatory, immunomodulatory, and antiproliferative effects, and also regulates apoptosis and angiogenesis. These effects are classified as “non-classical.” The VDR is encoded by the VDR gene, which has several polymorphic variants. The most significant and studied polymorphic variants of the VDR gene associated with several disease deve lopment are rs1544410 (BsmI), rs2228570 (FokI), rs731236 (TaqI), and rs7975232 (ApaI) [1] (Figure). Figure. Polymorphic variants and structure of the VDR gene: FokI, BsmI, ApaI, TaqI — sites for recognition of the corresponding restriction endonucleases Genital endometriosis is registered in 10% of women of reproductive age worldwide. This disease most commonly manifests itself as pain and infertility. On average, the delay in diagnosing patients with external genital endometriosis (EGE) is approximately 8–10 years [2]. The problem of late EGE diagnosis is mainly associated with the variety of clinical manifestations and absence of non-invasive highly specific markers that determine the presence of the disease, as well as necessary intraoperative and morphological diagnosis confirmation. EGE is caused not by mutations of single genes, but rather unfavorable combinations of allelic variants of several different genes (gene network) that control endometrial morphogenesis processes, which is typical for multifactorial diseases [3]. Precisely due to its non-classical effects, the colecalciferol is believed to directly affect the EGE pathogenesis and can be used as its drug therapy. A number of works, both in vitro and based on experimental models in animals, demonstrate the positive effect of colecalciferol on endometrioid foci [4–7]. Data on the effect of colecalciferol on pain syndrome, psycho-emotional background stabilization, and fertility improvement are controversial [8–11]. Epidemiological data indicate the involvement of vitamin D deficiency in the pathogenesis of type 1 diabetes mellitus (DM). Polymorphisms in genes essential for vitamin D metabolism also modulate the risk of type 1 DM. J. Cooper et al. revealed a relationship between single nucleotide polymorphisms (SNPs) rs10741657 and rs12794714 in the CYP2R1 gene and the risk of occurrence of type 1 DM [12]. The United Kingdom case-control study, involving 7854 patients with type 1 DM and 8758 healthy participants, revealed an association between the two SNPs (rs10877012 and rs4646536) in the CYPB1 gene encoding vitamin D 1á-hydroxylase and type 1 DM [13]. The GG genotype of CYP2R1 (SNP rs10741657) or the CC genotype of CYP27B1 (SNP rs10877012) was found to increase the risk of type 1 DM [14]. In people with a combination of these two genotypes, the risk of type 1 DM was significantly higher than that with only one genotype, which indicates a potential synergy between the GG genotype of CYP2R1 and the CC genotype of CYP27B1 in determining the risk of type 1 DM. Serum vitamin D (25[OH]D) levels were significantly lower in patients with the GG genotype of CYP2R1 and the CC genotype of CYP27B1 compared to those with the CYP2R1 AA and CYP27B1 AA genotypes. An assumption was made about the potential role of VDR gene polymorphisms in the patho genesis of type 1 DM. A major TEDDY study was conducted in 6 United States and 5 European countries from 2004 to 2010 [15]. A total of 424,788 newborns were examined. The study included 8,676 children with an increased risk of type 1 DM (Abs GADA, IAA, and IA-2A), having first-line relatives with type 1 DM and those without relatives with type 1 DM. The study started in children aged 4 months. The follow-up period was 6 years. The polymorphism in genes VDR, CYP24A, CYP27B1, GC, and RXR was analyzed. Vitamin D deficiency based on the determination of the blood serum level of 25(OH)D was established in 42% of children and 22%–67% of children with type 1 DM. The highest plasma concentrations of 25(OH)D and a low risk of developing type 1 DM were revealed in children with the minor allele of the VDR rs7975232 (ApaI). - Tapija et al. [16] believe that a higher level of 25(OH)D in cord blood can be considered a favorable prognostic factor to reduce the risk of developing type 1 DM in children homozygous for the VDR rs11568820 (Cdx2) G/G genotype. N. Habibian et al. demonstrated an association between an increased risk of type 1 DM and some polymorphic variants in the VDR gene (especially BsmI and FokI). A sufficient level of 25(OH)D in the blood serum (≥30 ng/ml) in combination with some SNP genotypes (TaqI and BsmI) in the VDR gene in patients with newly diagnosed type 1 DM was established to contribute to the functional preservation of residual beta cells in the pancreas [17]. Research results suggest that SNPs in genes important for synthesis, transportation, and action of vitamin D may influence the risk of developing type 1 DM. The work aimed to analyze the association of the VDR gene polymorphism with the risk of EGE and type 1 DM.

Materials and methods

A total of 282 female patients were enrolled in the study, including 129 patients with grade I–IV genital endometriosis that are confirmed intraoperatively and morphologically, 71 patients with type 1 DM, and 82 female patients of the control group represented by the population sample. The exclusion criteria were severe concomitant somatic pathology and cancer. DNA from peripheral blood lymphocytes was isolated by the standard salt method with some modifications. The frequencies of allelic variants of the VDR gene were studied using the polymerase chain reaction (PCR) with restriction fragment length polymorphism. The following primers were used to amplify a fragment of the promoter region of the VDR gene: - VDR rs2228570 F GTATGAGGGCTCCGAAGGCA - VDR rs2228570 R GAAGGAGATGTGAAAAATGCAAG - VDR rs1544410 F CCCTCACTGCCCTTAGCTCT - VDR rs1544410 R TAACTTCCTCTTCGGCCTTT - VDR rs731236 F 5’- GATGATCCAGAAGCTAGCCGACCT-3’ - VDR rs731236 R 5’- GCAACTCCTCATGGCTGAGGTCT-3’ PCR conditions are presented in Table 1. Table 1. Conditions for the polymerase chain reaction Polymorphic variants of the VDR gene | Denaturation | Denaturation | Renaturation | Synthesis | 12 cycles | 20 cycles | ||| rs2228570 (FokI) | 94°С — 7 min | 96°С — 15 s 65°С — 20 s | 96°С — 15 s 62°С — 20 s 76°С — 15 s | 72°С — 5 min | rs1544410 (BsmI) | 94°С — 7 min | 96°С — 15 s 65°С — 20 s | 96°С — 15 s 62°С — 20 s 76°С — 15 s | 72°С — 5 min | rs731236 (TaqI) | 94°С — 7 min | 96°С — 15 s 65°С — 20 s | 96°С — 15 s 62°С — 20 s 76°С — 15 s | 72°С — 5 min | Table 2. Restriction endonucleases and analysis of polymorphic variants of the VDR gene Polymorphic variants of the VDR gene | Size of the PCR product | Endonuclease | Allele and size of restriction fragments | rs1544410 (BsmI) | 320 bp | HspA I | A — 320 bp G — 216 + 104 bp | rs2228570 (FokI) | 429 bp | BstF5I | T — 101 + 91 + 237 bp C — 101 + 328 bp | rs731236 (TaqI) | 360 bp | Taq I | T — 360 bp t — 248 + 112 bp | Note: bp — base pairs; PCR — polymerase chain reaction. Restriction of the amplified DNA fragments was performed according to the manufacturer’s recommendations (Sibenzyme). PCR products were hydrolyzed with a restriction endonuclease (Table 2) at 37°C for 16 h in 10 μl of reaction mixture containing 5 μl of amplification agent, 3 μl of water, 1 μl × 10 of buffer recommended by the manufacturer for each restriction endonuclease, and 10 units (0.5 μl) of restriction endonuclease. The completeness of hydrolysis was assessed by the results of electrophoresis in 7.5% polyacrylamide gel. Images were captured using a video gel documentation system (Vilber Lourmat). Statistical data processing was performed using the standard approaches used in population genetic studies. The significance of the frequency differences was determined using the exact two-tailed Fisher’s test using the standard formula, taking into account the Yates correction for paired comparisons with the control group. The chi-square test (÷2) with the use of the standard formula, taking into account the Yates correction for paired comparisons. The Bonferroni correction was used for multiple comparisons with the control group. The odds ratio (OR) was also applied for significant differen ces between the control and the study groups. The OR value concerning our data shows the extent probability of a given genotype in patients exceeding the probability of its presence in the control group or the extent of the probability of having a particular disease with a certain genotype is higher. The OR value was calculated using the formula: where a is the number of individuals with this marker in the study group; b is the number of individuals without this marker in the study group; c is the number of individuals with this marker in the control group; and d is the number of individuals lacking this marker in the control group. OR is indicated with a 95% confidence interval (CI). The CI boundaries were calculated by the formulas: . Differences were considered statistically significant at a p-value of <0.05.

Results

In the present study, the frequencies of alleles and genotypes were determined for the polymorphic variants rs1544410 (BsmI), rs2228570 (FokI), and rs731236 (TaqI) of the VDR gene. The analysis revealed that in the group of patients with EGE, the most common genotypes were G/G (47.3%) of the rs1544410 (BsmI) polymorphism, C/T (45.7%) of the rs2228570 (FokI) polymorphism, and T/T (49.6%) of the rs731236 (TaqI) polymorphism of the VDR gene. In the group of patients with type 1 DM, the most common genotypes were G/A (53.5%) of polymorphism rs1544410 (BsmI), C/T (40.9%) of polymorphism rs2228570 (FokI), and T/t (53.5%) of polymorphism rs731236 (TaqI); whereas in the control group, they were G/A (52.4%) of the rs1544410 (BsmI) polymorphism, C/T (47.6%) of the rs2228570 (FokI) polymorphism, and T/t (45.1%) of the rs731236 (TaqI) polymorphism of the VDR gene. The statistical data processing revealed a significantly higher frequency of the G allele of the polymorphic variant rs1544410 (BsmI) of the VDR gene in the group of patients with EGE compared with the population sample (p = 0.048). Significant differences were found in the G/G genotype in patients with EGE relative to the control group (p < 0.05) and the group of patients with type 1 DM (p < 0.05). According to the OR coefficient, the risk of EGE is 1.9 times higher for this genotype (OR 1.93 CI 1.082–3.450; OR 1.892 CI 1.022–3.430). The combination of genotypes A/A + G/A is significantly more common in patients with type 1 DM (p = 0.04) and the population (p = 0.025) compared to patients with EGE. Based on the data presented in Table 3, the analyses of the rs2228570 (FokI) polymorphic variant of the VDR gene found no significant differences. Table 3. Frequency distribution of genotypes and alleles of polymorphic variants of the VDR gene in patients with external genital endometriosis, type 1 diabetes mellitus, and the control group Polymorphic variant of the VDR gene | External genital endometriosis | Type 1 diabetes mellitus | Control group | p | ||||| n | % | n | % | n | % | |||| rs1544410 (BsmI) | Genotypes | A/A | 16 | 12.4 | 10 | 14.1 | 13 | 15.9 | | G/A | 52 | 40.3 | 38 | 53.5 | 43 | 52.4 | ||| G/G | 61 | 47.3 | 23 | 32.4* | 26 | 31.7** | <0.05* OR 1.892 CI 1.022–3.430 0.05** OR 1.932 CI 1.082–3.450 | || A/A+G/A | 68 | 52.7 | 48 | 67.6* | 56 | 68.3** | 0.04* 0.025** OR 0.52 CI 0.29–0.92 | || Total | 129 | 100 | 71 | 100 | 82 | 100 | ||| Alleles | A | 84 | 32.6 | 58 | 40.8 | 69 | 42.1 | || G | 174 | 67.4 | 84 | 59.2 | 95 | 57.9 | 0.048 | || rs2228570 (FokI) | Genotypes | C/C | 37 | 28.7 | 28 | 39.4 | 22 | 26.8 | | C/T | 59 | 45.7 | 29 | 40.9 | 39 | 47.6 | ||| T/T | 33 | 25.6 | 14 | 19.7 | 21 | 25.6 | >0.05 | || Total | 129 | 100 | 71 | 100 | 82 | 100 | ||| Alleles | С | 133 | 51.6 | 85 | 59.9 | 83 | 50.6 | || Т | 125 | 48.4 | 57 | 40.1 | 81 | 49.4 | >0.05 | || rs731236 (TaqI) | Genotypes | T/T | 64 | 49.6 | 23 | 32.4 | 33 | 40.3 | | T/t | 51 | 39.5 | 38 | 53.5 | 37 | 45.1 | ||| t/t | 14 | 10.9 | 10 | 14.1 | 12 | 14.6 | >0.05 | || T/t+t/t | 65 | 50.4 | 48 | 67.6 | 49 | 59.7 | 0.017 | || Total | 129 | 100 | 71 | 100 | 82 | 100 | ||| Alleles | T | 179 | 69.4 | 84 | 59.2 | 103 | 62.8 | || t | 79 | 30.6 | 58 | 40.8 | 61 | 37.2 | <0.05 | Note. Values are presented in bold if statistically significant differences were revealed upon comparison. The study revealed a significantly increased frequency of occurrence of the t-allele of the rs731236 (TaqI) polymorphism of the VDR gene in the group of female patients with type 1 DM (p < 0.05). Combinations of genotypes T/t + t/t of the rs731236 (TaqI) polymorphism of the VDR gene in patients with type 1 DM were significantly noted more often than in the group of patients with EGE (p = 0.017).

Discussion

Only a few studies are currently focused on the analysis of VDR gene polymorphism in patients with EGE. A group of Brazilian scientists suggested that genetic alterations in the VDR gene could lead to significant defects in gene activation and thus affect immune function. The authors investigated the possible relationship between endometriosis and/or infertility and VDR gene polymorphisms (ApaI, TaqI, FokI, and BmsI). Study results indicate that the VDR gene polymorphism does not play an important role in the pathogenesis of endometriosis and/or infertility in the studied Brazilian women [18]. Another work of this group of authors assessed the frequencies of the FokI polymorphism of the VDR gene in infertile women with endometriosis and its relationship with the disease. Study results showed that the FokI polymorphism of the VDR gene is not associated with infertility caused by endometriosis in Brazilian women [19]. A group of Polish scientists, investigating the genetic risk factors for infertility associated with endometriosis, revealed that the frequencies of genotypes and alleles did not differ significantly in the main and control groups, but the A-T (BmsI-FokI) haplotype (OR 1.659 [1.122–2.453], p = 0.011) of the VDR gene was identified as a risk factor for infertility associated with endometriosis [20]. Our study established that the G/G genotype of the rs1544410 (BsmI) polymorphic variant of the VDR gene increases the risk of EGE by 1.9 times. According to the literature data, the A allele of this polymorphism is associated with increased expression of the VDR gene and increases the serum level of the active hormonal form of vitamin D, calcitriol, compared with variant G [21]. In addition, variant G predominates among patients with EGE, which is probably associated with decreased gene expression and serum calcitriol levels. This fact may be important when choosing the dose of the drug for this category of patients. Our study found a significantly increased frequency of occurrence of the t-allele of the rs731236 (TaqI) polymorphism of the VDR gene in the group of patients with type 1 DM (p f (rs10753810), Bsm I B > b (rs1544410), Apa I A > an (rs7975232), and Taq I T > t (rs731236) in the VDR gene and type 1 DM in children. The BsmI B and ApaI A polymorphisms were associated with the risk of type 1 DM. Deficient vitamin D was registered more often in patients with DM. When vitamin D was added to standard insulin therapy, a significant improvement in the glycemic profile was noted. O.A. Sahin et al. [23] analyzed 9 studies that included 1,053 pediatric patients with type 1 DM and the control group consisted of 1,017 children without DM. The results showed that the BsmI BB, BsmI Bb, and TaqI tt polymorphisms were associated with an increased risk of type 1 DM, whereas such polymorphic variants as BsmI Bb and TaqI tt, contrarily, were associated with a protective effect on the disease development. The meta-analysis and systematic review, which combined 40 studies, aimed to assess the associations between polymorphisms FokI (rs2228570), TaqI (rs731236), BsmI (rs1544410), and ApaI (rs7975232) of the VDR gene and the predisposition to the development of type 1 DM. The authors failed to identify a significant relationship between the VDR gene SNP and the risk of type 1 DM in the population [24]. However, when analyzing these associations in various subgroups, a significant association was found between the FokI and BsmI polymorphisms and the risk of type 1 DM in the African and American populations. Polymorphisms of genes that are involved in the synthesis of vitamin D and encode its hydroxylases, VDBR and VDR, can increase the risk of developing type 1 DM. Therefore, an extension study is required to assess their influence on vitamin D status and its effects. This will identify the groups of patients who need higher doses of vitamin D to achieve the desired target serum 25(OH)D values to prevent and treat type 1 DM. Further studies of VDR, in addition to genetic and traditional risk factors for the development of type 1 DM, will make it possible to identify new critical factors that can be further applied in personalized medicine for diagnosis and more optimized and higher quality treatment of such patients. Thus, the obtained data are important for assessing the risk of developing EGE and type 1 DM and developing new strategies for the prevention and treatment of these diseases; however, further research is required in this field. ADDITIONAL INFORMATION Funding. The study was conducted within the fundamental scientific research works АААА-А19-119030490009-6, АААА-А19- 119030490046-1. Conflict of interest. The authors declare no conflict of interest. Author contributions. T.E. Ivaschenko and M.I. Yarmolin skaya created the concept and design, wrote and edited the text. A.S. De nisova, A.A. Shagina, and E.V. Misharina collected and processed material. T.E. Ivaschenko and A.S. Denisov processed the statistical data. A.S. Denisova and E.V. Misharina wrote the text. About the authors Aleksandra Denisova Research Institute of Obstetrics, Gynecology and Reproductology named after D.O. Ott Email: [email protected] ORCID iD: 0000-0003-3607-2420 MD Russian Federation, 3 Mendeleevskaya Line, Saint Petersburg, 199034Tatyana E. Ivaschenko Research Institute of Obstetrics, Gynecology and Reproductology named after D.O. Ott Email: [email protected] ORCID iD: 0000-0002-8549-6505 Scopus Author ID: 7004724202 Dr. Sci. (Biol.), Professor Russian Federation, 3 Mendeleevskaya Line, Saint Petersburg, 199034Maria I. Yarmolinskaya Research Institute of Obstetrics, Gynecology, and Reproductology named after D.O. Ott; North-Western State Medical University named after I.I. Mechnikov Email: [email protected] ORCID iD: 0000-0002-6551-4147 SPIN-code: 3686-3605 Scopus Author ID: 7801562649 ResearcherId: P-2183-2014 MD, Dr. Sci. (Med.), Professor, Professor of the Russian Academy of Sciences Russian Federation, Saint Petersburg; Saint PetersburgAnna A. Shagina Medical Genetic Diagnostic Center Email: [email protected] ORCID iD: 0000-0002-2276-6803 Russian Federation, Saint Petersburg Elena V. Misharina Research Institute of Obstetrics, Gynecology and Reproductology named after D.O. Ott Author for correspondence. Email: [email protected] ORCID iD: 0000-0002-0276-7112 MD, Cand. Sci. (Med.) Russian Federation, 3 Mendeleevskaya Line, Saint Petersburg, 199034References - Bukhalko MA, Skripchenko NV, Skripchenko EYu, Imyanitov EN. Significance of gene polymorphism of vitamin D receptor in human pathology. Rossijskij vestnik perinatologii i pediatrii. 2017;62(6):23–28. doi: 10.21508/1027-4065-2017-62-6-23-28 - Ahn SH, Singh V, Tayade C. Biomarkers in endometriosis: challenges and opportunities. Fertil Steril. 2017;107(3):523–532. doi: 10.1016/j.fertnstert.2017.01.009 - Jarmolinskaja MI, Ajlamazjan JeK. Genital’nyj jendometrioz: Razlichnye grani problem. Saint Petersburg: Jeko-Vektor; 2017. - Mariani M, Viganò P, Gentilini D, et al. The selective vitamin D receptor agonist, elocalcitol, reduces endometriosis development in a mouse model by inhibiting peritoneal inflammation. Hum Reprod. 2012;27(7):2010–2019. doi: 10.1093/humrep/des150 - Yildirim B, Guler T, Akbulut M, et al. 1–Alpha, 25–Dihydroxyvitamin D3 regresses endometriotic implants in rats by inhibiting neovascularization and altering regulation of matrix metalloproteinase. Postgraduate medicine. 2014;126(1):104–110. doi: 10.3810/pgm.2014.01.2730 - Abbas MA, Taha MO, Disi AM, et al. Regression of endometrial implants treated with vitamin D3 in a rat model of endometriosis. Eur J Pharmacol. 2013;715(1–3):72–75. doi: 10.1016/j.ejphar.2013.06.016 - Yarmolinskaya MI, Denisova AS, Andreeva NYu. The effectiveness of vitamin d (cholecalciferol) in the treatment of surgically induced endometriosis in rats. Rossijskij vestnik akushera-ginekologa. 2019;19(3):37–42. doi: 10.17116/rosakush20191903137 - Lasco A, Catalano A, Benvenga S. Improvement of primary dysmenorrhea caused by a single oral dose of vitamin D: results of a randomized, double-blind, placebo-controlled study. Arch Intern Med. 2012;172(4):366–367. doi: 10.1001/archinternmed.2011.715 - Almassinokiani F, Khodaverdi S, Solaymani-dodaran M, et al. Effects of vitamin D on endometriosis-related pain: a double-blind clinical trial. Med Sci Monitor. 2016;22:4960. doi: 10.12659/MSM.901838 - Giampaolino P, Corte LD, Foreste V, et al. Is there a relationship between vitamin D and endometriosis? An overview of the literature. Curr Pharm Des. 2019;25(22):2421–2427. doi: 10.2174/1381612825666190722095401 - Patent RUS No. 2711658/ 20.01.2020. MPK A61K8/67, A61K31/593, A61R15/00. Byul. No. 2. Jarmolinskaja MI, Denisova AS. Sposob lechenija naruzhnogo genital’nogo jendometrioza: No. 20191113822. - Cooper JD, Smyth DJ, Walker NM, et al. Inherited variation in vitamin D genes is associated with predisposition to autoimmune disease type 1 diabetes. Diabetes. 2011;60:1624–1631. doi: 10.2337/db10-1656 - Bailey R, Cooper JD, Zeitels L, et al. Association of the vitamin D metabolism gene CYP27B1 with type 1 diabetes. Diabetes. 2007;56:2616–2621. doi: 10.2337/db07-0652 - Hussein AG, Mohamed RH, Alghobashy AA. Synergism of CYP2R1 and CYP27B1 polymorphisms and susceptibility to type 1 diabetes in Egyptian children. Cell. Immunol. 2012;279:42–45. doi: 10.1016/j.cellimm.2012.08.006 - Norris JM, Lee HS, Frederiksen B, et al. Plasma 25-hydroxyvitamin D сoncentration and кisk of шslet фutoimmunity. Diabetes. 2018;67:146–154. doi: 10.2337/db17-0802 - Tapia G, Mårild K, Dahl SR, et al. Maternal and newborn vitamin D-binding protein, vitamin D levels, vitamin D receptor genotype, and childhood type 1 diabetes. Diabetes Care. 2019;42:553–559. doi: 10.2337/dc18-2176 - Habibian N, Amoli MM, Abbasi F, et al. Role of vitamin D and vitamin D receptor gene polymorphisms on residual beta cell function in children with type 1 diabetes mellitus. Pharmacological Reports. 2019;71:282–288. doi: 10.1016/j.pharep.2018.12.012 - Vilarino FL, Bianco B, Lerner TG, et al. Analysis of vitamin D receptor gene polymorphisms in women with and without endometriosis. Human Immunology. 2011;72(4):359–363. doi: 10.1016/j.humimm.2011.01.006 - Vilarino FL, Bianco B, Christofolini DM, et al. Analysis of VDR gene polymorphism Fok1 in infertile women with endometriosis. Revista Brasileira de Ginecologia e Obstetrícia. 2011;33(2):65–69. doi: 10.1590/S0100-72032011000200002 - Szczepańska M, Mostowska A, Wirstlein P, et al. Polymorphic variants in vitamin D signaling pathway genes and the risk of endometriosis-associated infertility. Molecular medicine reports. 2015;12(5):7109–7115. doi: 10.3892/mmr.2015.4309 - Naimi ZMS, Kalinina EA, Donnikov AE, Dudarova AKh. Association of vitamin D receptor (VDR) gene polymorphism with embryological characteristics and effectiveness of in vitro fertilization programs. Obstetrics and Gynecology. 2017;2:51–57. doi: 10.18565/aig.2017.2.51-7 - Ahmed AE, Sakhr HM, Hassan MH, et al. Vitamin D receptor rs2228570, rs731236 and rs1544410 single nucleotide polymorphisms, and 25-hydroxyvitamin D levels in Egyptian children with type 1 diabetes mellitus: effect of vitamin D co-therapy. Diabetes Metab Syndr Obes. 2019;14(12):703–716. doi: 10.2147/DMSO.S201525 - Sahin OA, Goksen D, Ozpinar A, et al. Association of vitamin D receptor polymorphisms and type 1 diabetes susceptibility in children: a meta-analysis. Endocr Connect. 2017;6(3):159–171. doi: 10.1530/EC-16-0110 - Zhai N, Bidares M, Hassanzadeh M, et al. Vitamin D receptor gene polymorphisms and the risk of the type 1 diabetes: meta-regression and updated meta-analysis. BMC Endocrine Disoders. 2020;20:121–135. doi: 10.1186/s12902-020-00575-8.

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: oa-doi-fallback

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Condition tags

endometriosis

Citation neighborhood

Papers in the corpus that this work cites (lower rings, blue) and that cite this one (upper rings, green). Dot size scales with the paper's in-corpus citation count — bigger dot = more influential within the endo/adeno field. Click a dot to open that paper. [ expand to 2 hops ] — adds papers reached through this work's immediate citers/citees. Heavier; up to 60 extra dots.

References (23)

Cited by (1)

Source provenance

openalex
last seen: 2026-06-10T17:14:06.276822+00:00
License: CC0 · commercial use OK