Knockdown of lncRNA H19 suppresses endometriosis in vivo

article OA: gold CC0 ⤵ 8 in-corpus citations
AI-generated summary by gemini-2.5-flash-lite, 2026-07-11

This study demonstrated that knockdown of lncRNA H19 in ectopic endometrial stromal cells reduced the size and weight of endometriotic implants in a nude mouse model.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

AI-generated deep summary by claude@2026-07, 2026-07-11 · read from full text

This study investigated whether knocking down the lncRNA H19 would suppress endometriosis in vivo using ectopic endometrial stromal cells from four patients with histologically confirmed endometriosis. Researchers infected ecESCs with lentiviruses expressing either lncRNA H19 shRNA or a negative control, then subcutaneously implanted the cells into nude mice and monitored lesion growth over four weeks; they also measured lncRNA H19 levels in the resulting lesions. Compared with the negative control, LV-H19-shRNA significantly reduced lesion size and decreased lncRNA H19 expression across the study period, with all lesions showing typical glandular and stromal structures. A key limitation is that the model uses xenotransplanted ecESCs in a subcutaneous setting rather than a more physiologically complete endometriosis model, and the human tissue source was small (n=4 patients). This paper is centrally about endometriosis — specifically, it tests lncRNA H19 knockdown to suppress ectopic lesion growth in vivo.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

The long noncoding RNA (lncRNA) H19 is involved in the pathogenesis of endometriosis by modulating the proliferation and invasion of ectopic endometrial cells in vitro, but related in vivo studies are rare. This study aimed to investigate the role of lncRNA H19 in a nude mouse model of endometriosis. Ectopic endometrial stromal cells (ecESCs) were isolated from ectopic endometrium of patients with endometriosis and infected with lentiviruses expressing short hairpin RNA (shRNA) negative control (LV-NC-shRNA) or lncRNA-H19 shRNA (LV-H19-shRNA). The ecESCs infected with LV-NC-shRNA and LV-H19-shRNA were subcutaneously implanted into forty 6- to 8-week-old female nude mice. The size and weight of the endometriotic implants were measured at 1, 2, 3, and 4 weeks after implantation and compared, and lncRNA H19 levels in endometriotic implants were evaluated using real-time polymerase chain reaction (RT-PCR). All nude mice survived the experimental period, and no significant differences in body weight were observed between the experimental group and the control group. All nude mice developed histologically confirmed subcutaneous endometriotic lesions with glandular structures and stroma after 1 week of implantation. The subcutaneous lesions in the LV-NC-shRNA group after 1, 2, 3, and 4 weeks of implantation were larger than those in the LV-H19-shRNA group, and lncRNA H19 levels in subcutaneous lesions in the LV-NC-shRNA group were significantly higher than those in the LV-H19-shRNA group. Knockdown of lncRNA H19 suppresses endometriosis in vivo. Further study is required to explore the underlying mechanism in the future.
Full text 14,505 characters · extracted from pmc-nxml · 4 sections · click to expand

Intro

Endometriosis is a prevalent gynecological disorder that affects 10-15% of women of reproductive age ( 1 , 2 ). It is defined as the presence and growth of endometrial tissue outside of the uterine cavity and often causes chronic pelvic pain, infertility, menstrual disorders, and pelvic masses ( 3 – 5 ). Endometriosis is a benign disorder but has a high recurrence rate after treatment ( 6 ) and may develop into ovarian endometrioid and clear cell cancer ( 7 , 8 ). Although a number of studies have been carried out to understand the etiology of endometriosis, its detailed pathogenesis remains unclear ( 9 – 13 ). Long noncoding RNAs (lncRNAs) are a group of noncoding single-stranded RNAs with more than 200 nucleotides that participate in biological processes, including cell proliferation, differentiation, chromosome remodeling, epigenetic regulation, transcription, and posttranscriptional modification ( 14 , 15 ). In recent years, many studies have focused on defining the regulatory functions of lncRNAs and found that lncRNAs play important roles in the pathogenesis of many diseases ( 16 – 19 ). However, there are few reports on the involvement of lncRNAs in endometriosis. In our prior study, we analyzed the endometrial transcriptome in patients with endometriosis using RNA sequencing technology and found that lncRNA H19 had the highest upregulation in both ectopic and eutopic endometrium ( 20 ). Further study showed that downregulation of lncRNA H19 could inhibit ectopic endometrial cell proliferation and invasion by modulating miR-124-3p and ITGB3 in vitro ( 21 ). These studies provide insight into the role of lncRNA H19 in the pathogenesis of endometriosis; however, the function of lncRNA-H19 in endometriosis was not further verified in vivo . In this study, lentiviruses carrying short hairpin RNA (shRNA) negative control (LV-NC-shRNA) or lncRNA H19 shRNA (LV-H19-shRNA) were generated and used to knock down lncRNA H19 levels in ectopic endometrial stromal cells (ecESCs). EcESCs infected with LV-NC-shRNA and LV-H19-shRNA were subcutaneously implanted into female nude mice, after which subcutaneous lesions were observed, and lncRNA H19 levels in lesions were determined. Our study is the first to demonstrate the function of lncRNA H19 in endometriosis in vivo .

Results

As shown in Figure 1 , immunocytochemical results of vimentin staining confirmed that the isolated cells were ecESCs, and the purity was higher than 90%. As shown in Figure 2 , infection of ecESCs from 4 patients with LV-H19-shRNA led to decreased lncRNA H19 expression. The results suggested that LV-H19-shRNA transduction knocked down lncRNA H19 in ecESCs. All nude mice survived the experimental period, and no significant differences in body weight were observed between the experimental group and control group. All nude mice developed histologically confirmed subcutaneous endometriotic lesions with glandular structures and stroma after 1 week of implantation. The results suggested that xenotransplantation of the human ectopic endometrium can be used to establish mouse models of endometriosis for endometriosis research. As shown in Figure 3 , the subcutaneous lesions in the LV-NC-shRNA group after 1, 2, 3, and 4 weeks of implantation were all larger than those in the LV-H19-shRNA group (P<0.001). As shown in Figure 4 , the lncRNA-H19 levels in subcutaneous lesions in the LV-NC-shRNA group were significantly higher than those in the LV-H19-shRNA group (P<0.001). The results suggested that downregulation of lncRNA H19 inhibited the tumorigenicity of ecESCs in subcutaneous implants in nude mice, and knockdown of lncRNA H19 suppressed endometriosis in vivo .

Discussion

lncRNA H19 is a maternally expressed imprinted gene, and is one of the earliest discovered and widely studied lncRNAs. lncRNA H19 has been shown to play important roles in many research fields. Studies of lung adenocarcinoma have reported that in vitro , lncRNA H19 silencing suppresses cell proliferation, sphere-forming ability, apoptosis, migration, and invasion and inhibits the epithelial-mesenchymal transition process, and in vivo , it also results in suppressed tumorigenicity ( 24 ). lncRNA H19 overexpression significantly promotes breast cancer cell clonogenicity, migration, and mammosphere-forming ability, while lncRNA H19 knockdown markedly inhibits tumor growth and suppresses tumorigenesis in nude mice. Mechanistically, lncRNA H19 acts as a competing endogenous RNA to sponge miRNA let-7, leading to an increase in the expression of LIN28 ( 25 ). However, there are few studies on the role of lncRNA H19 in endometriosis. A previous study reported that decreased lncRNA H19 expression increases miRNA let-7 activity by acting as a molecular sponge and then reduces the proliferation of endometrial stromal cells via insulin-like growth factor (IGF) signaling in eutopic endometrium of women with endometriosis, which may contribute to impaired endometrial receptivity for implantation and is associated with infertility ( 26 ). Another study showed that alterations in the lncRNA H19/miR-216a-5p/ACTA2 pathway affect the invasion and migration of eutopic endometrial stromal cells and contribute to fibrous tissue formation or fibrosis in women with endometriosis. Furthermore, endometriosis is considered an estrogen-dependent disorder, and this signaling pathway has been confirmed to be regulated by estrogen ( 27 ). However, most of the existing studies focus on the eutopic endometrium, while few studies on ectopic endometrium have been carried out. Our prior study indicated that in the ectopic endometrium of women with endometriosis, downregulation of lncRNA H19 inhibits the proliferative and invasive abilities of stromal cells through modulation of miR-124-3p and ITGB3 expression ( 21 ). Furthermore, knockdown of lncRNA H19 has been demonstrated to suppress tumorigenesis in vivo ( 24 , 25 ). Consistent with these reports, the present study also indicated that knockdown of lncRNA H19 suppressed endometriosis in nude mice. Our findings represent the first example of a function of lncRNA H19 in endometriosis in vivo and thus have implications for the pathogenesis and treatment of endometriosis. However, further studies of lncRNA H19-based mechanisms in vivo are needed in the future. There were also some limitations that need to be addressed: 1) due to time and funding constraints, this study had a relatively small sample size; more in-depth study with a larger sample size is needed to confirm the conclusion; and 2) a nude mouse model of endometriosis was established by subcutaneous injection, and the lesions were easily observed, but the model generated by intraperitoneal injection was more similar to the endometriosis phenotype observed in humans. In the future, an intraperitoneal model could be established for further verification.

Materials|Methods

Ectopic endometrium samples were collected in September 2018 from 4 patients who had histological evidence of endometriosis. Four patients aged 25-34 years had ovarian cysts that persisted for more than 3 months and were larger than 4 cm in diameter. Surgery was used as the initial treatment, and none of the patients had received hormonal therapy for at least 6 months prior to surgery. All patients had regular menstrual cycles and underwent laparoscopic cystectomy in the late proliferative phase. The clinical characteristics of the patients are shown in Table 1 . Institutional review board approval was obtained from Zhenjiang Maternal and Child Health Hospital (No. 20161204), and all patients provided informed consent for the investigation and experiments. Animal studies were reported in compliance with the ARRIVE guidelines ( 22 ), and all animal care procedures were followed in accordance with the guidelines set by the European Communities Council Directive (86/609/ EEC). Table 1 Clinical characteristics of the patients with endometriosis. Characteristics Patient 1 Patient 2 Patient 3 Patient 4 Age, years 25 29 26 34 Gravidity, n 1 0 1 2 Parity, n 0 0 1 1 BMI, kg/m 2 22.6 21.4 22.8 24.7 Dysmenorrheal Present Absent Absent Present Dyspareunia Absent Present Absent Absent Infertility Present Present Absent Absent CA125 level (U/mL) 86.4 137.1 34.2 65.9 rAFS stage III IV III III DIE status Absent Absent Absent Absent BMI: body mass index; rAFS: revised American Fertility Society; DIE: deep infiltrating endometriosis. BMI: body mass index; rAFS: revised American Fertility Society; DIE: deep infiltrating endometriosis. Fresh endometriotic tissues were collected during the laparoscopies and washed twice with sterile phosphate-buffered saline (PBS) to remove blood and clots. The cyst walls were minced into 3-5 mm pieces and incubated with 0.25% collagenase type IV (Sigma-Aldrich, USA) in a water bath at 37°C for 90 min. EcESCs were obtained by filtering with a 40-μm monofilament nylon mesh. The digestion and filtration steps were repeated 3 times, and the collected ecESC suspension was centrifuged at 300 g for 10 min at 25 o C. EcESCs were grown in high glucose Dulbecco's modified Eagle medium containing 10% fetal bovine serum (Gibco, USA) and 1% antibiotic (Beijing Solarbio Science & Technology, China). The cells were cultured in a Thermo Forma 3111 incubator (Thermo Fisher Scientific, USA) at 37°C with 5% CO 2 , and the medium was replaced every two days. Immunocytochemical staining for vimentin was performed in the isolated cells to confirm their ecESC phenotype. EcESCs cultured on slides were fixed with 95% alcohol and incubated with 1:50 diluted primary mouse anti-human vimentin antibody (Boster, China) for 3 h at room temperature. After being washed with PBS 3 times, the slides were incubated with horseradish peroxidase-labeled goat anti-mouse secondary antibody (Boster) for 30 min at room temperature. The slides were stained with DAB and counterstained with hematoxylin. Finally, the slides were digitally imaged. In our previous study ( 21 ), three shRNA interference sequences targeting lncRNA H19 were synthesized and inserted into the AgeI-EcoRI site of the pLKO.1-Puro vector. EcESCs were infected with lentiviruses containing H19 shRNA (shH19-1, shH19-2, or shH19-3) or shRNA negative control (shNC), and real-time polymerase chain reaction (RT-PCR) and western blot assays showed that the expression of shH19 in ecESCs led to decreased lncRNA H19 expression, with shH19-1 and shH19-2 showing the highest efficiency. In this study, shH19-1 ( Table 2 ) was selected, and pLKO.1-Puro-lncRNA-H19 shRNA or pLVX-Puro-FKBP3 was co-transfected into 293T cells with the viral packaging plasmids psPAX2 and pMD2.G (Addgene, USA) using Lipofectamine 2000 (Invitrogen, USA). After incubation for 48 h, viral particles were collected by ultracentrifugation. LV-H19-shRNA was used to infect ecESCs to knock down the expression of lncRNA H19, and the transduction efficiency of LV-H19-shRNA was evaluated using an RT-PCR assay. Table 2 lncRNA H19 interference sequences. Name Sequence (5′ to 3′) H19-shRNA(2357-2375) CCAAGTAGGGACAACCCTT H19-shRNA-Forward CCGGTCCAAGTAGGGACAACCCTTCTCGAGAAGGGTTGTCCCTACTTGGTTTTTG H19-shRNA-Reverse AATTCAAAAACCAAGTAGGGACAACCCTTCTCGAGAAGGGTTGTCCCTACTTGGA H19-shRNA: lncRNA H19 short hairpin RNA. H19-shRNA: lncRNA H19 short hairpin RNA. Studies were conducted on 40 adult female nude mice (6-8 weeks old, 18-22 g) (Animal Experiment Center of Jiangsu University, Jiangsu University, China). Mice were raised in a specific pathogen-free (SPF) laminar flow cabinet with regulated 12-h light/dark cycles, at 23-25°C. Mice had free access to food and water and underwent a 2-week period of acclimation to the environment before the experiment. A nude mouse model of endometriosis was established according to a published paper ( 23 ). When infected ecESCs in good condition grew to 80-90% confluence, the cell concentration was adjusted to 1×10 8 cells/mL after digestion and resuspension. The 40 nude mice were randomly divided into two groups, and the 20 nude mice in the experimental group were implanted with LV-H19-shRNA-infected ecESCs. The 20 nude mice in the control group were implanted with LV-NC-shRNA-infected ecESCs. On day 0, 0.2 mL of cell suspension was injected subcutaneously into the left subaxillary regions of the 40 nude mice. After implantation, we monitored the condition of all the nude mice, the responses to external stimulation, the infection at the implantation site, and the growth of subcutaneous masses daily. The subcutaneous mass size (in mm 3 ) was determined by caliper measurements performed every week and calculated by using the following formula: volume=length×width 2 ×0.5. Five nude mice were sacrificed by cervical dislocation every week for 4 continuous weeks (on days 7, 14, 21, 28), and the subcutaneous masses were removed, weighed by electronic scale, and imaged. lncRNA-H19 levels were determined using RT-PCR. All procedures were performed under isoflurane anesthesia. The tail of each mouse was marked using nontoxic permanent markers, and researchers were blinded to the treatment groups. All mice were euthanized with an anesthetic overdose at the end of the experiment. RT-PCR was performed to determine lncRNA H19 expression. TRIzol reagent (Invitrogen) was used to isolate total RNA from ecESCs or endometriotic implants. One microgram of RNA was reverse transcribed into cDNA with a reverse transcription kit (Fermentas, USA). Quantitative RT-PCR analysis was carried out with a SYBR Green PCR kit (Thermo Fisher Scientific) on the ABI-7300 Real-time PCR system (Applied Biosystems, USA) under the following conditions: 95°C for 10 min; 40 cycles of 95°C for 15 s and 60°C for 45 s; 95°C for 15 s; 60°C for 1 min; 95°C for 15 s; and 60°C for 15 s. The sequences of all primers are shown in Table 3 . GAPDH was used as an internal reference for the normalization of lncRNA H19 expression data. The data were analyzed by the 2 -ΔΔCt relative expression method. Table 3 Primer sequences used in real-time polymerase chain reaction assays. Name Sequence (5′ to 3′) lncRNA-H19 Forward GCGGGTCTGTTTCTTTACTTCC Reverse CTTTGATGTTGGGCTGATGAGG GAPDH Forward AATCCCATCACCATCTTC Reverse AGGCTGTTGTCATACTTC The data are reported as means±SD. GraphPad Prism 7.0 software (GraphPad Software, Inc., USA) was used to analyze the data. The statistical significance between the two groups was tested by the Student's t -test. A P value <0.05 was considered to be statistically significant.

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: pmc-nxml

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Condition tags

endometriosis

MeSH descriptors

Endometriosis Endometriosis RNA, Long Noncoding RNA, Long Noncoding Animals Cell Proliferation Cell Proliferation Endometrium Female Humans Mice Mice, Nude RNA, Small Interfering RNA, Small Interfering

Citation neighborhood

Papers in the corpus that this work cites (lower rings, blue) and that cite this one (upper rings, green). Dot size scales with the paper's in-corpus citation count — bigger dot = more influential within the endo/adeno field. Click a dot to open that paper. [ expand to 2 hops ] — adds papers reached through this work's immediate citers/citees. Heavier; up to 60 extra dots.

References (27)

Cited by (8)

Source provenance

europepmc
last seen: 2026-09-19T06:15:14.566301+00:00
openalex
last seen: 2026-06-10T17:14:06.276822+00:00
pubmed
last seen: 2026-05-13T22:24:49.034193+00:00
License: CC0 · commercial use OK