Loss of PRICKLE1 leads to subfertility, aberrant extracellular matrix and abnormal myometrial architecture in mice

Using Prickle1 f/+ ES cells from EUCOMM ( Prickle1tm1a(EUCOMM)Wtsi) , we developed Prickle1 f/f mice and utilized our myometrial-specific Cre from the proximal promoter from the rat calbindin-D9K (CaBP9K) promotor (MiC) ( Cloud et al., 2022 ) to conditionally ablate Prickle1 in the mouse myometrium ( Figure 1 A - C ). Upon Prickle1 ablation, we observed significant changes in the uterus, including altered tissue architecture in the myometrium and the formation of fibrotic structures within the endometrium ( Figure 1 D - H ). Furthermore, we noted a decrease in fertility in the cKO, consistent with a UL phenotype ( Makker and Goel, 2013 ) ( Figure 1 I ). These changes were accompanied by alterations in ECM components, including a reduction in COL1A1 immunofluorescent staining ( Figure 1 J - N ), an increase in COL4A1 immmunohistochemistry staining ( Supplementary Figure 1 ), and an increase in Col4a1 , Col4a2 , and Col6a3 RNA expression in the cKO, consistent with the UL phenotype of increased collagen deposition ( Maekawa et al., 2013 ) ( Figure 1 O ). Additionally, immunofluorescent staining of alpha-smooth muscle actin (αSMA) showed increased expression in addition to circular myometrial smooth muscle cell altered organization into bundles in the cKO rather than a parallel organization, as seen in the control ( Figure 1 P - S ). Since UL is known to be associated with altered expression of genes involved in TGF-β signaling, decreased dermatoponin ( Dpt ), and altered alpha-smooth muscle actin ( Acta2 ) ( Arici and Sozen, 2000 , Catherino et al., 2004 , Wolanska et al., 1998 ) we performed TaqMan RT-qPCR to test the expression of Dpt, Acta2, and Tgfb3. Results from 6-month-old control and cKO mice indicated that cKO had significantly lower expression of Dpt and Acta2 with increased expression of Tgfb3 , consistent with UL phenotype ( Figure 1 T ). Western blot analysis of P13K-AKT/mTOR signaling pathway proteins indicated that this signaling cascade was not aberrantly activated in the cKO mice ( Supplementary Figure 2 ), a phenotype distinct from that of the Rest f/f Amhr2-cre cKO mouse model for UL in which REST is more widely deleted within the mesenchymal lineage ( Cloud et al., 2022 ). While alterations were seen from our analysis of the whole uterus, further understanding of individual cellular changes was pertinent. Therefore, to study the impact the loss of PRICKLE1 in the myometrium has on the whole uterus by cell type, single-cell RNA sequencing was performed on 6-month-old Prickle1 f/f MiC and Prickle1 f/f mice in diestrus ( GSE276991 ). The analysis identified 14 distinct clusters with differences in subpopulations between the control and the cKO ( Figure 2 A ). This analysis was performed at a resolution of 0.4, resulting in a few cell types being identified in multiple clusters. This includes several clusters of fibroblasts at this chosen resolution. However, we have not classified these fibroblasts as specifically stromal or myometrial. Based on our analysis, we need more information to specifically classify these fibroblasts at this time. Analysis of collagen expression by cell type demonstrated increased Col1a1 and Col6a3 expression in stromal clusters (clusters 1 and 5) and epithelial clusters (clusters 2 and 11) in the cKO compared to control ( Figure 2 B and C ). Violin plots demonstrated increased expression of Col3a1, Col4a1, Col4a2, and Col6a3 within the myometrial cluster (cluster 0) and stromal clusters (clusters 1 and 5) and increased Col1a1 expression within stromal clusters in the cKO compared to control ( Supplementary Figure 3 ). Further analysis demonstrated minimal alterations to REST target genes Gria2, Stmn2, and Mmp24 ( Supplementary Figure 4 ). Whereas Acta2 and Tgfb3, which are known to be overexpressed in UL, were increased within the myometrial cluster (cluster 0) in the cKO compared to control ( Supplementary Figure 4 ). In addition, increased expression of Esr1 and Pgr was seen in both myometrial cluster 0 and stromal clusters 1 and 5, with increased Esr1 expression seen in whole uterus samples, consistent with altered steroid hormone receptor expression seen in UL ( Bulun, 2013 , Borahay et al., 2015 ) ( Figure 2 D - F ). Ingenuity pathway analysis (IPA) of the myometrial cluster (cluster 0) indicated upstream regulators to include several forms of vitamin D3 and ML290, an allosteric agonist of the relaxin receptor RXFP1 ( Table 1 ). Rxfp1 expression is higher in fibroblast clusters 4 and 12 of the cKO compared to control ( Supplementary Figure 5 ). IPA also indicated dysregulation of genes involved in cellular functions of the myometrium (cluster 0), including collagen synthesis and degradation, endocrine system disorders, reproductive system disorders, skeletal and muscular disorders, and organ development ( Tables 2 , Supplementary Tables 1 and 2 ). IPA of stromal clusters 1 and 5 indicated dysregulation of genes involved in cell death and survival, molecular transport, organismal development and survival, development of carcinoma, advanced malignant tumor, and advanced stage tumor ( Supplementary Tables 3 - 6 ). Moreover, IPA of epithelial clusters 2 and 11 displayed dysregulation of genes involved in pulmonary fibrosis, hepatic fibrosis, reproductive system disease, endocrine system disease, cancer, and cell growth and proliferation ( Supplementary Tables 7 and 10 ). Due to PRICKLE1’s involvement in non-canonical Wnt/planar cell polarity (PCP) signaling, we performed a western blot analysis of whole uterus samples for both canonical and non-canonical Wnt signaling ( Figure 3 ). This analysis indicated that canonical Wnt signaling was not activated ( Figure 3 A and B ) even though the canonical Wnt signaling pathway activation is still highly debated in UL. The non-canonical Wnt/PCP signaling analysis showed that the pathway was not significantly affected by the loss of PRICKLE1, except for lower SCRIBBLE expression and increased PKC phosphorylation in the cKO compared to the control ( Figure 3 C - M ). This may be due to species-specific compensation from Prickle2 and Prickle3 , as evidenced by increased RNA expression within the cKO compared to control ( Supplementary Figure 6 ). However, when looking at specific cell types, there is strong evidence for dysregulation in Wnt signaling pathways. Violin plots from the single-cell RNA sequencing analysis indicated increased Dvl1 , Dvl2, Scrib, Nkd1, and Nkd2 expression in stromal clusters 1 and 5 with decreased expression within the epithelial clusters (clusters 2 and 11) in the cKO compared to control ( Figure 4 A - E ). Moreover, Vangl1, Vangl2, and Wnt5a expression were minimally altered with small decreases in epithelial clusters (clusters 2 and 11) and slight increases in stromal clusters (clusters 1 and 5) in the cKO compared to control ( Figure 4 F - H ). In addition to the altered cellular organization of the circular smooth muscle cells of the myometrium into bundles seen via αSMA staining ( Figure 1 P - R ), immunofluorescence staining for total actin displayed decreased levels of actin in addition to a similar alteration in organization in the cKO ( Figure 5 A - E ) Additionally, Picrosirius Red staining indicated alterations to collagen organization and increased collagen deposition levels in the cKO compared to the control ( Figure 5 F - J ), a hallmark of UL. The cKO showed collections of bundles of collagen fibers throughout the myometrium and stroma rather than parallel and longitudinal fibers, as seen within the control. In addition, IPA of the myometrium (cluster 0) included dysregulation of collagen chain trimerization, assembly of collagen fibrils, ECM organization, and tissue development, all of which indicate fibrosis ( Table 2 , Supplementary Tables 1 and 2 ). IPA of stromal clusters 1 and 5 indicated dysregulation of genes involved in cellular movement, cell death and survival, organismal development, connective tissue development and function, and tissue morphology ( Supplementary Tables 4 - 6 ). Moreover, IPA of epithelial clusters 2 and 11 displayed dysregulation of genes involved in ECM organization, integrin cell surface interactions, assembly of collagen fibrils, cellular movement, cell death and survival, cellular development, cellular growth and proliferation, cell-to-cell signaling, and tissue morphology ( Supplementary Tables 7 - 10 ).

Mouse embryonic stem cell clone harboring floxed Prickle1 ( Prickle1tm1a(EUCOMM)Wtsi, ES cell clones with floxed exon 6 with conditional knockout potential) was acquired from EuCOMM. The ES cells were used to generate chimeric founder mice, which were mated to C57BL6 WT mice to create heterozygous PRICKLE1 fl/+ mice. These mice were crossed with FLPo (Gt(ROSA)26Sor tm2(FLP*)Sor ) mice to remove FRT flanked βgal-neo sequences. These were bred together to obtain homozygous PRICKLE1 fl/fl mice, which were then crossed with transgenic myometrial-specific iCre (MiC) mice that we generated using the rat Calbindin D9K proximal promoter upstream of iCre, to produce PRICKLE1 cKO mice, specific to the myometrium ( Cloud et al., 2022 ). The mice were genotyped by PCR using primers for PRICKLE1 (5’GGTTTCATGTGTTGAGACATTTC) (5’GTATTTCTGTGCCCTTTTTGTCGTCG) (5’TGAACTGATGGCGAGCTCAGACC) as well as primers for MiC (5’CCACTAATGCTGTTCCGACCTGTC) (5’GGTGATGAGGAGAATCAGAAAGG) (5’CATCCTTGGCACCATAGATCAG). All animal procedures were performed per the Guide for Care and Use of Laboratory Animals, approved by the National Institute of Health (NIH), and followed an KUMC IACUC-approved animal study proposal. Uterine tissues were fixed in 4% paraformaldehyde for 24 hours and then processed for paraffin embedding. Tissues were deparaffinized in xylene and rehydrated in a series of ethanol washes and either stained for Hematoxylin and Eosin (H&E), immunofluorescence, or picrosirius red. For immunofluorescence staining, antigen retrieval was performed following rehydration by boiling in antigen unmasking solution (Vector Labs, Cat# H-3301). Following antigen retrieval, tissues were stained with primary antibodies anti-Col1a1 (Novus Biologicals, Cat# NB600-594SS, 1:100), anti-αSMA (Millepore, Cat# MABT381, 1:1000), anti-actin (Santa Cruz Biotechnology, Cat# sc-1616, 1:500), and DAPI. Alexa Fluor 488 secondary antibody was used for all immunofluorescence staining (Jackson Research Laboratories, Cat# 711-545-152, 1:200). Picrosirius red staining was performed via manufacture protocol within the kit (Polyscience Inc, Cat# 24901). All histological samples were imaged using a Nikon Eclipse 90i fluorescent microscope with Nikon Digital Sight color DS-Fi1 camera. Image analysis was performed using ImageJ to determine the corrected total cell fluorescence (CTCF) for 3 sections of 3 separate samples of 6-month-old cKO and controls in diestrus. Student’s nonparametric T-test was performed to determine statistical significance. Total RNA was isolated from uterine tissue samples stored in RNAlater (Invitrogen, Cat# AM7020) and then biopulvirized and placed into TRIzol Reagent (Invitrogen, Cat# 15596026). Following TRIzol, a series of chloroform, isopropanol, and ethanol washes were used to isolate the RNA. Following quantification using Nanodrop spectrophotometer, aliquots of RNA were reverse transcribed using High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, 4368814). TaqMan assays for Col1a1 (IDT, Mm.PT.47.9778198) , Col4a1 (IDT, Mm.PT.58.31838522) , Col4a2 (IDT, Mm.PT.58.28692624) , Col6a3 (IDT, Mm.PT.58.15781337) , Dpt (IDT, Mm.PT.47.17098032) , Acta2 (IDT, Mm.PT.47.7024949) , Tgfb3 (IDT, Mm.PT.47.10648587), Esr1 (IDT, Mm.PT.58.8025728), Pgr (IDT, Mm.PT.5810254276), Prickle1 (IDT, Mm.PT.58.43612140), Prickle2 (IDT, Mm.PT.58.13127366), and Prickle3 (IDT, Mm.PT.58.13792190) were used to quantify gene expression differences utilizing the delta delta C(T) method with housekeeping genes Rn18s (ThermoFisher Scientific, Mm03928990_G1) for 3 cKO and 3 control 6-month-old mice in diestrus. Female Prickle1 f/f and Prickle1 f/f mice were mated with Prickle1 f/f males to induce pregnancy. The morning of finding the vaginal plug was considered day 0.5 of pregnancy. Litter size analysis was tracked via number of pups born following positive vaginal plug formation at days 17-21. Student’s nonparametric T-test was performed to determine statistical significance. Frozen tissue samples were processed via biopulverization followed by sonication in Cell Lysis Buffer (Cell Signaling Technology, Cat# 9803) with protease and phosphatase inhibitor cocktails (ThermoFisher Scientific, Cat# P8340 and P0044). Samples were centrifuged at 18,000g at 4C for 15 minutes and the supernatant was collected. Protein was quantified using Bio-Rad Protein Assay Kit II (Bio-Rad, Cat# 50000002). 50 μg of protein was loaded with Laemmli buffer into 4-15% precast polyacrylamide gels (Bio-rad, Cat#5671083) and subjected to 130V for electrophoresis. Transfer onto a nitrocellulose membrane (ThermoFisher Scientific, Cat# 1620094) was performed at 4C for 1.5 hours at 70V. Membranes were blocked with 5% skim milk for 1 hour and incubated overnight at 4C with primary antibody. Primary antibodies included anti-mTOR (Cell Signaling Technology, Cat# 2983S, 1:1000), anti-AKT (Cell Signaling Technology, Cat# 9272S, 1:1000), anti-p-mTOR (Cell Signaling Technology, Cat# 2971S, 1:1000), anti-p-AKT (Cell Signaling Technology, Cat# 40605, 1:1000), anti-p-4EBP1 (Cell Signaling Technology, Cat# 94594, 1:1000), anti-p-P70S6 (Cell Signaling Technology, Cat# 42065, 1:1000), anti-LRP6 (Cell Signaling Technology, Cat# 3395S, 1:1000), anti-p-LRP6 (Cell Signaling Technology, Cat# 2568S, 1:500), anti-DVL1 (Sigma, Cat# D3570, 1:1000), anti-c-MYC (Cell Signaling Technology, Cat# 5605S, 1:1000), anti-DVL2 (Cell Signaling Technology, Cat# 3216S, 1:2000), anti-WNT3A (Cell Signaling Technology, Cat# C64F2, 1:1000), anti-SCRIBBLE (Cell Signaling Technology, Cat# 4475, 1:1000), anti-c-JUN (Cell Signaling Technology, Cat# 9165, 1:1000), anti-p-JNK (Santa Cruz Biotechnology, Cat# sc-6254, 1:1000), anti-p-PKC (Cell Signaling Technology, Cat# 9379S, 1:1000), anti-RAC1/2/3 (Cell Signaling Technology, Cat# 2465P, 1:1000), anti-RHOA (Cell Signaling Technology, Cat# 2117P, 1:1000), anti-WNT5A (Cell Signaling Technology, Cat# 2392, 1:1000), and anti-β-ACTIN (Genescript, Cat# A01865, 1:5,000). Following 3 washes, membranes were incubated at room temperature in anti-rabbit or anti-mouse IgG (Promega, Cat# W401B and W402B, 1:10,000) for 1 hour. Proteins were detected using SuperSignal West Pico PLUS Chemiluminescent Substrate (ThermoFisher Scientific, Cat# 34080). Blots were imaged using a BioRad Chemidoc MP imager. Western blot quantification was performed using ImageJ and normalized to loading controls for 3 cKO and 3 control 6-month-old mice in diestrus. Student’s nonparametric T-test was performed to determine statistical significance. Whole uteri of Prickle1 f/f MiC (n=3) and Prickle1 f/f (n=3) mice aged 6 months were isolated immediately following euthanasia using IACUCC approved methods and washed in cold 1X PBS. Uteri were digested as previously described ( Cloud et al., 2022 ), and samples were pooled following digestion. The KUMC genomics core processed and sequenced the cells as previously described ( Cloud et al., 2022 ). The Prickle1 f/f MiC sample had 4998 cells with 38799 mean reads and 1431 median genes per cell, while the Prickle1 f/f sample had 5426 cells with 43202 mean reads and 1098 median genes per cell. Both samples had high sequence saturation levels (> 60%) and the mapping rate of reads to the mouse genome (mm10) was > 90% for both samples. The data discussed in this publication have been deposited in NCBI's Gene Expression Omnibus and are accessible through GEO Series accession number GSE276991 . scRNA-sequencing libraries were generated using the 10x Chromium Single Cell 3' v3 chemistry (10x Genomics) and sequenced in an Illumina NovaSeq 6000 sequencing machine. The raw sequence reads were processed using the 10x Genomics Cellranger pipeline (v 6.1.1) to obtain UMI feature-barcode count matrices. Doublets were removed using DoubletFinder ( McGinnis et al., 2019 ) and cells filtered to contain only those cells with at least 500 UMIs and over 250 detected genes with a genes per UMI ratio greater than 0.8 and a mitochondrial gene ratio less than 20%. The resulting single-cell data was analyzed using the R software Seurat (v4), as previously described ( Sasaki et al., 2024 ). The analysis was performed at a 0.4 cluster resolution reasoned using the Clustree software ( Zappia and Oshlack, 2018 ) , giving 14 stable clusters. The cluster cell types were identified using the SingleR software ( Aran et al., 2019 ) and our expert curation as previously described ( Cloud et al., 2022 ). Annotations were based on the two reference datasets, ImmGenData from the Immunological Genome Project (ImmGen) ( Heng et al., 2008 ) and MouseRNAseqData ( Benayoun et al., 2019 ). All single cell expression data (feature counts) used in differential expression analysis and presented as figures in this manuscript are normalized (using the Seurat NormalizeData function, accounting for the variation in sequencing depth) and scaled (using the Seurat ScaleData function, to give a mean centered unit variance across cells) to facilitate comparative analysis. Biological, functional, and pathway analysis were performed using Ingenuity Systems Pathway Analysis software (IPA, QIAGEN, Germantown, MD) on the significantly (FC >1.5, p-value <0.05) differentially expressed genes between Prickle1 f/f MiC and Prickle1 f/f myometrial (cluster 0), stromal (clusters 1 and 5), and epithelial (clusters 2 and 11) cells.

A better understanding of the mechanisms affecting the pathogenesis of UL is critical to developing pharmacotherapies for treating UL. There is a vast need for better animal models of UL that encompass the various characteristics of UL. PRICKLE1, also known as Rest-interacting LIM-domain Protein (RILP), is a crucial component of the non-canonical Wnt/Planar Cell Polarity (PCP) signaling cascade ( Adler, 2012 , Butler and Wallingford, 2017 ). PCP proteins, and particularly PRICKLE1, have been understudied in the context of UL. Here, we developed a novel Prickle1 myometrial-specific conditional knockout mouse model that, at least in part, mimics UL phenotype and provides a better understanding of the role PCP plays in UL pathogenesis and uterine physiology. Our Prickle1 f/f MiC cKO mice showed fibrotic structures within the endometrium at 6 months old ( Figure 1 E and F ). Further investigation of these structures is necessary to determine their morphogenesis. However, these structures are not seen in the controls, and while their presence was rare within the cKO, excessive collagen expression and altered myometrial architecture phenotypes were consistently observed in all the cKO uterus samples. In addition, the Prickle1 f/f MiC cKO had a subfertile phenotype, consistent with a UL phenotype, and requires further investigation. Furthermore, alterations to collagen deposition and changes to ECM composition are characteristic of UL phenotype ( Walker and Stewart, 2005 , Maekawa et al., 2013 ). Our cKO showed a reduction in COL1A1 protein expression ( Figure 1 J - N ), an increase in COL4A1 protein expression ( Supplementary Figure 1 ), with an increase in Col3a1, Col4a1, Col4a2, and Col6a3 RNA expression ( Figure 1 O , Figure 2 B and C , and Supplementary Figure 3 ), consistent with this UL phenotype. Reduced Col1a1 in the ckO may be due to species-specific differences between rodent and human. Additionally, alteration to αSMA organization and expression in the ckO ( Figure 1 P - S ) is consistent with UL phenotypic behavior ( Kobayashi et al., 1996 , Wolanska et al., 1998 ). Differences seen in the Acta2 RNA, with decreased expression in the cKO, is likely due to the use of whole uterus samples for RNA analysis. Moreover, increased expression of TGF-β3 through decreased Dpt , a known regulator of TGF-β3, is an established component of UL ( Arici and Sozen, 2000 , Kuroda et al., 1999 ). Our cKO model shows both a decrease in Dpt with an associated increase in Tgfb3 , consistent with this phenotype ( Figure 1 T ). Increased expression of Esr1 and Pgr in the cKO ( Figure 2 D - F ) is also consistent with a UL phenotype ( Borahay et al., 2015 , Bulun, 2013 ), allowing for the improved study of hormone sensitivity and altered response to steroid hormones seen in UL. Previous work within our lab has shown similar increases in Esr1 and Pgr in REST cKO mouse models ( Cloud et al., 2022 ), although an epistatic analysis of this dysregulation needs further research. In addition, IPA of differentially expressed genes within myometrial, stromal, and epithelial clusters indicated upstream regulators, including various forms of vitamin D3 and ML290. Vitamin D3 deficiency is a well-established risk factor for UL, and vitamin D3 has previously been implicated for possible use as a therapeutic for UL ( Baird et al., 2013 , Sabry et al., 2013 ). This provides another potential connection to known pathways in UL involving vitamin D3 and the loss of PRICKLE1. ML290 is an allosteric agonist of the relaxin receptor RXFP1 and exhibited anti-fibrotic properties in cardiac fibroblasts ( Kocan et al., 2017 ), making a possible connection for its regulation and, coupled with the increased Rxfp1 expression in the cKO ( Supplementary Figure 5 ), its potential therapeutic use in UL. Furthermore, IPA showed dysregulation of pathways associated with several cellular processes, fibrosis, and reproductive tumors and disorders, providing even further connection to the loss of PRICKLE1 and UL pathogenesis ( Tables 1 - 2 , Supplementary Tables 1 - 10 ). Dysregulated pathways that include pulmonary fibrosis and hepatic fibrosis ( Supplementary Table 7 ) are highly associated with and indicative of the fibrosis seen in UL, even though these changes are seen within the epithelial cell population of the cKO. Pathway dysregulation of cell death and survival, carcinoma, and tumor formation are potentially related to UL tumorigenesis ( Supplementary Tables 4 and 6 ). The majority of the changes indicated with IPA were seen within the stromal clusters, consistent with stromal changes seen in UL that lead to symptoms of excessive bleeding and increased inflammation ( Zheng et al., 2014 ). While the MiC-mediated deletion of Prickle1 is expected to be myometrial-specific ( Cloud et al., 2022 ), the changes seen within other layers of the uterus could be related to the architectural, biophysical, or molecular changes in the myometrium and require further investigation. It is known that PI3K-AKT/mTOR signaling is activated in UL ( Crabtree et al., 2009 ) and is increased in the REST cKO UL mouse model ( Cloud et al., 2022 ). However, our cKO did not demonstrate activation of PI3K-AKT/mTOR signaling ( Supplementary Figure 2 ). We also did not see any significant alterations to REST target genes as expected ( Supplementary Figure 4 ). This may be due to differences in how PRICKLE1 regulates REST in rodents compared to humans and requires further investigation. Furthermore, it is unknown if the increased Prickle2 and Prickle3 expression in the cKO model could compensate for REST stabilization and nuclear localization in the absence of PRICKLE1. In the context of Wnt/PCP signaling, the loss of PRICKLE1 in our cKO showed alterations to non-canonical Wnt signaling pathways at both the protein ( Figure 3 ) and RNA ( Figure 4 ) levels with subsequent changes to myometrial and ECM organization ( Figures 1 and 5 ). Small changes in Wnt signaling protein expression are likely due to using whole uterus samples for evaluation with compensation from other Prickle homologs ( Supplementary Figure 6 ). Single-cell RNA sequencing demonstrates alteration to RNA expression in myometrial clusters for several Wnt signaling genes with corresponding compensation in stromal clusters, likely preventing visualization of protein changes within whole uterus samples. Previously, in vitro studies have demonstrated structural changes occur in primary myometrial cells to allow for parallel organization, while leiomyoma cells become aggregates and form bundled nodules ( Kobayashi et al., 1996 ). Our cKO mimics this behavior through alterations in ECM and myometrial cell organization, likely due to the disruption of Wnt/PCP signaling through the ablation of Prickle1 . Altered architecture seen in the cKO would also indicate that potential remodeling of Wnt/PCP medicated cytoskeleton organization and tissue architecture changes occur even after puberty when iCre is expressed in MiC ( Cloud et al., 2022 ). Alterations to myometrial and ECM organization, coupled with alterations to ECM within the stroma, may play a role in the fertility phenotype seen within the cKO ( Figure 1 I ) and in particular cases of UL ( Al-Hendy and Salama, 2006 ). Moreover, IPA analysis of myometrial, stromal, and epithelial differentially expressed genes provides further evidence for Wnt/PCP disruption through the dysregulation of pathways involved in cell communication, tissue organization, ECM organization, collagen fibril organization, connective tissue morphology, and protein expression in myometrial, stromal, and epithelial cell populations ( Tables 1 - 2 , Supplementary Tables 1 - 10 ). Our novel myometrial-specific Prickle1 f/f MiC cKO links the loss of PRICKLE1 to UL pathogenesis by disrupting Wnt/PCP signaling, collagen expression, and myometrial ECM organization. Our cKO developed fibrotic structures and contains many of the same human UL characteristics, making it an exciting model for the study of UL pathogenesis. Our model allows for further research of Wnt/PCP cellular communication and organization to the subsequent pathways in UL, providing an important pre-clinical model to study UL pathogenesis. Further analysis of this mouse model and the single-cell RNA sequencing data will be crucial to better the field’s understanding of the relationship between UL, PRICKLE1, and Wnt/PCP signaling, ultimately leading to better development of pharmacotherapies for the treatment of UL. This study further establishes that the role of Wnt/PCP dysregulation, rather than the canonical Wnt signaling pathway, is important for the development of UL.

Uterine leiomyomas (UL, uterine fibroids) are the most common benign tumors of the female reproductive tract, affecting over 75% of reproductive-age females ( Bulun, 2013 ). Although benign, approximately 1 in 4 patients will have severe symptoms requiring clinical treatment ( Bulun, 2013 ). Symptoms of UL include pelvic pain and pressure, dysmenorrhea, menorrhagia, anemia, and, in some instances, reproductive dysfunction ( Al-Hendy and Salama, 2006 , Cook et al., 2010 ). UL are hormone-responsive and arise from the myometrial smooth muscle cells of the uterus, ranging in size from 10 millimeters to over 20 centimeters ( McWilliams and Chennathukuzhi, 2017 ). Unfortunately, despite the large number of affected patients, there is no effective, long-term pharmacotherapy option to treat UL ( Islam et al., 2020 ). Due to this lack of options, UL has become the primary reason for hysterectomies, accounting for 39% of all hysterectomies performed in the United States ( De La Cruz and Buchanan, 2017 ). The absence of long-term pharmacotherapies is primarily due to the lack of accurate animal models for UL and the gap in understanding the mechanisms behind UL pathogenesis. Previous work from our laboratory has demonstrated that the loss of NSRF/REST results in increased GPR10 and the activation of P13K/AKT-mTOR signaling in UL ( Varghese et al., 2013 ). Moreover, ablation of Rest within the myometrium results in UL phenotype in mice with altered progesterone receptor function and enhanced estrogen signaling ( Cloud et al., 2022 ). PRICKLE1, also referred to as Rest-interacting LIM-domain Protein (RILP), is highly involved in nuclear localization of REST in addition to Wnt/planar cell polarity (PCP) signaling, making it an intriguing target of study in UL ( Shimojo and Hersh, 2003 , Katoh and Katoh, 2003 ). Previous work in the lab has shown the loss of PRICKLE1 in human UL samples compared to matched controls (M McWilliams, F Koohestani, WN Jefferson, S Gunewardena, K Shivashankar, RA Wertenberger, CJ Williams, TR Kumar, & VM Chennathukuzhi, BioRxiv preprint, doi: 10.1101/2024.09.09.612036 ). Moreover, in vitro siRNA knockdown of PRICKLE1 in human myometrial cells results in the loss of REST (M McWilliams, F Koohestani, WN Jefferson, S Gunewardena, K Shivashankar, RA Wertenberger, CJ Williams, TR Kumar, & VM Chennathukuzhi, BioRxiv preprint, doi: 10.1101/2024.09.09.612036 ). In the context of planar cell polarity, UL structural proteins (collagens, fibronectins, and proteoglycans) are abnormal in organization, structure, and expression levels ( Patel et al., 2016 , Parker, 2007 ), potentially affected by the loss of PRICKLE1. The role PRICKLE1 plays within the myometrium in the context of UL is not well understood and may be key to further understanding of UL pathogenesis and the development of long-term pharmacotherapies. To investigate the role of PRICKLE1 in UL, we developed a myometrial conditional knockout (cKO) of Prickle1 using a myometrial specific icre using the proximal region from the rat calbindin-D9K (CaBP9K) promotor (MiC) previously developed and characterized in our laboratory ( Cloud et al., 2022 ). We demonstrate that the deletion of Prickle1 in the myometrium leads to a UL phenotype consisting of fibrotic structures, excess extracellular matrix (ECM) production, altered ECM and smooth muscle cell organization, increased Esr1 and Pgr expression, and dysregulated Wnt/PCP signaling. This novel mouse model provides a potentially crucial preclinical tool for investigating and understanding UL pathogenesis and the future development of pharmacotherapies.