Genetic and statistical analysis of ESR1 variants in endometriosis-related infertility: a case–control study from South India

Background Endometriosis, defined by the abnormal growth of endometrial-like tissue outside the uterus, impacts 6–10% of women of reproductive age and is a significant contributor to infertility. The Estrogen Receptor 1 (ESR1) gene is integral to estrogen-dependent signalling pathways, and variations in this gene have been associated with an increased susceptibility to endometriosis.

This study investigated the relationship between two polymorphisms in the ESR1 gene (rs9340799 and rs2234693) and infertility associated with endometriosis in South Indian women. The research involved three groups: infertile women diagnosed with endometriosis, infertile women without the condition, and fertile women serving as controls. Genotyping was performed using PCR, and statistical analyses assessed genotype distributions. Additionally, in silico analyses were conducted using GeneMANIA and STRING to examine ESR1-related gene–gene and protein– protein interaction networks.

Among the 163 subjects studied, no significant association was observed between either ESR1 SNP and infertility related to endometriosis across all genetic models. In silico analysis revealed that ESR1 participates in biologically meaningful networks, interacting with multiple genes and proteins involved in hormonal signalling, transcriptional regulation, and reproductive functions, supporting its functional relevance in endometriosis pathways.

Although ESR1 variants rs9340799 and rs2234693 were not statistically associated with endometriosis- related infertility in this population, bioinformatics analyses underscored ESR1's role in regulatory networks related to estrogen signalling. These findings warrant further large-scale and functional studies integrating both genetic association and molecular pathway data to better understand ESR1's contribution to endometriosis.

Endometriosis, Infertility, Gene polymorphism, Polymorphism, Genetics Page 2 of 13 Baskar et al. Middle East Fertility Society Journal (2026) 31:60

Endometriosis (EM) is an inflammatory condition caused by estrogen hormone, where endometrial glands and stromal cells are found outside the uterus [ 14] Shigesi et al. 26. Besides lesion development, endometriosis is known for causing estrogen dysregulation, inflammation, immune cell dysfunction, angiogenesis and tissue mod - elling that cause pelvic pain, infertility, and decrease the patient's quality of life. There is mounting evidence show- ing that estrogen signalling pathways are responsible for endometriotic lesions. As a result, genes such as ESR1 are considered critical in the development of endometriosis [6]. Ectopic endometrial tissue refers to endometrial tis - sue that grows outside of the uterus. These lesions are most commonly found in areas such as the pelvic peri - toneum, cervix, uterosacral ligaments, fallopian tubes, the pouch of Douglas, rectum, and colon [ 29]. Distant organs, such as the lymph nodes, lungs, and umbilicus, often exhibit EM. It is believed that retrograde menstrua- tion, as well as immunologic abnormalities and perito - neal dysfunction, is the main cause [ 19]. According to the data from WHO (2024), endometriosis, polycystic ovary syndrome, tubal factor, other anatomical reasons, and unexplained infertility are the primary illnesses that impact female infertility [ 10]. Endometriosis is estimated to affect around 247 million girls and women worldwide, and an estimated 42 million Indian women are affected, equivalent to roughly 10% of those aged 18 to 45. The estimation of the prevalence rate for endometriosis in India ranges from 10 to 18%, depending on age group; this variation may convey the demographic/economic variances that exist within the overall female population's reproductive age. An increased prevalence of infertil - ity and chronic pelvic pain among women presenting to the clinics has also been noted, with evidence suggesting an association between endometriosis and infertility; the evidence that exists does suggest significant clinical rel - evance of these findings for women living in South India [8]. Endometriosis is also caused by environmental chemi - cals such as dioxin, which mimics estrogen and functions by connecting with estrogen receptors [ 8]. It impacts between 6 and 10% of women aged 18 to 40, the typi - cal reproductive age range. Because EM needs an inva - sive method for confirmation, the actual prevalence rate remains unknown [ 25]. This disorder may produce dis - tressing symptoms, including dysmenorrhea, infertility, pelvic discomfort, and dyspareunia [ 34]. Alternatively, it may present without any symptoms and be incidentally detected during a laparoscopic procedure [ 31]. Lifestyle modifications, environmental variables, exposure to pol - lutants, immunological and hormonal factors, as well as several other elements, are possible additional causal factors crucial in the disease's progression [ 37]. Ovarian endometriosis is an estrogen-dependent cystic area that develops in women of reproductive age and inhibits female fertility due to oocyte quality problems. Trans - vaginal ultrasound monitoring can quickly detect ovar - ian endometriosis [ 7, 36]. Age, lifestyle, and peritoneal implants are associated with ovarian forms, which grow into endometriomas. This is mainly found on the left ovary due to peritoneal implants. It can be uninoculated or multiloculated, depending on the number of implants [2]. The discovery of genetic variables contributes to a better understanding of the disease's underlying biol - ogy. The basic strategy for investigating the underlying processes and causes of endometriosis is to identify and comprehend the roles of the genetic variations respon - sible for the heritable component [ 33]. It has a polygenic inheritance, encompassing many loci and chromosomal regions associated with the disease [ 4]. The ESR1 gene spans almost 300 kilobases and comprises non-coding 5' UTR exons and coding exons [ 13]. The estrogen recep - tor protein has over 597 amino acids, with several splice variants that help form dimers with the wild type, hence modifying receptor activity [24]. The ESR1 gene encodes an estrogen receptor with vari - ous domains essential for DNA binding and transcription activation. Estrogen receptors in humans were divided into Alpha and Beta, encoded by the ESR1 and ESR2 genes, respectively. These estrogen receptor alpha pro - teins are thought to be estrogen-signalling mediators that serve as ligand-dependent transcription factors [24, 28]. The hormone estrogen is a crucial element in the devel- opment of endometriosis since it supports proliferation, survival and invasion of ectopic endometrial tissue. It was suggested that all biological events, such as endo - metrial proliferation, differentiation of cells, immune response and angiogenesis, were regulated by the ESR1- mediated signalling pathway, thus affecting the growth and advancement of the endometriotic lesions. The alter- ation of ESR1 expression level modulates the estrogen responsiveness of the endometrium and ectopic tissue, determining the level of disease susceptibility and sever - ity. In addition, aberrant estrogen signalling in endome - triosis can also be responsible for deficient endometrial receptivity, aberrant folliculogenesis and infertility. For this reason, gene polymorphisms linked to the ESR1 gene could explain differences among women as regards sus - ceptibility to endometriosis and its related complications [32]. The SNPs rs9340799 and rs2234693 are within intron 1 of the ESR1 gene on chromosome 6q25 and exhibit link - age disequilibrium. Despite their location in an intron and lack of impact on the amino acid sequence, they could potentially modulate ESR1 gene expression directly or be associated with unidentified causal DNA sequence Page 3 of 13 Baskar et al. Middle East Fertility Society Journal (2026) 31:60 variants. Introns have diverse implications for gene expression, potentially influencing alternative splicing via enhancer elements or promoters and regulating various cis- and trans-acting elements that may result in different protein isoforms [ 27, 30]. EM has a genetic component with certain genetic variations implicated in its develop - ment. Research suggests that variations in genes involved in hormone regulation, inflammation, and tissue growth may contribute to an individual's susceptibility to devel - oping EM. Nevertheless, additional research is required to gain a comprehensive understanding of the genetic factors involved. Beyond predisposition to the condition, other recent advancements within reproductive medicine seek to enhance fertility success for women with endo - metriosis. One interesting adjunctive therapeutic that has been researched for this use is nutraceutical supplemen - tation with inositol, given its participation in signalling, ovarian physiology and reproductive functions. Inositols help manage metabolism and inflammatory responses for more successful oocyte and follicle formation and matu - ration, improving outcomes and promoting reproductive health for infertile women. Infertility preservation, in women affected by endometriosis, has become increas - ingly important prior to invasive reproductive sparing surgeries. Coordinated intervention, including GnRH antagonists in conjunction with oocyte vitrification fol - lowing controlled ovarian stimulation, has shown prom - ise for preserving female reproductive potential while limiting the detrimental effect of this intervention on the ovarian reserve. More recent work has also highlighted the necessity for a holistic approach involving genetic, molecular and reproductive interventions when address - ing endometriosis-related infertility [ 5, 22]. Our study aims to investigate the genetic factors that influence infertility, both with and without endometriosis, and to evaluate the associations between gene polymorphisms and fertile control groups.

Study subjects This study was done during the years 2017–2020 after getting clearance from the Institutional Human Eth - ics Committee of Chettinad Academy of Research and Education (Proposal No:115/IHEC/12—16). The full intent and nature of the study were explained to all the participants at the time of sampling, and consent was taken from each participant with informed understand - ing. This was a case control study and consisted of three sets of participants (i) infertile women with a confirmed diagnosis of endometriosis ( n = 39) (ii) infertile women without endometriosis (n = 43) (iii) Fertile control women (n = 81). An abdominal or transvaginal ultrasound was necessary to confirm ovarian endometriomas, and diag - nostic laparoscopy was essential to confirm peritoneal endometriosis. The introduction of a second comparator group of fertile women without endometriosis provided a way to distinguish between the genetics of endometrio - sis per se and infertility per se. Therefore, this provided a potential method to analyze the impact of ESR1 poly - morphisms on endometriosis-related infertility without the potential confounders of infertility. Peripheral blood samples were obtained from individuals who fulfilled the inclusion criteria. Venipuncture was used to obtain approximately 5  mL of blood, which was then kept in an EDTA tube at 4 °C. Participants were recruited from the Department of Andrology and Reproductive Medi - cine in the Institute, along with additional fertility cen - tres located in Chennai. For identification, each sample was assigned a group code with a numerical label during sample processing. The SNPs rs9340799 and rs2234693 were selected based on their previous association with EM in different geographical regions and their impact on disease mechanisms. Inclusion criteria This study enrolled women aged 20 to 40 years. The case group consisted of infertile women with endometriosis on transvaginal ultrasound and/or laparoscopic exami - nation. The non-diseased infertile controls consisted of infertile women without signs of endometriosis on either clinical evaluation or radiologic imaging. The fertile con - trols consisted of fertile women with at least 2 live births and no history of infertility or endometriosis. Fertile controls were obtained from women who attended the hospitals for routine gynecologic evaluations and physi - cal examinations. All subjects who agreed to participate were enrolled in the study. Exclusion criteria Exclusion criteria included women with a history of sex - ually transmitted infections (STIs) and HIV infection, cancer, autoimmune diseases, chronic systemic diseases, hormonal disorders (not endometriosis) or a history of gynecological surgery that could affect reproductive out - come, or contraindications for informed consent or poor clinical data. Genomic DNA isolation and PCR amplification for genotyping SNPs Participants meeting the inclusion criteria provided 5 mL of peripheral blood, from which genomic DNA was extracted using the salting-out method [ 11]. The DNA concentration and purity were assessed using a UV–vis - ible spectrophotometer. Primers specific to the selected SNPs (rs9340799 and rs2234693) were designed using the Tetra 1 primer tool and validated with an oligo (dt) calculator. The finalized primer sequences are presented in Table  1. PCR amplification was conducted using the Page 4 of 13 Baskar et al. Middle East Fertility Society Journal (2026) 31:60 such an association is present. This analysis was con - ducted using metadata within a 95% confidence inter - val, ensuring that the study results accurately reflect the actual effect in the general population. An alpha level of 0.05 was applied, indicating a 5% probability that any observed association may have occurred by chance rather than due to a real genetic link. The sample size for each study, including cases (individuals diagnosed with endo - metriosis) and controls (healthy participants), was inde - pendently evaluated for the ESR1 gene polymorphisms. The statistical power of each dataset was calculated using G*Power 3.1 software to confirm that the results were unlikely to be attributed to random variability. Bioinformatics-based investigation Gene–gene interaction and pathway analysis The gene–gene interaction networks relevant to endo - metriosis were examined using the GeneMANIA online platform. A curated list of genes, including ESR1, was input to generate a comprehensive interaction map. Only gene interactions with correlation scores of ≥ 0.4 were considered biologically meaningful. The Gene Ontology (GO) database was utilized to extract detailed informa - tion on the involved cellular components, molecular functions, and biological processes. These insights helped clarify the roles of ESR1 and its associated genes in path - ways related to endometriosis. Protein–protein interactions (PPI) To investigate protein-level associations, STRING v11.0, an online database, was employed to predict func - tional relationships between proteins, including those potentially affected by the ESR1 SNPs rs9340799 and rs2234693. Protein interactions were analyzed using a minimum confidence score threshold of 0.4. Genotyping validation by sanger sequencing In order to authenticate the genotypes derived through Tetra-ARMS PCR, relevant samples from cases and con - trols relevant to the observed genotypes were picked, and Sanger sequencing was performed. The PCR amplified following thermal cycling conditions: an initial dena - turation at 92  °C for 5  min, followed by 35 cycles com - prising denaturation at 94 °C for 45 s, annealing at 62 °C for 45  s, and extension at 72  °C for 45  s, concluding with a final extension step at 72  °C for 5  min. For each SNP , the ARMS-PCR reaction mixture consisted of 3 µL of genomic DNA, 5 µL of master mix, 1 µL of dis - tilled water, and 0.5 µL each of the outward forward and reverse primers. Statistical analysis The mean and standard deviation were calculated for key demographic parameters. Hardy–Weinberg equilibrium (HWE) was assessed in the control group for each poly - morphic site to ensure genetic consistency. Chi-square tests were employed to assess variations in genotype dis - tribution between the patient and control groups, and odds ratios (ORs) with 95% confidence intervals (CIs) were computed to determine the strength of the associa - tion. Additionally, a p-value of less than 0.05 indicated that the disparity was statistically significant. Sample size estimation The sample size was estimated using the formula: N = p(1− p)(Z/E)2 where p represents the estimated prevalence of endome - triosis, Z corresponds to the standard normal deviate at a 95% confidence interval (1.96), and E denotes the mar - gin of error (0.05). Based on the reported prevalence of endometriosis among women of reproductive age, the minimum sample size required for the study was calcu - lated. Considering participant availability and eligibil - ity criteria during the study period, a total of 39 infertile women with endometriosis, 43 infertile women without endometriosis, and 81 fertile controls were recruited. Power analysis A power analysis was performed to assess the prob - ability of identifying a true genetic association, assuming Table 1 Designed primer sequences of ARMS-PCR Name Primer Sequence [5' to 3'] Total no of bases Allele PCR product size ESR1 Gene (rs9340799) Inner Forward GTTTCCCAGAGACCCTGAGTGTGGTATG 28 G 239 Inner Reverse TAGAGACCAATGCTCATCCCAACGCT 26 A 270 Outer Forward AACCACCATGCTCAGTCTCTACATGTTCC 29 - 455 Outer Reverse GTCTGTTGCAGCAAAAGGTGTTGCCTAT 28 - ESR1 Gene (rs2234693) Inner Forward TTCATCTGAGTTCCAAATGTCCCATCC 27 C 246 Inner Reverse CTGGGAAACAGAGACAAAGCATAAACCA 28 T 277 Outer Forward TTAAACAATTCTCCTGCTTTGGCCTCC 27 - 468 Outer Reverse TTGAGGGGAAATTGTTTATTGCAAACTTG 29 - Page 5 of 13 Baskar et al. Middle East Fertility Society Journal (2026) 31:60 product was bidirectionally sequenced by the con - ventional Sanger sequencing method. The chromato - grams were observed through the Chromas software, and sequence alignment was performed with the help of the BLAST tool (NCBI) in order to authenticate the polymorphisms of concern. Late-acquired sequences were compared with their respective Tetra-ARMS PCR genotypes.

Demographic and clinical characteristics of study subjects The demographic and clinical variables are presented for a more realistic interpretation of the data in Table  2. The study included a total of 163 participants, consisting of 39 infertile women with endometriosis, 43 infertile women without endometriosis, and 81 fertile control subjects. The mean ages of the healthy controls were 36.26 ± 8.9, 40 ± 6.2, and 38 ± 7.3, respectively. Overall, this study's findings show no evident difference in mean age between women experiencing infertility associated with endo - metriosis and patients with infertility without endome - triosis. However, the mean age of the infertile patients in both groups was slightly higher than that of the healthy controls. The mean BMI was notably higher in infer - tile women with endometriosis (29.4 ± 7.3) compared to infertile women without endometriosis (27.7 ± 6.4) and the healthy control group (22.5 ± 4.3). Compared to infer- tile patients without endometriosis and healthy controls, infertile patients with endometriosis showed significantly higher BMI values. The study found a significant asso - ciation between regular and irregular menstrual cycles across all three groups ( p = 0.01). Menarche age, first childbirth age, and family history of endometriosis are merely a few of the various additional factors that may be relevant. Statistical analysis: allelic and genotypic frequencies for both the polymorphism The DNA examinations of the three groups were most likely carried out using ARMS-PCR to amplify specific DNA sequences that differed from one another. The primers used to amplify the DNA sequences are shown schematically in Figs.  1 and 2 of the ARMS-PCR pro - cedures, along with the expected sizes of the amplified fragments. Tables 3 & 4 present the genotypic and allelic frequencies of the study population for rs9340799 and rs2234693. The first SNP of the ESR1 gene, rs9340799, has a variation from A to G. The G allele was observed in 33.3% of the endometriosis group, 22% without endo - metriosis, and 27.1% in controls. This suggests that the G allele may be associated with a higher likelihood of devel- oping endometriosis. The evaluation of the rs9340799 polymorphism with and without EM shows an insig - nificant association with the G allele (OR = 0.55 [95% CI (0.28–1.13)], p = 0.10). Similarly, homozygous recessive (GG) shows an insignificant association (OR = 0.45 [95% CI (0.10–1.98)], p = 0.2), while the groups without EM and control groups show an insignificant association in the G allele (OR = 1.31 [95% CI (0.71–2.43)], p = 0.38. Similarly, homozygous recessive (GG) shows an insignifi- cant association (OR = 1.14 [95% CI (0.29–4.47), p = 0.84]; Table 2 Demographic characteristics of cases and controls S. no Factors Infertile with Endo- metriosis [N = 39] Infertile without En- dometriosis [N = 43] Controls [N = 81] p- value 1 Age 22 23 13 > 1 25–30 31–35 10 12 18 36–40 07 08 50 Mean age 36.26 ± 8.9 40 ± 6.2 38 ± 7.3 2 BMI 25 28 50 0 Normal Obese 14 15 31 Mean BMI 29.4 ± 7.3 27.7 ± 6.4 22.5 ± 4.3 3 Cause of Infertility 39 - - - 4 Menstrual cycles 14 16 45 0.01* Regular Irregular 25 27 36 Data are presented as mean ±SD NA Not Applicable *denotes statistically significant data Fig. 1 Gel showing the amplified product of the ESR1 rs9340799 polymorphism analysis on 2% agarose gel Page 6 of 13 Baskar et al. Middle East Fertility Society Journal (2026) 31:60 the inconsequence association in with EM and control groups, G allele (OR = 0.74 [95% CI (0.41–1.33), p = 0.32, while in homozygous recessive (GG) shows OR = 0.52 [95% CI (0.15–1.70), p = 0.28. The second SNP , rs2234693, has a variation from C to T. The T allelic frequencies observed in the study groups were 38.4%, 32.5%, and 40.1% in EM, infertile women without endometriosis, and control subjects, respec - tively. The analysis of the rs2234693 polymorphism with and without EM shows an insignificant association with the T allele (OR = 0.77 [95% CI (0.40–1.46)], p = 0.43). Similarly, homozygous recessive (TT) shows an insig - nificant association (OR = 0.66 [95% CI (0.19–2.33)], p = 0.52), while the groups without EM and control show an irrelevant correlation with the T allele (OR = 1.38 [95% CI (0.80–2.40)], p = 0.24). Similarly, homozygous reces - sive (TT) shows an insignificant association (OR = 1.82 [95% CI (0.61–5.39), p = 0.27]; the inconsequence associ - ation in with EM and control groups, allele T (OR = 1.07 [95% CI (0.61–1.86), p = 0.80, while in homozygous reces- sive (TT) shows OR = 1.21 [95% CI (0.42–3.46), p = 0.71 respectively. The results may be inconclusive if the sam - ple size is inadequate to detect a link between an SNP and a trait. A more extensive study with a larger sample size would be necessary to conduct a more in-depth assessment. Other potential impacts on the trait, such as environmental factors and genetic variants, should be explored in future studies. DNA samples from each group of ESR1 variants, including rs9340799 and rs2234693, were sequenced to confirm the presence of allele-specific DNA fragments. The sequence of DNA samples produces allele-specific DNA fragments. Figures  3 and 4 illustrate the DNA sequencing electropherogram of both SNPs. Power analysis A power analysis was conducted to evaluate the sta - tistical validity and robustness of each included study concerning the selected ESR1 gene polymorphisms (rs9340799 and rs2234693), as depicted in Fig.  5. The analysis aimed to determine whether the sample sizes were sufficient to achieve the designated level of statisti - cal significance, with an alpha error probability of 0.05. Table 3 Association of rs9340799 polymorphism with three distinct groups Polymorphisms: rs9340799(A > G) Infertile women with En- dometriosis (N = 39 (%) Infertile women without Endometriosis (N = 43 (%) OR 95% CI p- val- ue Allele A 52 (66.6) 67 (77.9) Reference 0.10 G 26 (33.3) 19 (22) 0.55 0.28 −1.13 Genotype AA 21 (53.8) 28 (65.1) Reference 0.7 AG 10 (25.6) 11 (25.5) 0.83 0.3—2.30 GG 08 (20.1) 04 (9.3) 0.45 0.10–1.98 0.2 Infertile women without Endometriosis (N = 43(%) Controls (N = 81(%) Allele A 67 (77.9) 118 (72.8) Reference 0.38 G 19 (22) 44 (27.1) 1.31 0.71–2.43 Genotype AA 28 (65.1) 47 (58) Reference AG 11 (25.5) 24 (29.6) 1.29 0.55–3.05 0.54 GG 04 (9.3) 10 (12.3) 1.14 0.29–4.47 0.84 Infertile women with en- dometriosis (N = 39(%) Controls (N = 81(%) Allele A 52 (66.6) 118 (72.8) Reference 0.32 G 26 (33.3) 44 (27.1) 0.74 0.41–1.33 Genotype AA 21 (53.8) 47 (58) Reference 0.87 AG 10 (25.6) 24 (29.6) 1.07 0.43–2.63 GG 08 (20.1) 10 (12.3) 0.52 0.15–1.70 0.28 Fig. 2 Gel showing the analysis of the amplified product of ESR1 rs2234693 polymorphism on 2% agarose gel Page 7 of 13 Baskar et al. Middle East Fertility Society Journal (2026) 31:60 This approach estimates the probability of identifying a true genetic association based on specific parameters, including sample size, effect size, and the significance threshold. The results confirmed that the majority of the reviewed studies had adequate sample sizes to reach the required power, indicating a high likelihood of detecting actual genetic effects if present. Consequently, the stud - ies were sufficiently powered to identify significant asso - ciations between the ESR1 variants and susceptibility to endometriosis, thereby reducing the risk of Type II error (false negatives). This strengthens the credibility and reli- ability of the findings, supporting the conclusion that the reported genetic associations are both statistically and biologically meaningful. Bioinformatics-based investigation results Gene–gene interaction analysis using geneMANIA Using Gene Ontology (GO) classification, we further cat - egorized these associated genes based on their involve - ment in key cellular components, molecular functions, and biological processes relevant to endometriosis. This integrative approach enabled a comprehensive under - standing of the functional roles and interconnectedness of ESR1-related genes within disease-specific pathways, as illustrated in Fig. 6. This method significantly enhanced our understanding of the complex genetic architecture and molecular mechanisms underlying endometriosis. PPI network evaluation The protein–protein interaction (PPI) network generated using the STRING v11.0 database comprised 11 nodes and 50 edges, with an average node degree of 9.09 and a clustering coefficient of 0.914. The analysis yielded a highly significant PPI enrichment p-value of 9.83 × 10–7 , indicating that the observed protein interactions are sig - nificantly more frequent than would be expected from a random protein set of comparable size and degree distri - bution. This significant enrichment implies that the pro - teins are functionally and biologically interconnected as a group. Figure  7 presents the detailed protein interaction network centring on ESR1, highlighting its interactions and the potential functional implications in the patho - genesis of endometriosis. These visualizations provide compelling evidence that the ESR1-associated proteins form a biologically meaningful network rather than a random collection, reinforcing the functional significance of these molecular interactions Fig. 8.

Several factors contribute to the pathogenesis of endo - metriosis, but estrogen and its receptor play a significant role [18]. Endometriosis has been studied concerning ste- roid hormone receptors and their potential function. A key role is played by estrogen receptor alpha, encoded by Table 4 Association of rs2234693 polymorphism with three distinct groups Polymorphisms rs2234693(C > T) Infertile women with Endometriosis (N = 39 (%) Infertile women without Endometriosis (N = 43 (%) OR 95% CI p-value Allele C 48 (61.5) 58 (67.4) Reference 0.43 T 30 (38.4) 28 (32.5) 0.77 0.40–1.46 Genotype CC 18 (46.1) 22 (51.1) Reference 0.92 CT 12 (30.7) 14 (32.5) 0.95 0.35–2.57 TT 09 (23) 07 (16.2) 0.66 0.19–2.33 0.52 Infertile women without Endometriosis (N = 43(%) Controls (N = 81(%) Allele C 58 (67.4) 97 (59.8) Reference 0.24 T 28 (32.5) 65 (40.1) 1.38 0.80–2.40 Genotype CC 22 (51.1) 37 (45.6) Reference 0.95 CT 14 (32.5) 23 (28.3) 0.97 0.41–2.28 TT 07 (16.2) 21 (25.9) 1.82 0.61–5.39 0.27 Infertile women with endometriosis (N = 39(%) Controls (N = 81(%) Allele C 48 (61.5) 97 (59.8) Reference 0.80 T 30 (38.4) 65 (40.1) 1.07 0.61–1.86 Genotype CC 18 (46.1) 37 (45.6) Reference CT 12 (30.7) 23 (28.3) 0.93 0.38–2.28 0.87 TT 09 (23) 21 (25.9) 1.21 0.42–3.46 0.71 Page 8 of 13 Baskar et al. Middle East Fertility Society Journal (2026) 31:60 the ESR1 gene, when estrogen binds to tissues via estro - gen receptor subtypes (alpha and beta). Several studies have confirmed this assumption in regular and endome - triosis patients. The estrogen receptor alpha is expressed differently in endometriosis samples, hinting that estro - gen is mediated by the receptor alpha in endometriosis [3]. To the best of our knowledge, this is the first report which assessed the link between ESR1 rs9340799 and rs2234693 polymorphisms and endometriosis-associ - ated infertility in South Indian women. In the present study, no association was observed between either of the studied polymorphisms and the risk for endometriosis- associated infertility. The genotype and allele frequen - cies in infertile women with endometriosis, infertile women without endometriosis and fertile controls were not found to be statistically different from one another. Hence, the ESR1 variants studied in the present study Fig. 5 The graphical representation of a power analysis plot depicts how statistical power is affected by either the sample size or effect size in a two-tailed hypothesis test for the ESR1 rs9340799 and rs2234693 gene polymorphisms Fig. 4 DNA sequence electropherogram of rs2234693 polymorphism Fig. 3 DNA sequence electropherogram of rs9340799 polymorphism Page 9 of 13 Baskar et al. Middle East Fertility Society Journal (2026) 31:60 might not be major genetic risk factors for endometrio - sis-associated infertility in the present study group. A comparison of endometriosis patients' lesions with normal ovaries revealed the presence of 17-hydroxys - teroid dehydrogenase type 2 (17β-HSD2) and Cyto - chrome P450 aromatase ( CYP19). As a result of both enzymes, 17 estradiol is eventually produced, which is then released into the bloodstream as estrogen. Endo - metriosis may be an estrogen-dependent illness because estrogen stimulates endometrial development in patients with the disease [ 9]. In various populations with differ - ing sample sizes and detection techniques, several studies have investigated ESR1 and ESR2 gene polymorphisms to determine whether these polymorphisms are associated with endometriosis and endometriosis-related infertil - ity, including ER-XbaI, PvuII, and ER-AluI [12]. Japanese women and other Asian populations have a greater prev - alence rate, but African women have a lower incidence rate when compared to Caucasian women. A significant amount of attention has been given to rs9340799 (A > G) and rs2234693 (C > T), both of which are single-nucleo - tide polymorphisms of the estrogen receptor. Research on the influence of ESR1 gene polymorphisms on endo - metriosis-associated infertility remains limited across various populations [35]. There is evidence that the estro- gen receptor variant is positively associated with repro - ductive issues because of endometriosis in Asians and Caucasians, while some researchers have reported a lack of association. Studies focusing on the Indian popula - tion have not been documented so far. This investigation aims to examine the potential link between ESR1 gene polymorphisms and endometriosis-related infertility, explicitly targeting the rs9340799 and rs2234693 variants within the ESR1 gene. Single-nucleotide polymorphisms (SNPs) within the intronic region can alter transcriptional regulation events by introducing errors in splicing or disrupting regulatory Fig.  7 The Protein–Protein Interaction (PPI) network of differentially ex - pressed genes (DEGs) of the selected gene associated with endometriosis Fig. 6 The gene-to-gene interaction of various genes in association with ESR1 in endometriosis subjects Page 10 of 13 Baskar et al. Middle East Fertility Society Journal (2026) 31:60 elements. Endometriosis is associated with genetic poly - morphisms, including the immune system, galactose metabolism, and nuclear receptor polymorphisms [ 35]. Studies have shown that polymorphisms in estrogen receptor alpha can regulate estrogen activity. An ances - tral allele C has been changed to an ancestral allele T in the PvuII SNP (rs2234693). A first intronic region con - taining both polymorphisms has been found [ 17]. There is a polymorphism in the PvuII gene (rs2234693) that

in the termination of the DNA sequence binding site for the transcription factor activator protein (AP-4) [35]. Endometriosis, breast cancer, osteoporosis, and Alzheimer's disease have all been associated with these polymorphisms. XbaI and PvuII are the most robustly associated ESR1 gene variations with prostate cancer. This mutation is located on the first intronic region of chromosome 6q25 at the rs9340799 (A-351G) position. This polymorphism causes no amino acid changes in the intronic region but has a direct impact on gene expres - sion. Numerous cis and trans regulatory elements in the Intronic region regulate splicing and encourage the production of distinct protein isoforms due to polymor - phisms in this region [ 1]. We investigated the outcomes of the present study, which indicated that the ESR1 gene rs9340799 and rs2234693 polymorphisms showed no significant relationship with disease susceptibility in any of the three studied groups: those with EM, those with - out EM, and the control groups.  Similar results were observed in Japanese and Korean populations [ 35]. In contrast, a 2013 study of the Brazilian population found a significant association between ESR1 (rs9340799) gene polymorphisms and infertility in women with endome - triosis ( p < 0.001). Likewise, a study among the Japanese population also showed that the C allele had a higher incidence compared to controls without endometrio - sis and was significantly associated ( p = 0.017) [16]. This polymorphism has been shown to have a significant asso- ciation with other diseases, such as endometrial cancer [23]. Hence, the results obtained in the present study are similar to those obtained from several populations from East Asia, but are different from those from some other populations. The results might be affected by various eth- nic and geographic variations, different sample sizes and possible interaction between genes. Although no statis - tically significant relation between polymorphisms of ESR1 and infertility in endometriosis was found in the present study, a key role of estrogen signalling in repro - duction is well documented. It is widely recognized that factors responsible for endometriosis-associated infertil - ity include interactions among endocrine, inflammatory, oxidative stress and genetic factors. Promising advances have been observed in new therapeutic options aimed at treating inflammatory pathways, enhancing repro - ductive outcomes and decreasing disease progression. Along with these therapies, inositol supplementation has gained considerable attention for improving ovarian function and enhancing oocyte competence and fertility outcome of infertile women undergoing assisted repro - ductive technologies. These observations suggest that when assessing the prognosis of women with endome - triosis, considering genetic susceptibility together with Fig. 8 Bubble plot showing enriched biological processes based on Gene Ontology analysis, in which bubble size represents gene count, and color indicates FDR significance Page 11 of 13 Baskar et al. Middle East Fertility Society Journal (2026) 31:60 molecular and therapeutic variables is an appropriate approach [5, 15, 21]. Several reasons for the failure to detect significant asso- ciation in the present study may include ethnicity-depen- dent genetic architectures, variations in allele frequencies among different populations, gene–gene interactions, gene-environment interactions, and relatively small sam - ple size. Endometriosis is a complex, multifactorial dis - ease determined by various genetic and environmental factors, and single gene polymorphisms may contribute only a small fraction to the risk of the disease. Even though this study did not identify a statistically significant link between these ESR1 SNPs and endo - metriosis-related infertility in the South Indian cohort, functional and computational analyses suggest their continued relevance. Our in-silico investigations, using GeneMANIA and STRING, highlighted ESR1's integra - tion into a dense biological network with other genes and proteins implicated in hormone receptor activ - ity, transcription regulation, and cell proliferation. The protein–protein interaction (PPI) network generated through STRING demonstrated a strong enrichment of ESR1 interactions ( p-value = 9.83 × 10–7 ), indicating non- random, biologically meaningful associations. Furthermore, Gene Ontology (GO) enrichment analy - sis revealed that ESR1 and its interacting partners are involved in critical pathways, including steroid hormone receptor activity, transcription coactivator binding, and reproductive development. These computational findings support the biological plausibility of ESR1 as a key regu - lator in endometrial tissue dynamics, even in the absence of significant genotype–phenotype correlations in this cohort. From a clinical point of view, fertility preservation options should be explored in women suffering from endometriosis, as they might need to undergo fertility- sparing surgery, or they are likely to face a progressive reduction in ovarian reserve. Following controlled ovar - ian stimulation and oocyte vitrification, we have seen a trend toward positive clinical outcomes of this technique, which has now become an integral part of fertility pres - ervation. Moreover, in light of emerging data about good neonatal and follow-up outcomes after frozen embryo transfer, modern cryopreservation is confirmed to be a safe and effective technique for the preservation of fertil - ity [20]. Study limitations The study's limitation is its small sample size, and these

must be confirmed. Further investigation is needed to assess the clinical significance of these cor - relations. The discrepancies between the findings of this study and those of previous research may be attributed to variations in the study populations, sample sizes, and the limited genetic power to detect susceptibility-related gene polymorphisms within our cohort. Furthermore, the study groups were not matched for BMI, and pos - sible confounders of the observed associations cannot be excluded. In future studies, BMI-matched study groups should be investigated, or BMI should be controlled during association analysis. Analysis of the fundamen - tal association between these genetic polymorphisms is made possible by using a larger number of samples.

This study investigated the potential correlation between two crucial SNPs in the ESR1 gene, namely rs9340799 and rs2234693, and their possible role in endometrio - sis-related infertility among women in the South Indian population. While in silico analyses using GeneMANIA and STRING databases revealed biologically relevant gene–gene and protein–protein interaction networks involving ESR1, the genotypic and allelic frequency anal - yses of both SNPs in our case–control study showed no statistically significant association with endometriosis or infertility. Despite the biological plausibility of ESR1 vari- ants contributing to estrogen-driven pathophysiological mechanisms in endometriosis, our findings suggest that rs9340799 and rs2234693 polymorphisms are not signifi - cant risk factors for endometriosis-related infertility in this population. Thus, larger multi-centric studies, inclu - sive of diverse ethnic groups and integrating hormonal and lifestyle factors, are warranted for a more robust understanding of the genetic architecture of endome - triosis. Future research should also investigate the roles of other functional polymorphisms and gene regulatory mechanisms involved in estrogen signalling pathways. Although ESR1 remains a biologically plausible candi - date gene, our study highlights the complexity of endo - metriosis and underscores the need for a multifactorial approach in uncovering its genetic underpinnings. Abbreviations ESR1 Estrogen Receptor 1 ARMS-PCR The Amplification Refractory Mutation System SNP Single-nucleotide Polymorphism EM Endometriosis PCOS Polycystic ovary syndrome ROS Reactive oxygen species ERE Estrogen response element HIV Human immunodeficiency virus FASTA Fast Adaptive Shrinkage Threshold Algorithm NCBI The National Center for Biotechnology Information BMI Body mass index PCR Polymerase chain reaction

Our sincere gratitude is extended to the Chettinad Academy of Research and Education for its unwavering support and encouragement. Authors’ contributions BB, JK, IBK, SMT, AHRS: Writing – review & editing, Writing – original draft, Validation, Methodology, Data curation. PS: Clinician, Sample collection. RV: Page 12 of 13 Baskar et al. Middle East Fertility Society Journal (2026) 31:60 Study design, Supervision, Investigation, Conceptualization, Draft Editing, and Validation. Funding Not applicable. Data availability No datasets were generated or analysed during the current study. Declarations Ethics approval and consent to participate Obtained from the Institution. Consent for publication All authors have read and approved the manuscript. Competing interests The authors declare no competing interests. Received: 20 April 2026 / Accepted: 18 June 2026

1. Al-Amri RJ, Alotibi MKH, Al-Raddadi RI, Shebli WTY, Fallatah EIY, Alhujaily AS, Mohamed HS (2020) Estrogen Receptor 1 Gene (ESR1) rs2234693 Polymor- phism and Breast Cancer Risk in Saudi Women. Asian Pacific J Cancer Preven- tion 21(11):3235–3240. https:/ /doi.or g/10.31 557/ APJCP .2020.21.11.3235 2. Benagiano G, Guo SW (2022) Age-dependent phenotypes of ovarian endo- metriomas. Reproductive medicine and biology 21(1):e12438. h t t p s : / / d o i . o r g / 1 0 . 1 0 0 2 / r m b 2 . 1 2 4 3 8 3. Chantalat E, Valera MC, Vaysse C, Noirrit E, Rusidze M, Weyl A, Vergriete K, Bus- cail E, Lluel P , Fontaine C, Arnal JF, Lenfant F (2020) Estrogen Receptors and Endometriosis. Int J Mol Sci 21(8):2815. https:/ /doi.or g/10.33 90/i jms21082815 4. Chiorean DM, Mitranovici MI, Toru HS, Cotoi TC, Tomuț AN, Turdean SG, Cotoi OS (2023) New Insights into Genetics of Endometriosis-A Comprehensive Literature Review. Diagnostics (Basel, Switzerland) 13(13):2265. h t t p s : / / d o i . o r g / 1 0 . 3 3 9 0 / d i a g n o s t i c s 1 3 1 3 2 2 6 5 5. Coldebella D, Buzzaccarini G, Ferrari J, Sleiman Z, D'Alterio MN, Della Corte L, ... & Gullo G (2023) Inositols administration: Further insights on their biologi- cal role. Italian J Gynaecol Obstetr 35(01):30–36. h t t p s : / / d o i . o r g / 1 0 . 3 6 1 2 9 / j o g . 2 0 2 2 . 4 0 6. Dai Y, Ye Z, Lin X, Zhang S (2025) Immunopathological insights into endome- triosis: from research advances to future treatments. Seminars Immunopathol 47(1):31. https:/ /doi.or g/10.10 07/s 00281-025-01058-5 7. Daniilidis A, Grigoriadis G, Dalakoura D, D’Alterio MN, Angioni S, Roman H (2022) Transvaginal Ultrasound in the Diagnosis and Assessment of Endome- triosis-An Overview: How, Why, and When. Diagnostics (Basel, Switzerland) 12(12):2912. https:/ /doi.or g/10.33 90/d iagnostics12122912 8. Gajbhiye RK, Montgomery G, Pai MV, Phukan P , Shekhar S, Padte K, DasMa- hapatra P , John BM, Shembekar C, Bhurke AV, Bagde N, Kulkarni K, Sardesh- pande N, Humane A, Mahobia S, Shah M, Singh U, Srivastava A, Mishra G, Warty N, … Mahale SD (2021) Protocol for a case-control study investigating the clinical phenotypes and genetic regulation of endometriosis in Indian women: the ECGRI study. BMJ Open 11(8):e050844. h t t p s : / / d o i . o r g / 1 0 . 1 1 3 6 / b m j o p e n - 2 0 2 1 - 0 5 0 8 4 4 9. Gibson DA, Simitsidellis I, Collins F, Saunders PTK (2018) Endometrial Intra- crinology: Oestrogens, Androgens and Endometrial Disorders. Int J Mol Sci 19(10):3276. https:/ /doi.or g/10.33 90/i jms19103276 10. https:/ /www.wh o.int/n ews- room/f act-she ets/det ail/ infertility 11. Lakshmi Kardam AA, Singh KN, Rai S (2024) DNA Isolation from Whole Blood Samples of Endometriosis Patients using the Salting out Method and ITS Scope in Ayurveda. Asian J Pharmaceutics 18(1):149 12. Lu J, Ling X, Liu L, Jiang A, Ren C, Lu C, Yu Z (2023) Emerging hallmarks of endometriosis metabolism: A promising target for the treatment of endome- triosis. Biochimica et biophysica acta. Mol Cell Res 1870(1):119381. h t t p s : / / d o i . o r g / 1 0 . 1 0 1 6 / j . b b a m c r . 2 0 2 2 . 1 1 9 3 8 1 13. Lung DK, Reese RM, Alarid ET (2020) Intrinsic and Extrinsic Factors Governing the Transcriptional Regulation of ESR1. Hormones & cancer 11(3–4):129–147. https:/ /doi.or g/10.10 07/s 12672-020-00388-0 14. Mahema S, Roshni J, Raman J, Ahmad SF, Al-Mazroua HA, Ahmed SSSJ (2024) Molecular Regulator Driving Endometriosis Towards Endometrial Cancer: A Multi-Scale Computational Investigation to Repurpose Anti-Cancer drugs. Cell Biochem Biophys 82(4):3367–3381. h t t p s : / / d o i . o r g / 1 0 . 1 0 0 7 / s 1 2 0 1 3 - 0 2 4 - 0 1 4 2 0 - 8 15. Marin L, Sabbadin C, Radu CM, Brun P , Frison C, Gullo G, Armanini D, Bordin L, Ragazzi E, Ambrosini G, Andrisani A (2025) Progesterone and IL-6 Expression Are Modulated by Follicular Fluid in Granulosa Cell Cultures. Biomolecules 15(12):1646. https:/ /doi.or g/10.33 90/b iom15121646 16. Marla S, Mortlock S, Houshdaran S, Fung J, McKinnon B, Holdsworth-Carson SJ, Girling JE, Rogers PAW, Giudice LC, Montgomery GW (2021) Genetic risk factors for endometriosis near estrogen receptor 1 and coexpression of genes in this region in endometrium. Mol Human Reprod 27(1):gaaa082. https:/ /doi.or g/10.10 93/m olehr/gaaa082 17. Méar L, Herr M, Fauconnier A, Pineau C, Vialard F (2020) Polymorphisms and endometriosis: a systematic review and meta-analyses. Hum Reprod Update 26(1):73–102. https:/ /doi.or g/10.10 93/h umupd/dmz034 18. Moradi Y, Shams-Beyranvand M, Khateri S, Gharahjeh S, Tehrani S, Varse F, Tiy- uri A, Najmi Z (2021) A systematic review on the prevalence of endometriosis in women. Indian J Med Res 154(3):446–454. h t t p s : / / d o i . o r g / 1 0 . 4 1 0 3 / i j m r . I J M R _ 8 1 7 _ 1 8 19. Osuchowska-Grochowska I, Blicharska E, Gogacz M, Nogalska A, Winkler I, Szopa A, Ekiert H, Tymczyna-Borowicz B, Rahnama-Hezavah M, Grochowski C (2021) Brief Review of Endometriosis and the Role of Trace Elements. Int J Mol Sci 22(20):11098. https:/ /doi.or g/10.33 90/i jms222011098 20. Papatheodorou A, Vanderzwalmen P , Panagiotidis Y, Petousis S, Gullo G, Kasapi E, Goudakou M, Prapas N, Zikopoulos K, Georgiou I, Prapas Y (2016) How does closed system vitrification of human oocytes affect the clinical outcome? A prospective, observational, cohort, noninferiority trial in an oocyte donation program. Fertil Steril 106(6):1348–1355. h t t p s : / / d o i . o r g / 1 0 . 1 0 1 6 / j . f e r t n s t e r t . 2 0 1 6 . 0 7 . 1 0 6 6 21. Perrone U, Barra F, Anatrà M, Paudice M, Vellone VG, Gullo G, Ferrero S (2025) Targeting inflammation in endometriosis: emerging therapeutic options. Expert Opin Investig Drugs 34(12):995–1009. h t t p s : / / d o i . o r g / 1 0 . 1 0 8 0 / 1 3 5 4 3 7 8 4 . 2 0 2 5 . 2 6 0 9 7 3 4 22. Prapas Y, Ravanos K, Petousis S, Panagiotidis Y, Papatheodorou A, Margioula- Siarkou C, Iuliano A, Gullo G, Prapas N (2017) GnRH antagonist administered twice the day before hCG trigger combined with a step-down protocol may prevent OHSS in IVF/ICSI antagonist cycles at risk for OHSS without affecting the reproductive outcomes: a prospective randomized control trial. J Assist Reprod Genet 34(11):1537–1545. https:/ /doi.or g/10.10 07/s 10815-017-1010-7 23. Sadat Eshaghi F, Dehghan Tezerjani M, Ghasemi N, Dehghani M (2022) Association study of ESR1 rs9340799, rs2234693, and MMP2 rs243865 vari- ants in Iranian women with premature ovarian insufficiency: A case-control study. Int J Reprod Biomed 20(10): 841–850. h t t p s : / / d o i . o r g / 1 0 . 1 8 5 0 2 / i j r m . v 2 0 i 1 0 . 1 2 2 6 8 24. Saito K, Cui H (2023) Estrogen Receptor Alpha Splice Variants, Post-Transla- tional Modifications, and Their Physiological Functions. Cells 12(6):895. https:/ /doi.or g/10.33 90/c ells12060895 25. Ser HL, Au Yong SJ, Shafiee MN, Mokhtar NM, Ali RAR (2023) Current Updates on the Role of Microbiome in Endometriosis: A Narrative Review. Microorgan- isms 11(2):360. https:/ /doi.or g/10.33 90/m icroorganisms11020360 26. Shigesi N, Harris HR, Fang H, Ndungu A, Lincoln MR, International Endome- triosis Genome Consortium, 23andMe Research Team, Cotsapas C, Knight J, Missmer SA, Morris AP , Becker CM, Rahmioglu N, Zondervan KT (2025) The phenotypic and genetic association between endometriosis and immuno- logical diseases. Human Reprod (Oxford, England) 40(6):1195–1209. h t t p s : / / d o i . o r g / 1 0 . 1 0 9 3 / h u m r e p / d e a f 0 6 2 27. Shu J, Li J, Fu Y, Hui X, Jin Y, Chen M, Zheng X, Shi Y (2020) Association of ESR1 polymorphism rs2234693 and rs9340799 with postmenopausal osteoporosis in a Chinese population. BMC Musculoskelet Disord 21(1):346. h t t p s : / / d o i . o r g / 1 0 . 1 1 8 6 / s 1 2 8 9 1 - 0 2 0 - 0 3 3 5 9 - 2 28. Sumi MP , Guru SA, Mir R, Masroor M, Bhat MA, Girish MP , Saxena A (2019) Clinical Importance of Estrogen Receptor 1 (ESR1) Gene Polymorphisms and Their Expression Patterns in Coronary Artery Disease Patients: A Study from India. Indian J Clin Biochem 34(2):133–142. h t t p s : / / d o i . o r g / 1 0 . 1 0 0 7 / s 1 2 2 9 1 - 0 1 9 - 0 0 8 2 7 - y 29. Takeuchi M, Matsuzaki K, Harada M (2024) Endometriosis, a common but enigmatic disease with many faces: current concept of pathophysiology, and Page 13 of 13 Baskar et al. Middle East Fertility Society Journal (2026) 31:60 diagnostic strategy. Jpn J Radiol 42(8):801–819. h t t p s : / / d o i . o r g / 1 0 . 1 0 0 7 / s 1 1 6 0 4 - 0 2 4 - 0 1 5 6 9 - 5 30. Tan SC, Low TY, Mohamad Hanif EA, Sharzehan MAK, Kord-Varkaneh H, Islam MA (2021) The rs9340799 polymorphism of the estrogen receptor alpha (ESR1) gene and its association with breast cancer susceptibility. Sci Rep 11(1):18619. https:/ /doi.or g/10.10 38/s 41598-021-97935-8 31. Thanikachalam P , Arunkumar S, Pandiyan R, Natarajan P (2025) Endometrio- sis–revisited. J Reprod Healthcare Med 6(13):1. h t t p s : / / d o i . o r g / 1 0 . 2 5 2 5 9 / J R H M _ 6 _ 2 0 2 5 32. Thomas SM, Veerabathiran R (2025) Genetic and stem cell insights into the pathogenesis of endometriosis: A comprehensive review. J Biol Meth- ods 12(4):e99010075. https:/ /doi.or g/10.14 440/ jbm.0148 33. Turcan M, Maioru O, Pop L, Radoi V, Ursu R, Bacalbasa N, ... & Suciu ID (2022) Genetic determination in endometriosis. Rom Med J 69(4), 28. h t t p s : / / d o i . o r g / 1 0 . 3 7 8 9 7 / r m j . 2 0 2 2 . s 4 . 8 34. Upson K (2020) Environmental risk factors for endometriosis: A critical evalu- ation of studies and recommendations from the epidemiologic perspective. Curr Epidemiol Reports 7(3):149–170. h t t p s : / / d o i . o r g / 1 0 . 1 0 0 7 / s 4 0 4 7 1 - 0 2 0 - 0 0 2 3 6 - 3 35. van der Vaart JF, Merki-Feld GS (2022) Sex hormone-related polymorphisms in endometriosis and migraine: A narrative review. Womens Health (Lond Engl) 18:17455057221111316. https:/ /doi.or g/10.11 77/1 7455057221111315 36. Vatsa R, Sethi A (2021) Impact of endometriosis on female fertility and the management options for endometriosis-related infertility in reproductive age women: a scoping review with recent evidences. Middle East Fertil Soc J 26(1):36. https:/ /doi.or g/10.11 86/s 43043-021-00082-3 37. Zhang H, Sheng S, Pan Z, Zhao L, Yang C, Li C, Wang F (2023) Immune and endocrine regulation in endometriosis: what we know. J Endometriosis Uterine Dis 4:100049. https: //d oi. or g/10 . 1 016 /j.j eud.2023.100049 Publisher's Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.