{"paper_id":"c986a24c-63b4-4ddd-94a1-a69bc7fffc1d","body_text":"RESEARCH Open Access\nMiddle East Fertility\nSociety Journal\nBaskar et al. Middle East Fertility Society Journal           (2026) 31:60 \nhttps://doi.org/10.1186/s43043-026-00350-0\nGenetic and statistical analysis of ESR1 \nvariants in endometriosis-related infertility: \na case–control study from South India\nBhavani Baskar1, Sheena Mariam Thomas1, Jethendra Kumar Muruganantham1, B. K. Iyshwarya1, R. S. Akram Husain1, \nP . Surya2 and Ramakrishnan Veerabathiran1*\n  * C o r r e s p o n d e n c e :  \nRamakrishnan Veerabathiran\nrkgenes@gmail.com\n1Human Cytogenetics and Genomics Laboratory, Faculty of Allied Health \nSciences, Chettinad Hospital and Research Institute, Chettinad Academy \nof Research and Education, Kelambakkam, Tamil Nadu 603103, India\n2Department of Andrology & Reproductive Medicine, Chettinad Super \nSpeciality Hospital, Chettinad Hospital and Research Institute, Chettinad \nAcademy of Research and Education, Kelambakkam, Tamil Nadu  \n603103, India\n© The Author(s) 2026. Open Access  This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, \nsharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and \nthe source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this \narticle are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included \nin the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will \nneed to obtain permission directly from the copyright holder. To view a copy of this licence, visit  h t t  p : / /  c r e  a t  i v e c o m m o n s . o r g / l i c e n s e s / b y / 4 . 0 /     .    \nAbstract\nBackground Endometriosis, defined by the abnormal growth of endometrial-like tissue outside the uterus, impacts \n6–10% of women of reproductive age and is a significant contributor to infertility. The Estrogen Receptor 1 (ESR1) \ngene is integral to estrogen-dependent signalling pathways, and variations in this gene have been associated with an \nincreased susceptibility to endometriosis.\nMethods This study investigated the relationship between two polymorphisms in the ESR1 gene (rs9340799 and \nrs2234693) and infertility associated with endometriosis in South Indian women. The research involved three groups: \ninfertile women diagnosed with endometriosis, infertile women without the condition, and fertile women serving as \ncontrols. Genotyping was performed using PCR, and statistical analyses assessed genotype distributions. Additionally, \nin silico analyses were conducted using GeneMANIA and STRING to examine ESR1-related gene–gene and protein–\nprotein interaction networks.\nResults Among the 163 subjects studied, no significant association was observed between either ESR1 SNP and \ninfertility related to endometriosis across all genetic models. In silico analysis revealed that ESR1 participates in \nbiologically meaningful networks, interacting with multiple genes and proteins involved in hormonal signalling, \ntranscriptional regulation, and reproductive functions, supporting its functional relevance in endometriosis pathways.\nConclusion Although ESR1 variants rs9340799 and rs2234693 were not statistically associated with endometriosis-\nrelated infertility in this population, bioinformatics analyses underscored ESR1's role in regulatory networks related \nto estrogen signalling. These findings warrant further large-scale and functional studies integrating both genetic \nassociation and molecular pathway data to better understand ESR1's contribution to endometriosis.\nKeywords Endometriosis, Infertility, Gene polymorphism, Polymorphism, Genetics\n\nPage 2 of 13\nBaskar et al. Middle East Fertility Society Journal            (2026) 31:60 \n Introduction\nEndometriosis (EM) is an inflammatory condition caused \nby estrogen hormone, where endometrial glands and \nstromal cells are found outside the uterus [ 14] Shigesi \net al. 26. Besides lesion development, endometriosis is \nknown for causing estrogen dysregulation, inflammation, \nimmune cell dysfunction, angiogenesis and tissue mod -\nelling that cause pelvic pain, infertility, and decrease the \npatient's quality of life. There is mounting evidence show-\ning that estrogen signalling pathways are responsible for \nendometriotic lesions. As a result, genes such as ESR1 are \nconsidered critical in the development of endometriosis \n[6]. Ectopic endometrial tissue refers to endometrial tis -\nsue that grows outside of the uterus. These lesions are \nmost commonly found in areas such as the pelvic peri -\ntoneum, cervix, uterosacral ligaments, fallopian tubes, \nthe pouch of Douglas, rectum, and colon [ 29]. Distant \norgans, such as the lymph nodes, lungs, and umbilicus, \noften exhibit EM. It is believed that retrograde menstrua-\ntion, as well as immunologic abnormalities and perito -\nneal dysfunction, is the main cause [ 19]. According to \nthe data from WHO (2024), endometriosis, polycystic \novary syndrome, tubal factor, other anatomical reasons, \nand unexplained infertility are the primary illnesses that \nimpact female infertility [ 10]. Endometriosis is estimated \nto affect around 247 million girls and women worldwide, \nand an estimated 42 million Indian women are affected, \nequivalent to roughly 10% of those aged 18 to 45. The \nestimation of the prevalence rate for endometriosis in \nIndia ranges from 10 to 18%, depending on age group; \nthis variation may convey the demographic/economic \nvariances that exist within the overall female population's \nreproductive age. An increased prevalence of infertil -\nity and chronic pelvic pain among women presenting to \nthe clinics has also been noted, with evidence suggesting \nan association between endometriosis and infertility; the \nevidence that exists does suggest significant clinical rel -\nevance of these findings for women living in South India \n[8].\nEndometriosis is also caused by environmental chemi -\ncals such as dioxin, which mimics estrogen and functions \nby connecting with estrogen receptors [ 8]. It impacts \nbetween 6 and 10% of women aged 18 to 40, the typi -\ncal reproductive age range. Because EM needs an inva -\nsive method for confirmation, the actual prevalence rate \nremains unknown [ 25]. This disorder may produce dis -\ntressing symptoms, including dysmenorrhea, infertility, \npelvic discomfort, and dyspareunia [ 34]. Alternatively, it \nmay present without any symptoms and be incidentally \ndetected during a laparoscopic procedure [ 31]. Lifestyle \nmodifications, environmental variables, exposure to pol -\nlutants, immunological and hormonal factors, as well \nas several other elements, are possible additional causal \nfactors crucial in the disease's progression [ 37]. Ovarian \nendometriosis is an estrogen-dependent cystic area that \ndevelops in women of reproductive age and inhibits \nfemale fertility due to oocyte quality problems. Trans -\nvaginal ultrasound monitoring can quickly detect ovar -\nian endometriosis [ 7, 36]. Age, lifestyle, and peritoneal \nimplants are associated with ovarian forms, which grow \ninto endometriomas. This is mainly found on the left \novary due to peritoneal implants. It can be uninoculated \nor multiloculated, depending on the number of implants \n[2].\nThe discovery of genetic variables contributes to a \nbetter understanding of the disease's underlying biol -\nogy. The basic strategy for investigating the underlying \nprocesses and causes of endometriosis is to identify and \ncomprehend the roles of the genetic variations respon -\nsible for the heritable component [ 33]. It has a polygenic \ninheritance, encompassing many loci and chromosomal \nregions associated with the disease [ 4]. The ESR1 gene \nspans almost 300 kilobases and comprises non-coding 5' \nUTR exons and coding exons [ 13]. The estrogen recep -\ntor protein has over 597 amino acids, with several splice \nvariants that help form dimers with the wild type, hence \nmodifying receptor activity [24].\nThe ESR1 gene encodes an estrogen receptor with vari -\nous domains essential for DNA binding and transcription \nactivation. Estrogen receptors in humans were divided \ninto Alpha and Beta, encoded by the ESR1 and ESR2 \ngenes, respectively. These estrogen receptor alpha pro -\nteins are thought to be estrogen-signalling mediators that \nserve as ligand-dependent transcription factors [24, 28].\nThe hormone estrogen is a crucial element in the devel-\nopment of endometriosis since it supports proliferation, \nsurvival and invasion of ectopic endometrial tissue. It \nwas suggested that all biological events, such as endo -\nmetrial proliferation, differentiation of cells, immune \nresponse and angiogenesis, were regulated by the ESR1-\nmediated signalling pathway, thus affecting the growth \nand advancement of the endometriotic lesions. The alter-\nation of ESR1 expression level modulates the estrogen \nresponsiveness of the endometrium and ectopic tissue, \ndetermining the level of disease susceptibility and sever -\nity. In addition, aberrant estrogen signalling in endome -\ntriosis can also be responsible for deficient endometrial \nreceptivity, aberrant folliculogenesis and infertility. For \nthis reason, gene polymorphisms linked to the ESR1 gene \ncould explain differences among women as regards sus -\nceptibility to endometriosis and its related complications \n[32].\nThe SNPs rs9340799 and rs2234693 are within intron 1 \nof the ESR1 gene on chromosome 6q25 and exhibit link -\nage disequilibrium. Despite their location in an intron \nand lack of impact on the amino acid sequence, they \ncould potentially modulate ESR1 gene expression directly \nor be associated with unidentified causal DNA sequence \n\nPage 3 of 13\nBaskar et al. Middle East Fertility Society Journal            (2026) 31:60 \nvariants. Introns have diverse implications for gene \nexpression, potentially influencing alternative splicing via \nenhancer elements or promoters and regulating various \ncis- and trans-acting elements that may result in different \nprotein isoforms [ 27, 30]. EM has a genetic component \nwith certain genetic variations implicated in its develop -\nment. Research suggests that variations in genes involved \nin hormone regulation, inflammation, and tissue growth \nmay contribute to an individual's susceptibility to devel -\noping EM. Nevertheless, additional research is required \nto gain a comprehensive understanding of the genetic \nfactors involved. Beyond predisposition to the condition, \nother recent advancements within reproductive medicine \nseek to enhance fertility success for women with endo -\nmetriosis. One interesting adjunctive therapeutic that has \nbeen researched for this use is nutraceutical supplemen -\ntation with inositol, given its participation in signalling, \novarian physiology and reproductive functions. Inositols \nhelp manage metabolism and inflammatory responses for \nmore successful oocyte and follicle formation and matu -\nration, improving outcomes and promoting reproductive \nhealth for infertile women. Infertility preservation, in \nwomen affected by endometriosis, has become increas -\ningly important prior to invasive reproductive sparing \nsurgeries. Coordinated intervention, including GnRH \nantagonists in conjunction with oocyte vitrification fol -\nlowing controlled ovarian stimulation, has shown prom -\nise for preserving female reproductive potential while \nlimiting the detrimental effect of this intervention on the \novarian reserve. More recent work has also highlighted \nthe necessity for a holistic approach involving genetic, \nmolecular and reproductive interventions when address -\ning endometriosis-related infertility [ 5, 22]. Our study \naims to investigate the genetic factors that influence \ninfertility, both with and without endometriosis, and to \nevaluate the associations between gene polymorphisms \nand fertile control groups.\nMethods\nStudy subjects\nThis study was done during the years 2017–2020 after \ngetting clearance from the Institutional Human Eth -\nics Committee of Chettinad Academy of Research and \nEducation (Proposal No:115/IHEC/12—16). The full \nintent and nature of the study were explained to all the \nparticipants at the time of sampling, and consent was \ntaken from each participant with informed understand -\ning. This was a case control study and consisted of three \nsets of participants (i) infertile women with a confirmed \ndiagnosis of endometriosis ( n = 39) (ii) infertile women \nwithout endometriosis (n = 43) (iii) Fertile control women \n(n = 81). An abdominal or transvaginal ultrasound was \nnecessary to confirm ovarian endometriomas, and diag -\nnostic laparoscopy was essential to confirm peritoneal \nendometriosis. The introduction of a second comparator \ngroup of fertile women without endometriosis provided \na way to distinguish between the genetics of endometrio -\nsis per se and infertility per se. Therefore, this provided \na potential method to analyze the impact of ESR1 poly -\nmorphisms on endometriosis-related infertility without \nthe potential confounders of infertility. Peripheral blood \nsamples were obtained from individuals who fulfilled \nthe inclusion criteria. Venipuncture was used to obtain \napproximately 5  mL of blood, which was then kept in \nan EDTA tube at 4 °C. Participants were recruited from \nthe Department of Andrology and Reproductive Medi -\ncine in the Institute, along with additional fertility cen -\ntres located in Chennai. For identification, each sample \nwas assigned a group code with a numerical label during \nsample processing. The SNPs rs9340799 and rs2234693 \nwere selected based on their previous association with \nEM in different geographical regions and their impact on \ndisease mechanisms.\nInclusion criteria\nThis study enrolled women aged 20 to 40 years. The case \ngroup consisted of infertile women with endometriosis \non transvaginal ultrasound and/or laparoscopic exami -\nnation. The non-diseased infertile controls consisted of \ninfertile women without signs of endometriosis on either \nclinical evaluation or radiologic imaging. The fertile con -\ntrols consisted of fertile women with at least 2 live births \nand no history of infertility or endometriosis. Fertile \ncontrols were obtained from women who attended the \nhospitals for routine gynecologic evaluations and physi -\ncal examinations. All subjects who agreed to participate \nwere enrolled in the study.\nExclusion criteria\nExclusion criteria included women with a history of sex -\nually transmitted infections (STIs) and HIV infection, \ncancer, autoimmune diseases, chronic systemic diseases, \nhormonal disorders (not endometriosis) or a history of \ngynecological surgery that could affect reproductive out -\ncome, or contraindications for informed consent or poor \nclinical data.\nGenomic DNA isolation and PCR amplification for \ngenotyping SNPs\nParticipants meeting the inclusion criteria provided \n5 mL of peripheral blood, from which genomic DNA was \nextracted using the salting-out method [ 11]. The DNA \nconcentration and purity were assessed using a UV–vis -\nible spectrophotometer. Primers specific to the selected \nSNPs (rs9340799 and rs2234693) were designed using \nthe Tetra 1 primer tool and validated with an oligo (dt) \ncalculator. The finalized primer sequences are presented \nin Table  1. PCR amplification was conducted using the \n\nPage 4 of 13\nBaskar et al. Middle East Fertility Society Journal            (2026) 31:60 \nsuch an association is present. This analysis was con -\nducted using metadata within a 95% confidence inter -\nval, ensuring that the study results accurately reflect the \nactual effect in the general population. An alpha level \nof 0.05 was applied, indicating a 5% probability that any \nobserved association may have occurred by chance rather \nthan due to a real genetic link. The sample size for each \nstudy, including cases (individuals diagnosed with endo -\nmetriosis) and controls (healthy participants), was inde -\npendently evaluated for the ESR1 gene polymorphisms. \nThe statistical power of each dataset was calculated using \nG*Power 3.1 software to confirm that the results were \nunlikely to be attributed to random variability.\nBioinformatics-based investigation\nGene–gene interaction and pathway analysis\nThe gene–gene interaction networks relevant to endo -\nmetriosis were examined using the GeneMANIA online \nplatform. A curated list of genes, including ESR1, was \ninput to generate a comprehensive interaction map. Only \ngene interactions with correlation scores of ≥ 0.4 were \nconsidered biologically meaningful. The Gene Ontology \n(GO) database was utilized to extract detailed informa -\ntion on the involved cellular components, molecular \nfunctions, and biological processes. These insights helped \nclarify the roles of ESR1 and its associated genes in path -\nways related to endometriosis.\nProtein–protein interactions (PPI)\nTo investigate protein-level associations, STRING v11.0, \nan online database, was employed to predict func -\ntional relationships between proteins, including those \npotentially affected by the ESR1 SNPs rs9340799 and \nrs2234693. Protein interactions were analyzed using a \nminimum confidence score threshold of 0.4.\nGenotyping validation by sanger sequencing\nIn order to authenticate the genotypes derived through \nTetra-ARMS PCR, relevant samples from cases and con -\ntrols relevant to the observed genotypes were picked, and \nSanger sequencing was performed. The PCR amplified \nfollowing thermal cycling conditions: an initial dena -\nturation at 92  °C for 5  min, followed by 35 cycles com -\nprising denaturation at 94 °C for 45 s, annealing at 62 °C \nfor 45  s, and extension at 72  °C for 45  s, concluding \nwith a final extension step at 72  °C for 5  min. For each \nSNP , the ARMS-PCR reaction mixture consisted of 3 \nµL of genomic DNA, 5 µL of master mix, 1 µL of dis -\ntilled water, and 0.5 µL each of the outward forward and \nreverse primers.\nStatistical analysis\nThe mean and standard deviation were calculated for key \ndemographic parameters. Hardy–Weinberg equilibrium \n(HWE) was assessed in the control group for each poly -\nmorphic site to ensure genetic consistency. Chi-square \ntests were employed to assess variations in genotype dis -\ntribution between the patient and control groups, and \nodds ratios (ORs) with 95% confidence intervals (CIs) \nwere computed to determine the strength of the associa -\ntion. Additionally, a p-value of less than 0.05 indicated \nthat the disparity was statistically significant.\nSample size estimation\nThe sample size was estimated using the formula:\n N = p(1− p)(Z/E)2\nwhere p represents the estimated prevalence of endome -\ntriosis, Z corresponds to the standard normal deviate at \na 95% confidence interval (1.96), and E denotes the mar -\ngin of error (0.05). Based on the reported prevalence of \nendometriosis among women of reproductive age, the \nminimum sample size required for the study was calcu -\nlated. Considering participant availability and eligibil -\nity criteria during the study period, a total of 39 infertile \nwomen with endometriosis, 43 infertile women without \nendometriosis, and 81 fertile controls were recruited.\nPower analysis\nA power analysis was performed to assess the prob -\nability of identifying a true genetic association, assuming \nTable 1 Designed primer sequences of ARMS-PCR\nName Primer Sequence [5' to 3'] Total no of bases Allele PCR product size\nESR1 Gene (rs9340799)\n Inner Forward GTTTCCCAGAGACCCTGAGTGTGGTATG 28 G 239\n Inner Reverse TAGAGACCAATGCTCATCCCAACGCT 26 A 270\n Outer Forward AACCACCATGCTCAGTCTCTACATGTTCC 29 - 455\n Outer Reverse GTCTGTTGCAGCAAAAGGTGTTGCCTAT 28 -\nESR1 Gene (rs2234693)\n Inner Forward TTCATCTGAGTTCCAAATGTCCCATCC 27 C 246\n Inner Reverse CTGGGAAACAGAGACAAAGCATAAACCA 28 T 277\n Outer Forward TTAAACAATTCTCCTGCTTTGGCCTCC 27 - 468\n Outer Reverse TTGAGGGGAAATTGTTTATTGCAAACTTG 29 -\n\nPage 5 of 13\nBaskar et al. Middle East Fertility Society Journal            (2026) 31:60 \nproduct was bidirectionally sequenced by the con -\nventional Sanger sequencing method. The chromato -\ngrams were observed through the Chromas software, \nand sequence alignment was performed with the help \nof the BLAST tool (NCBI) in order to authenticate the \npolymorphisms of concern. Late-acquired sequences \nwere compared with their respective Tetra-ARMS PCR \ngenotypes.\nResults\nDemographic and clinical characteristics of study subjects\nThe demographic and clinical variables are presented for \na more realistic interpretation of the data in Table  2. The \nstudy included a total of 163 participants, consisting of 39 \ninfertile women with endometriosis, 43 infertile women \nwithout endometriosis, and 81 fertile control subjects. \nThe mean ages of the healthy controls were 36.26 ± 8.9, \n40 ± 6.2, and 38 ± 7.3, respectively. Overall, this study's \nfindings show no evident difference in mean age between \nwomen experiencing infertility associated with endo -\nmetriosis and patients with infertility without endome -\ntriosis. However, the mean age of the infertile patients in \nboth groups was slightly higher than that of the healthy \ncontrols. The mean BMI was notably higher in infer -\ntile women with endometriosis (29.4 ± 7.3) compared to \ninfertile women without endometriosis (27.7 ± 6.4) and \nthe healthy control group (22.5 ± 4.3). Compared to infer-\ntile patients without endometriosis and healthy controls, \ninfertile patients with endometriosis showed significantly \nhigher BMI values. The study found a significant asso -\nciation between regular and irregular menstrual cycles \nacross all three groups ( p = 0.01). Menarche age, first \nchildbirth age, and family history of endometriosis are \nmerely a few of the various additional factors that may be \nrelevant.\nStatistical analysis: allelic and genotypic frequencies for \nboth the polymorphism\nThe DNA examinations of the three groups were most \nlikely carried out using ARMS-PCR to amplify specific \nDNA sequences that differed from one another. The \nprimers used to amplify the DNA sequences are shown \nschematically in Figs.  1 and 2 of the ARMS-PCR pro -\ncedures, along with the expected sizes of the amplified \nfragments. Tables 3 & 4 present the genotypic and allelic \nfrequencies of the study population for rs9340799 and \nrs2234693. The first SNP of the ESR1 gene, rs9340799, \nhas a variation from A to G. The G allele was observed \nin 33.3% of the endometriosis group, 22% without endo -\nmetriosis, and 27.1% in controls. This suggests that the G \nallele may be associated with a higher likelihood of devel-\noping endometriosis. The evaluation of the rs9340799 \npolymorphism with and without EM shows an insig -\nnificant association with the G allele (OR = 0.55 [95% CI \n(0.28–1.13)], p = 0.10). Similarly, homozygous recessive \n(GG) shows an insignificant association (OR = 0.45 [95% \nCI (0.10–1.98)], p = 0.2), while the groups without EM \nand control groups show an insignificant association \nin the G allele (OR = 1.31 [95% CI (0.71–2.43)], p = 0.38. \nSimilarly, homozygous recessive (GG) shows an insignifi-\ncant association (OR = 1.14 [95% CI (0.29–4.47), p = 0.84]; \nTable 2 Demographic characteristics of cases and controls\nS. \nno\nFactors Infertile \nwith Endo-\nmetriosis\n[N = 39]\nInfertile \nwithout En-\ndometriosis \n[N = 43]\nControls\n[N = 81]\np- \nvalue\n1 Age 22 23 13  > 1\n25–30\n31–35 10 12 18\n36–40 07 08 50\nMean age 36.26 ± 8.9 40 ± 6.2 38 ± 7.3\n2 BMI 25 28 50 0\nNormal\nObese 14 15 31\nMean BMI 29.4 ± 7.3 27.7 ± 6.4 22.5 ± 4.3\n3 Cause of \nInfertility\n39 - - -\n4 Menstrual \ncycles\n14 16 45 0.01*\nRegular\nIrregular 25 27 36\nData are presented as mean ±SD\nNA Not Applicable\n*denotes statistically significant data\nFig. 1 Gel showing the amplified product of the ESR1 rs9340799 polymorphism analysis on 2% agarose gel\n \n\nPage 6 of 13\nBaskar et al. Middle East Fertility Society Journal            (2026) 31:60 \nthe inconsequence association in with EM and control \ngroups, G allele (OR = 0.74 [95% CI (0.41–1.33), p = 0.32, \nwhile in homozygous recessive (GG) shows OR = 0.52 \n[95% CI (0.15–1.70), p = 0.28.\nThe second SNP , rs2234693, has a variation from C to \nT. The T allelic frequencies observed in the study groups \nwere 38.4%, 32.5%, and 40.1% in EM, infertile women \nwithout endometriosis, and control subjects, respec -\ntively. The analysis of the rs2234693 polymorphism with \nand without EM shows an insignificant association with \nthe T allele (OR = 0.77 [95% CI (0.40–1.46)], p = 0.43). \nSimilarly, homozygous recessive (TT) shows an insig -\nnificant association (OR = 0.66 [95% CI (0.19–2.33)], \np = 0.52), while the groups without EM and control show \nan irrelevant correlation with the T allele (OR = 1.38 [95% \nCI (0.80–2.40)], p = 0.24). Similarly, homozygous reces -\nsive (TT) shows an insignificant association (OR = 1.82 \n[95% CI (0.61–5.39), p = 0.27]; the inconsequence associ -\nation in with EM and control groups, allele T (OR = 1.07 \n[95% CI (0.61–1.86), p = 0.80, while in homozygous reces-\nsive (TT) shows OR = 1.21 [95% CI (0.42–3.46), p = 0.71 \nrespectively. The results may be inconclusive if the sam -\nple size is inadequate to detect a link between an SNP \nand a trait. A more extensive study with a larger sample \nsize would be necessary to conduct a more in-depth \nassessment. Other potential impacts on the trait, such \nas environmental factors and genetic variants, should be \nexplored in future studies. DNA samples from each group \nof ESR1 variants, including rs9340799 and rs2234693, \nwere sequenced to confirm the presence of allele-specific \nDNA fragments. The sequence of DNA samples produces \nallele-specific DNA fragments. Figures  3 and 4 illustrate \nthe DNA sequencing electropherogram of both SNPs.\nPower analysis\nA power analysis was conducted to evaluate the sta -\ntistical validity and robustness of each included study \nconcerning the selected ESR1 gene polymorphisms \n(rs9340799 and rs2234693), as depicted in Fig.  5. The \nanalysis aimed to determine whether the sample sizes \nwere sufficient to achieve the designated level of statisti -\ncal significance, with an alpha error probability of 0.05. \nTable 3 Association of rs9340799 polymorphism with three distinct groups\nPolymorphisms: rs9340799(A > G) Infertile women with En-\ndometriosis (N = 39 (%)\nInfertile women without \nEndometriosis (N = 43 (%)\nOR 95% CI p-\nval-\nue\nAllele A 52 (66.6) 67 (77.9) Reference 0.10\nG 26 (33.3) 19 (22) 0.55 0.28 −1.13\nGenotype AA 21 (53.8) 28 (65.1) Reference 0.7\nAG 10 (25.6) 11 (25.5) 0.83 0.3—2.30\nGG 08 (20.1) 04 (9.3) 0.45 0.10–1.98 0.2\nInfertile women without \nEndometriosis (N = 43(%)\nControls (N = 81(%)\nAllele A 67 (77.9) 118 (72.8) Reference 0.38\nG 19 (22) 44 (27.1) 1.31 0.71–2.43\nGenotype AA 28 (65.1) 47 (58) Reference\nAG 11 (25.5) 24 (29.6) 1.29 0.55–3.05 0.54\nGG 04 (9.3) 10 (12.3) 1.14 0.29–4.47 0.84\nInfertile women with en-\ndometriosis (N = 39(%)\nControls (N = 81(%)\nAllele A 52 (66.6) 118 (72.8) Reference 0.32\nG 26 (33.3) 44 (27.1) 0.74 0.41–1.33\nGenotype AA 21 (53.8) 47 (58) Reference 0.87\nAG 10 (25.6) 24 (29.6) 1.07 0.43–2.63\nGG 08 (20.1) 10 (12.3) 0.52 0.15–1.70 0.28\nFig. 2 Gel showing the analysis of the amplified product of ESR1 rs2234693 polymorphism on 2% agarose gel\n \n\nPage 7 of 13\nBaskar et al. Middle East Fertility Society Journal            (2026) 31:60 \nThis approach estimates the probability of identifying a \ntrue genetic association based on specific parameters, \nincluding sample size, effect size, and the significance \nthreshold. The results confirmed that the majority of the \nreviewed studies had adequate sample sizes to reach the \nrequired power, indicating a high likelihood of detecting \nactual genetic effects if present. Consequently, the stud -\nies were sufficiently powered to identify significant asso -\nciations between the ESR1 variants and susceptibility to \nendometriosis, thereby reducing the risk of Type II error \n(false negatives). This strengthens the credibility and reli-\nability of the findings, supporting the conclusion that the \nreported genetic associations are both statistically and \nbiologically meaningful.\nBioinformatics-based investigation results\nGene–gene interaction analysis using geneMANIA\nUsing Gene Ontology (GO) classification, we further cat -\negorized these associated genes based on their involve -\nment in key cellular components, molecular functions, \nand biological processes relevant to endometriosis. This \nintegrative approach enabled a comprehensive under -\nstanding of the functional roles and interconnectedness \nof ESR1-related genes within disease-specific pathways, \nas illustrated in Fig. 6. This method significantly enhanced \nour understanding of the complex genetic architecture \nand molecular mechanisms underlying endometriosis.\nPPI network evaluation\nThe protein–protein interaction (PPI) network generated \nusing the STRING v11.0 database comprised 11 nodes \nand 50 edges, with an average node degree of 9.09 and \na clustering coefficient of 0.914. The analysis yielded a \nhighly significant PPI enrichment p-value of 9.83 × 10–7 , \nindicating that the observed protein interactions are sig -\nnificantly more frequent than would be expected from a \nrandom protein set of comparable size and degree distri -\nbution. This significant enrichment implies that the pro -\nteins are functionally and biologically interconnected as a \ngroup. Figure  7 presents the detailed protein interaction \nnetwork centring on ESR1, highlighting its interactions \nand the potential functional implications in the patho -\ngenesis of endometriosis. These visualizations provide \ncompelling evidence that the ESR1-associated proteins \nform a biologically meaningful network rather than a \nrandom collection, reinforcing the functional significance \nof these molecular interactions Fig. 8.\nDiscussion\nSeveral factors contribute to the pathogenesis of endo -\nmetriosis, but estrogen and its receptor play a significant \nrole [18]. Endometriosis has been studied concerning ste-\nroid hormone receptors and their potential function. A \nkey role is played by estrogen receptor alpha, encoded by \nTable 4 Association of rs2234693 polymorphism with three distinct groups\nPolymorphisms\nrs2234693(C > T)\nInfertile women with Endometriosis (N = 39 (%) Infertile women without Endometriosis (N = 43 (%) OR 95% CI p-value\nAllele C 48 (61.5) 58 (67.4) Reference 0.43\nT 30 (38.4) 28 (32.5) 0.77 0.40–1.46\nGenotype CC 18 (46.1) 22 (51.1) Reference 0.92\nCT 12 (30.7) 14 (32.5) 0.95 0.35–2.57\nTT 09 (23) 07 (16.2) 0.66 0.19–2.33 0.52\nInfertile women without Endometriosis (N = 43(%) Controls (N = 81(%)\nAllele C 58 (67.4) 97 (59.8) Reference 0.24\nT 28 (32.5) 65 (40.1) 1.38 0.80–2.40\nGenotype CC 22 (51.1) 37 (45.6) Reference 0.95\nCT 14 (32.5) 23 (28.3) 0.97 0.41–2.28\nTT 07 (16.2) 21 (25.9) 1.82 0.61–5.39 0.27\nInfertile women with endometriosis (N = 39(%) Controls (N = 81(%)\nAllele C 48 (61.5) 97 (59.8) Reference 0.80\nT 30 (38.4) 65 (40.1) 1.07 0.61–1.86\nGenotype CC 18 (46.1) 37 (45.6) Reference\nCT 12 (30.7) 23 (28.3) 0.93 0.38–2.28 0.87\nTT 09 (23) 21 (25.9) 1.21 0.42–3.46 0.71\n\nPage 8 of 13\nBaskar et al. Middle East Fertility Society Journal            (2026) 31:60 \nthe ESR1 gene, when estrogen binds to tissues via estro -\ngen receptor subtypes (alpha and beta). Several studies \nhave confirmed this assumption in regular and endome -\ntriosis patients. The estrogen receptor alpha is expressed \ndifferently in endometriosis samples, hinting that estro -\ngen is mediated by the receptor alpha in endometriosis \n[3].\nTo the best of our knowledge, this is the first report \nwhich assessed the link between ESR1 rs9340799 and \nrs2234693 polymorphisms and endometriosis-associ -\nated infertility in South Indian women. In the present \nstudy, no association was observed between either of the \nstudied polymorphisms and the risk for endometriosis-\nassociated infertility. The genotype and allele frequen -\ncies in infertile women with endometriosis, infertile \nwomen without endometriosis and fertile controls were \nnot found to be statistically different from one another. \nHence, the ESR1 variants studied in the present study \nFig. 5 The graphical representation of a power analysis plot depicts how statistical power is affected by either the sample size or effect size in a two-tailed \nhypothesis test for the ESR1 rs9340799 and rs2234693 gene polymorphisms\n \nFig. 4 DNA sequence electropherogram of rs2234693 polymorphism\n \nFig. 3 DNA sequence electropherogram of rs9340799 polymorphism\n \n\nPage 9 of 13\nBaskar et al. Middle East Fertility Society Journal            (2026) 31:60 \nmight not be major genetic risk factors for endometrio -\nsis-associated infertility in the present study group.\nA comparison of endometriosis patients' lesions with \nnormal ovaries revealed the presence of 17-hydroxys -\nteroid dehydrogenase type 2 (17β-HSD2) and Cyto -\nchrome P450 aromatase ( CYP19). As a result of both \nenzymes, 17 estradiol is eventually produced, which is \nthen released into the bloodstream as estrogen. Endo -\nmetriosis may be an estrogen-dependent illness because \nestrogen stimulates endometrial development in patients \nwith the disease [ 9]. In various populations with differ -\ning sample sizes and detection techniques, several studies \nhave investigated ESR1 and ESR2 gene polymorphisms to \ndetermine whether these polymorphisms are associated \nwith endometriosis and endometriosis-related infertil -\nity, including ER-XbaI, PvuII, and ER-AluI [12]. Japanese \nwomen and other Asian populations have a greater prev -\nalence rate, but African women have a lower incidence \nrate when compared to Caucasian women. A significant \namount of attention has been given to rs9340799 (A > G) \nand rs2234693 (C > T), both of which are single-nucleo -\ntide polymorphisms of the estrogen receptor. Research \non the influence of ESR1 gene polymorphisms on endo -\nmetriosis-associated infertility remains limited across \nvarious populations [35]. There is evidence that the estro-\ngen receptor variant is positively associated with repro -\nductive issues because of endometriosis in Asians and \nCaucasians, while some researchers have reported a lack \nof association. Studies focusing on the Indian popula -\ntion have not been documented so far. This investigation \naims to examine the potential link between ESR1 gene \npolymorphisms and endometriosis-related infertility, \nexplicitly targeting the rs9340799 and rs2234693 variants \nwithin the ESR1 gene.\nSingle-nucleotide polymorphisms (SNPs) within the \nintronic region can alter transcriptional regulation events \nby introducing errors in splicing or disrupting regulatory \nFig.  7 The Protein–Protein Interaction (PPI) network of differentially ex -\npressed genes (DEGs) of the selected gene associated with endometriosis\n \nFig. 6 The gene-to-gene interaction of various genes in association with ESR1 in endometriosis subjects\n \n\nPage 10 of 13\nBaskar et al. Middle East Fertility Society Journal            (2026) 31:60 \nelements. Endometriosis is associated with genetic poly -\nmorphisms, including the immune system, galactose \nmetabolism, and nuclear receptor polymorphisms [ 35]. \nStudies have shown that polymorphisms in estrogen \nreceptor alpha can regulate estrogen activity. An ances -\ntral allele C has been changed to an ancestral allele T in \nthe PvuII SNP (rs2234693). A first intronic region con -\ntaining both polymorphisms has been found [ 17]. There \nis a polymorphism in the PvuII gene (rs2234693) that \nresults in the termination of the DNA sequence binding \nsite for the transcription factor activator protein (AP-4) \n[35]. Endometriosis, breast cancer, osteoporosis, and \nAlzheimer's disease have all been associated with these \npolymorphisms. XbaI and PvuII are the most robustly \nassociated ESR1 gene variations with prostate cancer.\nThis mutation is located on the first intronic region of \nchromosome 6q25 at the rs9340799 (A-351G) position. \nThis polymorphism causes no amino acid changes in the \nintronic region but has a direct impact on gene expres -\nsion. Numerous cis and trans regulatory elements in \nthe Intronic region regulate splicing and encourage the \nproduction of distinct protein isoforms due to polymor -\nphisms in this region [ 1]. We investigated the outcomes \nof the present study, which indicated that the ESR1 gene \nrs9340799 and rs2234693 polymorphisms showed no \nsignificant relationship with disease susceptibility in any \nof the three studied groups: those with EM, those with -\nout EM, and the control groups.  Similar results were \nobserved in Japanese and Korean populations [ 35]. In \ncontrast, a 2013 study of the Brazilian population found \na significant association between ESR1 (rs9340799) gene \npolymorphisms and infertility in women with endome -\ntriosis ( p < 0.001). Likewise, a study among the Japanese \npopulation also showed that the C allele had a higher \nincidence compared to controls without endometrio -\nsis and was significantly associated ( p = 0.017) [16]. This \npolymorphism has been shown to have a significant asso-\nciation with other diseases, such as endometrial cancer \n[23]. Hence, the results obtained in the present study are \nsimilar to those obtained from several populations from \nEast Asia, but are different from those from some other \npopulations. The results might be affected by various eth-\nnic and geographic variations, different sample sizes and \npossible interaction between genes. Although no statis -\ntically significant relation between polymorphisms of \nESR1 and infertility in endometriosis was found in the \npresent study, a key role of estrogen signalling in repro -\nduction is well documented. It is widely recognized that \nfactors responsible for endometriosis-associated infertil -\nity include interactions among endocrine, inflammatory, \noxidative stress and genetic factors. Promising advances \nhave been observed in new therapeutic options aimed \nat treating inflammatory pathways, enhancing repro -\nductive outcomes and decreasing disease progression. \nAlong with these therapies, inositol supplementation \nhas gained considerable attention for improving ovarian \nfunction and enhancing oocyte competence and fertility \noutcome of infertile women undergoing assisted repro -\nductive technologies. These observations suggest that \nwhen assessing the prognosis of women with endome -\ntriosis, considering genetic susceptibility together with \nFig. 8 Bubble plot showing enriched biological processes based on Gene Ontology analysis, in which bubble size represents gene count, and color \nindicates FDR significance\n \n\nPage 11 of 13\nBaskar et al. Middle East Fertility Society Journal            (2026) 31:60 \nmolecular and therapeutic variables is an appropriate \napproach [5, 15, 21].\nSeveral reasons for the failure to detect significant asso-\nciation in the present study may include ethnicity-depen-\ndent genetic architectures, variations in allele frequencies \namong different populations, gene–gene interactions, \ngene-environment interactions, and relatively small sam -\nple size. Endometriosis is a complex, multifactorial dis -\nease determined by various genetic and environmental \nfactors, and single gene polymorphisms may contribute \nonly a small fraction to the risk of the disease.\nEven though this study did not identify a statistically \nsignificant link between these ESR1 SNPs and endo -\nmetriosis-related infertility in the South Indian cohort, \nfunctional and computational analyses suggest their \ncontinued relevance. Our in-silico investigations, using \nGeneMANIA and STRING, highlighted ESR1's integra -\ntion into a dense biological network with other genes \nand proteins implicated in hormone receptor activ -\nity, transcription regulation, and cell proliferation. The \nprotein–protein interaction (PPI) network generated \nthrough STRING demonstrated a strong enrichment of \nESR1 interactions ( p-value = 9.83 × 10–7 ), indicating non-\nrandom, biologically meaningful associations.\nFurthermore, Gene Ontology (GO) enrichment analy -\nsis revealed that ESR1 and its interacting partners are \ninvolved in critical pathways, including steroid hormone \nreceptor activity, transcription coactivator binding, and \nreproductive development. These computational findings \nsupport the biological plausibility of ESR1 as a key regu -\nlator in endometrial tissue dynamics, even in the absence \nof significant genotype–phenotype correlations in this \ncohort.\nFrom a clinical point of view, fertility preservation \noptions should be explored in women suffering from \nendometriosis, as they might need to undergo fertility-\nsparing surgery, or they are likely to face a progressive \nreduction in ovarian reserve. Following controlled ovar -\nian stimulation and oocyte vitrification, we have seen a \ntrend toward positive clinical outcomes of this technique, \nwhich has now become an integral part of fertility pres -\nervation. Moreover, in light of emerging data about good \nneonatal and follow-up outcomes after frozen embryo \ntransfer, modern cryopreservation is confirmed to be a \nsafe and effective technique for the preservation of fertil -\nity [20].\nStudy limitations\nThe study's limitation is its small sample size, and these \nresults must be confirmed. Further investigation is \nneeded to assess the clinical significance of these cor -\nrelations. The discrepancies between the findings of this \nstudy and those of previous research may be attributed \nto variations in the study populations, sample sizes, and \nthe limited genetic power to detect susceptibility-related \ngene polymorphisms within our cohort. Furthermore, \nthe study groups were not matched for BMI, and pos -\nsible confounders of the observed associations cannot be \nexcluded. In future studies, BMI-matched study groups \nshould be investigated, or BMI should be controlled \nduring association analysis. Analysis of the fundamen -\ntal association between these genetic polymorphisms is \nmade possible by using a larger number of samples.\nConclusion\nThis study investigated the potential correlation between \ntwo crucial SNPs in the ESR1 gene, namely rs9340799 \nand rs2234693, and their possible role in endometrio -\nsis-related infertility among women in the South Indian \npopulation. While in silico analyses using GeneMANIA \nand STRING databases revealed biologically relevant \ngene–gene and protein–protein interaction networks \ninvolving ESR1, the genotypic and allelic frequency anal -\nyses of both SNPs in our case–control study showed no \nstatistically significant association with endometriosis or \ninfertility. Despite the biological plausibility of ESR1 vari-\nants contributing to estrogen-driven pathophysiological \nmechanisms in endometriosis, our findings suggest that \nrs9340799 and rs2234693 polymorphisms are not signifi -\ncant risk factors for endometriosis-related infertility in \nthis population. Thus, larger multi-centric studies, inclu -\nsive of diverse ethnic groups and integrating hormonal \nand lifestyle factors, are warranted for a more robust \nunderstanding of the genetic architecture of endome -\ntriosis. Future research should also investigate the roles \nof other functional polymorphisms and gene regulatory \nmechanisms involved in estrogen signalling pathways. \nAlthough ESR1 remains a biologically plausible candi -\ndate gene, our study highlights the complexity of endo -\nmetriosis and underscores the need for a multifactorial \napproach in uncovering its genetic underpinnings.\nAbbreviations\nESR1  Estrogen Receptor 1\nARMS-PCR  The Amplification Refractory Mutation System\nSNP  Single-nucleotide Polymorphism\nEM  Endometriosis\nPCOS  Polycystic ovary syndrome\nROS  Reactive oxygen species\nERE  Estrogen response element\nHIV  Human immunodeficiency virus\nFASTA  Fast Adaptive Shrinkage Threshold Algorithm\nNCBI  The National Center for Biotechnology Information\nBMI  Body mass index\nPCR  Polymerase chain reaction\nAcknowledgements\nOur sincere gratitude is extended to the Chettinad Academy of Research and \nEducation for its unwavering support and encouragement.\nAuthors’ contributions\nBB, JK, IBK, SMT, AHRS: Writing – review & editing, Writing – original draft, \nValidation, Methodology, Data curation. PS: Clinician, Sample collection. RV: \n\nPage 12 of 13\nBaskar et al. Middle East Fertility Society Journal            (2026) 31:60 \nStudy design, Supervision, Investigation, Conceptualization, Draft Editing, and \nValidation.\nFunding\nNot applicable.\nData availability\nNo datasets were generated or analysed during the current study.\nDeclarations\nEthics approval and consent to participate\nObtained from the Institution.\nConsent for publication\nAll authors have read and approved the manuscript.\nCompeting interests\nThe authors declare no competing interests.\nReceived: 20 April 2026 / Accepted: 18 June 2026\nReferences\n1. Al-Amri RJ, Alotibi MKH, Al-Raddadi RI, Shebli WTY, Fallatah EIY, Alhujaily AS, \nMohamed HS (2020) Estrogen Receptor 1 Gene (ESR1) rs2234693 Polymor-\nphism and Breast Cancer Risk in Saudi Women. Asian Pacific J Cancer Preven-\ntion 21(11):3235–3240. https:/ /doi.or g/10.31 557/ APJCP .2020.21.11.3235\n2. Benagiano G, Guo SW (2022) Age-dependent phenotypes of ovarian endo-\nmetriomas. Reproductive medicine and biology 21(1):e12438.  h t t  p s : /  / d o  i .  o r g \n/ 1 0 . 1 0 0 2 / r m b 2 . 1 2 4 3 8       \n3. Chantalat E, Valera MC, Vaysse C, Noirrit E, Rusidze M, Weyl A, Vergriete K, Bus-\ncail E, Lluel P , Fontaine C, Arnal JF, Lenfant F (2020) Estrogen Receptors and \nEndometriosis. Int J Mol Sci 21(8):2815. https:/ /doi.or g/10.33 90/i jms21082815\n4. Chiorean DM, Mitranovici MI, Toru HS, Cotoi TC, Tomuț AN, Turdean SG, Cotoi \nOS (2023) New Insights into Genetics of Endometriosis-A Comprehensive \nLiterature Review. Diagnostics (Basel, Switzerland) 13(13):2265.  h t t  p s : /  / d o  i .  o r g \n/ 1 0 . 3 3 9 0 / d i a g n o s t i c s 1 3 1 3 2 2 6 5       \n5. Coldebella D, Buzzaccarini G, Ferrari J, Sleiman Z, D'Alterio MN, Della Corte L, \n... & Gullo G (2023) Inositols administration: Further insights on their biologi-\ncal role. Italian J Gynaecol Obstetr 35(01):30–36.  h t t  p s : /  / d o  i .  o r g / 1 0 . 3 6 1 2 9 / j o g . \n2 0 2 2 . 4 0       \n6. Dai Y, Ye Z, Lin X, Zhang S (2025) Immunopathological insights into endome-\ntriosis: from research advances to future treatments. Seminars Immunopathol \n47(1):31. https:/ /doi.or g/10.10 07/s 00281-025-01058-5\n7. Daniilidis A, Grigoriadis G, Dalakoura D, D’Alterio MN, Angioni S, Roman H \n(2022) Transvaginal Ultrasound in the Diagnosis and Assessment of Endome-\ntriosis-An Overview: How, Why, and When. Diagnostics (Basel, Switzerland) \n12(12):2912. https:/ /doi.or g/10.33 90/d iagnostics12122912\n8. Gajbhiye RK, Montgomery G, Pai MV, Phukan P , Shekhar S, Padte K, DasMa-\nhapatra P , John BM, Shembekar C, Bhurke AV, Bagde N, Kulkarni K, Sardesh-\npande N, Humane A, Mahobia S, Shah M, Singh U, Srivastava A, Mishra G, \nWarty N, … Mahale SD (2021) Protocol for a case-control study investigating \nthe clinical phenotypes and genetic regulation of endometriosis in Indian \nwomen: the ECGRI study. BMJ Open 11(8):e050844.  h t t  p s : /  / d o  i .  o r g / 1 0 . 1 1 3 6 / b \nm j o p e n - 2 0 2 1 - 0 5 0 8 4 4       \n9. Gibson DA, Simitsidellis I, Collins F, Saunders PTK (2018) Endometrial Intra-\ncrinology: Oestrogens, Androgens and Endometrial Disorders. Int J Mol Sci \n19(10):3276. https:/ /doi.or g/10.33 90/i jms19103276\n10. https:/ /www.wh o.int/n ews- room/f act-she ets/det ail/ infertility\n11. Lakshmi Kardam AA, Singh KN, Rai S (2024) DNA Isolation from Whole Blood \nSamples of Endometriosis Patients using the Salting out Method and ITS \nScope in Ayurveda. Asian J Pharmaceutics 18(1):149\n12. Lu J, Ling X, Liu L, Jiang A, Ren C, Lu C, Yu Z (2023) Emerging hallmarks of \nendometriosis metabolism: A promising target for the treatment of endome-\ntriosis. Biochimica et biophysica acta. Mol Cell Res 1870(1):119381.  h t t  p s : /  / d o  i \n.  o r g / 1 0 . 1 0 1 6 / j . b b a m c r . 2 0 2 2 . 1 1 9 3 8 1       \n13. Lung DK, Reese RM, Alarid ET (2020) Intrinsic and Extrinsic Factors Governing \nthe Transcriptional Regulation of ESR1. Hormones & cancer 11(3–4):129–147. \nhttps:/ /doi.or g/10.10 07/s 12672-020-00388-0\n14. Mahema S, Roshni J, Raman J, Ahmad SF, Al-Mazroua HA, Ahmed SSSJ (2024) \nMolecular Regulator Driving Endometriosis Towards Endometrial Cancer: A \nMulti-Scale Computational Investigation to Repurpose Anti-Cancer drugs. \nCell Biochem Biophys 82(4):3367–3381.  h t t  p s : /  / d o  i .  o r g / 1 0 . 1 0 0 7 / s 1 2 0 1 3 - 0 2 4 - 0 \n1 4 2 0 - 8       \n15. Marin L, Sabbadin C, Radu CM, Brun P , Frison C, Gullo G, Armanini D, Bordin L, \nRagazzi E, Ambrosini G, Andrisani A (2025) Progesterone and IL-6 Expression \nAre Modulated by Follicular Fluid in Granulosa Cell Cultures. Biomolecules \n15(12):1646. https:/ /doi.or g/10.33 90/b iom15121646\n16. Marla S, Mortlock S, Houshdaran S, Fung J, McKinnon B, Holdsworth-Carson \nSJ, Girling JE, Rogers PAW, Giudice LC, Montgomery GW (2021) Genetic risk \nfactors for endometriosis near estrogen receptor 1 and coexpression of \ngenes in this region in endometrium. Mol Human Reprod 27(1):gaaa082. \nhttps:/ /doi.or g/10.10 93/m olehr/gaaa082\n17. Méar L, Herr M, Fauconnier A, Pineau C, Vialard F (2020) Polymorphisms and \nendometriosis: a systematic review and meta-analyses. Hum Reprod Update \n26(1):73–102. https:/ /doi.or g/10.10 93/h umupd/dmz034\n18. Moradi Y, Shams-Beyranvand M, Khateri S, Gharahjeh S, Tehrani S, Varse F, Tiy-\nuri A, Najmi Z (2021) A systematic review on the prevalence of endometriosis \nin women. Indian J Med Res 154(3):446–454.  h t t  p s : /  / d o  i .  o r g / 1 0 . 4 1 0 3 / i j m r . I J M \nR _ 8 1 7 _ 1 8       \n19. Osuchowska-Grochowska I, Blicharska E, Gogacz M, Nogalska A, Winkler I, \nSzopa A, Ekiert H, Tymczyna-Borowicz B, Rahnama-Hezavah M, Grochowski C \n(2021) Brief Review of Endometriosis and the Role of Trace Elements. Int J Mol \nSci 22(20):11098. https:/ /doi.or g/10.33 90/i jms222011098\n20. Papatheodorou A, Vanderzwalmen P , Panagiotidis Y, Petousis S, Gullo G, \nKasapi E, Goudakou M, Prapas N, Zikopoulos K, Georgiou I, Prapas Y (2016) \nHow does closed system vitrification of human oocytes affect the clinical \noutcome? A prospective, observational, cohort, noninferiority trial in an \noocyte donation program. Fertil Steril 106(6):1348–1355.  h t t  p s : /  / d o  i .  o r g / 1 0 . 1 \n0 1 6 / j . f e r t n s t e r t . 2 0 1 6 . 0 7 . 1 0 6 6       \n21. Perrone U, Barra F, Anatrà M, Paudice M, Vellone VG, Gullo G, Ferrero S (2025) \nTargeting inflammation in endometriosis: emerging therapeutic options. \nExpert Opin Investig Drugs 34(12):995–1009.  h t t  p s : /  / d o  i .  o r g / 1 0 . 1 0 8 0 / 1 3 5 4 3 7 \n8 4 . 2 0 2 5 . 2 6 0 9 7 3 4       \n22. Prapas Y, Ravanos K, Petousis S, Panagiotidis Y, Papatheodorou A, Margioula-\nSiarkou C, Iuliano A, Gullo G, Prapas N (2017) GnRH antagonist administered \ntwice the day before hCG trigger combined with a step-down protocol may \nprevent OHSS in IVF/ICSI antagonist cycles at risk for OHSS without affecting \nthe reproductive outcomes: a prospective randomized control trial. J Assist \nReprod Genet 34(11):1537–1545. https:/ /doi.or g/10.10 07/s 10815-017-1010-7\n23. Sadat Eshaghi F, Dehghan Tezerjani M, Ghasemi N, Dehghani M (2022) \nAssociation study of ESR1 rs9340799, rs2234693, and MMP2 rs243865 vari-\nants in Iranian women with premature ovarian insufficiency: A case-control \nstudy. Int J Reprod Biomed 20(10): 841–850.  h t t  p s : /  / d o  i .  o r g / 1 0 . 1 8 5 0 2 / i j r m . v 2 \n0 i 1 0 . 1 2 2 6 8       \n24. Saito K, Cui H (2023) Estrogen Receptor Alpha Splice Variants, Post-Transla-\ntional Modifications, and Their Physiological Functions. Cells 12(6):895. https:/ \n/doi.or g/10.33 90/c ells12060895\n25. Ser HL, Au Yong SJ, Shafiee MN, Mokhtar NM, Ali RAR (2023) Current Updates \non the Role of Microbiome in Endometriosis: A Narrative Review. Microorgan-\nisms 11(2):360. https:/ /doi.or g/10.33 90/m icroorganisms11020360\n26. Shigesi N, Harris HR, Fang H, Ndungu A, Lincoln MR, International Endome-\ntriosis Genome Consortium, 23andMe Research Team, Cotsapas C, Knight J, \nMissmer SA, Morris AP , Becker CM, Rahmioglu N, Zondervan KT (2025) The \nphenotypic and genetic association between endometriosis and immuno-\nlogical diseases. Human Reprod (Oxford, England) 40(6):1195–1209.  h t t  p s : /  / d \no  i .  o r g / 1 0 . 1 0 9 3 / h u m r e p / d e a f 0 6 2       \n27. Shu J, Li J, Fu Y, Hui X, Jin Y, Chen M, Zheng X, Shi Y (2020) Association of ESR1 \npolymorphism rs2234693 and rs9340799 with postmenopausal osteoporosis \nin a Chinese population. BMC Musculoskelet Disord 21(1):346.  h t t  p s : /  / d o  i .  o r g \n/ 1 0 . 1 1 8 6 / s 1 2 8 9 1 - 0 2 0 - 0 3 3 5 9 - 2       \n28. Sumi MP , Guru SA, Mir R, Masroor M, Bhat MA, Girish MP , Saxena A (2019) \nClinical Importance of Estrogen Receptor 1 (ESR1) Gene Polymorphisms and \nTheir Expression Patterns in Coronary Artery Disease Patients: A Study from \nIndia. Indian J Clin Biochem 34(2):133–142.  h t t  p s : /  / d o  i .  o r g / 1 0 . 1 0 0 7 / s 1 2 2 9 1 - 0 \n1 9 - 0 0 8 2 7 - y       \n29. Takeuchi M, Matsuzaki K, Harada M (2024) Endometriosis, a common but \nenigmatic disease with many faces: current concept of pathophysiology, and \n\nPage 13 of 13\nBaskar et al. Middle East Fertility Society Journal            (2026) 31:60 \ndiagnostic strategy. Jpn J Radiol 42(8):801–819.  h t t  p s : /  / d o  i .  o r g / 1 0 . 1 0 0 7 / s 1 1 6 \n0 4 - 0 2 4 - 0 1 5 6 9 - 5       \n30. Tan SC, Low TY, Mohamad Hanif EA, Sharzehan MAK, Kord-Varkaneh H, Islam \nMA (2021) The rs9340799 polymorphism of the estrogen receptor alpha \n(ESR1) gene and its association with breast cancer susceptibility. Sci Rep \n11(1):18619. https:/ /doi.or g/10.10 38/s 41598-021-97935-8\n31. Thanikachalam P , Arunkumar S, Pandiyan R, Natarajan P (2025) Endometrio-\nsis–revisited. J Reprod Healthcare Med 6(13):1.  h t t  p s : /  / d o  i .  o r g / 1 0 . 2 5 2 5 9 / J R H \nM _ 6 _ 2 0 2 5       \n32. Thomas SM, Veerabathiran R (2025) Genetic and stem cell insights into the \npathogenesis of endometriosis: A comprehensive review. J Biol Meth-\nods 12(4):e99010075. https:/ /doi.or g/10.14 440/ jbm.0148\n33. Turcan M, Maioru O, Pop L, Radoi V, Ursu R, Bacalbasa N, ... & Suciu ID (2022) \nGenetic determination in endometriosis. Rom Med J 69(4), 28.  h t t  p s : /  / d o  i .  o r g \n/ 1 0 . 3 7 8 9 7 / r m j . 2 0 2 2 . s 4 . 8       \n34. Upson K (2020) Environmental risk factors for endometriosis: A critical evalu-\nation of studies and recommendations from the epidemiologic perspective. \nCurr Epidemiol Reports 7(3):149–170.  h t t  p s : /  / d o  i .  o r g / 1 0 . 1 0 0 7 / s 4 0 4 7 1 - 0 2 0 - 0 0 \n2 3 6 - 3       \n35. van der Vaart JF, Merki-Feld GS (2022) Sex hormone-related polymorphisms \nin endometriosis and migraine: A narrative review. Womens Health (Lond \nEngl) 18:17455057221111316. https:/ /doi.or g/10.11 77/1 7455057221111315\n36. Vatsa R, Sethi A (2021) Impact of endometriosis on female fertility and the \nmanagement options for endometriosis-related infertility in reproductive \nage women: a scoping review with recent evidences. Middle East Fertil Soc J \n26(1):36. https:/ /doi.or g/10.11 86/s 43043-021-00082-3\n37. Zhang H, Sheng S, Pan Z, Zhao L, Yang C, Li C, Wang F (2023) Immune and \nendocrine regulation in endometriosis: what we know. J Endometriosis \nUterine Dis 4:100049. https:   //d oi. or g/10 . 1 016 /j.j eud.2023.100049\nPublisher's Note\nSpringer Nature remains neutral with regard to jurisdictional claims in \npublished maps and institutional affiliations.","source_license":"CC0","license_restricted":false}