Immunological Dysregulation in Endometriosis Potentially Linked to Anomalies in NCOA4-Mediated Iron Autophagy Pathway

Immunological Dysregulation in Endometriosis Potentially Linked to Anomalies in NCOA4-Mediated Iron Autophagy Pathway | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Immunological Dysregulation in Endometriosis Potentially Linked to Anomalies in NCOA4-Mediated Iron Autophagy Pathway YiMing Liu, Fang Lian, YueWen Zhao This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4016800/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Objective This study aims to investigate the expression disparities of Nuclear Receptor Coactivator 4 (NCOA4) in endometriosis (EMS) patients, assessing its diagnostic potential. It also elucidate the correlation between the immune microenvironment in EMS patients and pivotal genes in iron autophagy,and seeks to corroborate the activation status of the NCOA4-mediated iron autophagy pathway in both ectopic and eutopic endometrial tissues in EMS, Methods "Data sets from microarrays pertaining to EMS patients were obtained from the GEO database. This was done to analyze the differential expression of NCOA4 in both ectopic and eutopic endometrial tissues, in comparison to normal endometrial tissues. The diagnostic efficacy of key iron autophagy genes in identifying EMS was projected using Area Under the Receiver Operating Characteristic Curve (AUROC). This study also further examined the differential immune landscape between ectopic and eutopic endometrial tissues of EMS patients and controls. Additionally, it analyzed the interplay between immune cells, immune checkpoint genes, and key iron autophagy genes in EMS patients. A rat model of EMS was employed to validate the expression patterns of the NCOA4-mediated iron autophagy pathway in ectopic and eutopic endometrium. Results NCOA4 was differentially expressed in endothelial tissues of EMS patients, including two diametrically opposed trends of up-regulation and down-regulation in the in situ endothelial tissues of EMS patients and up-regulation in the ectopic endothelial tissues; Immune infiltration analysis showed that a variety of immune cells and immune checkpoint genes were abnormal in the endothelial tissues of EMS patients, and most of the abnormal immune cells and immune checkpoint genes were strongly correlated with the key genes of iron autophagy, NCOA4, FTH1, LC3B, and P62; Animal results showed that iron autophagy signaling pathway activation was progressively enhanced from the in situ endometrium to the normal endometrium to the ectopic endometrium. Conclusion Restoring the normal function of the NCOA4-mediated iron autophagy signaling pathway by regulating it can block the development of EMS, and its mechanism may be related to improving the local microenvironmental immune imbalance in EMS endothelial tissues. Biological sciences/Cell biology Biological sciences/Immunology Health sciences/Pathogenesis Endometriosis Iron Autophagy NCOA4 Immune Response Eutopic Endometrium Ectopic Endometrium Rat Model Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 1 Background Endometriosis (EMS) is a prevalent gynecological disorder characterized by the aberrant growth of functional endometrial tissue outside the uterine lining, manifesting clinically as pain and infertility [1–2] . The consensus among researchers points to the involvement of hormonal, inflammatory, immunological, genetic, and environmental factors in the onset and progression of EMS [3] . However, due to the enigmatic nature of EMS pathogenesis, current clinical diagnostics lack non-invasive biomarkers and definitive therapeutic interventions [4–6] , rendering the identification of novel targets for EMS progression a critical area of research focus. Ferritin, the body's exclusive iron storage protein, undergoes degradation via the NCOA4-mediated iron autophagy pathway, a process integral to cellular iron homeostasis through the release and recycling of iron ions. Disruptions in iron homeostasis have been implicated in the pathogenesis of a spectrum of diseases, including Alzheimer's disease, myelodysplastic syndromes, and inflammatory bowel disease [7–9] . Studies also indicate prevalent iron overload in the peritoneum, peritoneal fluid, ectopic endometrial lesions, and macrophages in EMS patients [10] . Nevertheless, the exact role of iron homeostasis imbalance in the EMS developmental trajectory remains elusive. This study, therefore, endeavors to investigate the expression and potential mechanistic roles of NCOA4 and its mediated iron autophagy signaling pathway with the goal of uncovering new pathways contributing to the development of EMS, focusing on both eutopic and ectopic endometrial tissues. 2 Experimental Materials and Methods 2.1 Collection and Processing of Microarray Data Datasets from microarrays were sourced from the GEO database, with 'endometriosis' being the main keyword used for searching. The strategy employed was: (“endometriosis”[MeSH Terms] OR Endometriosis[All Fields]) AND "Homo sapiens"[porgn] AND "Expression profiling by array"[Filter]). In conducting the analysis that compares the eutopic endometrium in EMS patients with the corresponding tissue in healthy individuals, datasets GSE51981 (training set) and GSE141549 (validation set) were selected. GSE51981 comprises RNA samples from 77 eutopic endometrial tissues of EMS patients and 71 from control group eutopic endometrial tissues, whereas GSE141549 includes RNA samples from 104 EMS eutopic endometrial tissues and 43 controls. To compare ectopic endometrium in EMS patients with healthy control endometrium, GSE58178 (training set) and GSE141549 (validation set) were chosen. GSE58178 comprises RNA samples from six EMS patient ectopic endometrial tissues and an equal number from control group eutopic endometrial tissues. Conversely, GSE141549 encompasses 149 RNA samples from ectopic endometrial tissues of EMS patients and 43 from eutopic endometrial tissues of the control group. 2.2 Immune Infiltration and Immune Checkpoint Gene Dynamics in Endometriosis Versus Control Groups EMS is closely associated with immune system anomalies [11] . Consequently, we employed the CIBERSORT algorithm [12] to discern variances in the expression of immune cell markers between eutopic and ectopic endometrial tissues in EMS patients as compared to healthy controls. CIBERSORT is a robust tool that utilizes linear support vector regression to deconvolve the expression matrix of distinct human immune cell subtypes. This technique is grounded in a well-established reference set that characterizes gene expression patterns for 22 different immune cell subtypes. Furthermore, Pearson correlation analysis was conducted to explore the associations between NCOA4, LC3B, FTH1, P62 expression, and the immune cell subgroups and checkpoint genes within both the ectopic and eutopic endometrial tissues in individuals with EMS. 2.3 Laboratory Animals Healthy female Sprague-Dawley (SD) rats, of specific pathogen-free (SPF) grade, nulliparous, aged 8 weeks, and with a weight range of 180-220g, were procured from Jinan Pengyue Experimental Animal Breeding Co., Ltd., under the license number SCXK(Lu) 2019 0003. These creatures were accommodated in the Shandong University of Traditional Chinese Medicine Experimental Animal Center (SPF grade), with ambient conditions maintained at 21–24°C and relative humidity at 40–60%. Animals had ad libitum access to food and water. The animal use and care protocols adhered to the “Guide for the Care and Use of Laboratory Animals,” strictly observing the 3Rs principle. All experimental protocols were reviewed and approved by the Animal Ethics Committee of Shandong University of Traditional Chinese Medicine (Approval Number: AWE2022053) and we confirm that all methods were performed in accordance with the American Veterinary Medical Association (AVMA) Guidelines for the Euthanasia of Animals (2020) and ARRIVE guidelines. 2.4 Principal Instruments and Reagents Instruments : High-Speed Refrigerated Centrifuge (Dynamica, Model: VELOCITY 18R). Basic Electrophoresis Unit (Bio-Rad, Model: PowerPac Basic). Electrophoresis Tank (Junyi Dongfang Electrophoresis Equipment Co., Beijing, Model: JY300C). Gel Imaging System (Shanghai Tianneng Technology Co., Ltd., Model: Tanon 1600). Microspectrophotometer (Hangzhou Aosheng Instrument Co., Model: Nano-300). Standard PCR Machine (Likang Co., Model: K960). Real-Time Quantitative PCR System (Roche, Model: Roche LightCycler 480). Whole Slide Scanner (PANNORAMIC, Hungary, Models: DESK/MIDI/250/1000). Tissue Dehydrator (Leica, Germany, Model: ASP300S). Embedding Machine (Leica, Germany, Model: EG1160). Pathology Microtome (Thermo Fisher Scientific (Shanghai) Co., Ltd., Model: HM 325). Cryostat Microtome (Leica, Germany, Model: CM1860 UV). Upright Optical Microscope (Nikon, Japan, Model: ECLIPSE 80i). Microplate Reader (Molecular Devices, Model: Cmax Plus). Tissue Grinder (Jingxin Co., Model: JXFSTPRP-48L). Vertical Electrophoresis Unit, Transfer Electrophoresis Unit (Servicebio, Product Code: SVE-2). Reagents : Ferrous Ion Colorimetric Assay Kit (Elabscience, Batch No.: GY12R0627507). SPARKeasy Tissue/Cell RNA Rapid Extraction Kit, SPARKscript II All-in-one RT SuperMix for qPCR, 2×SYBR Green qPCR Mix (SparkJade, Product Codes: AG0305, AH0104). Primary Antibodies for β-actin, NCOA4, FTH1), Sequestosome-1 (P62), Microtubule-Associated Proteins 1A/1B Light Chain 3B (LC3B) (all from ABclonal, Product Codes: AC026, A5695, A19544, A19700, A19665). Secondary Antibody HRP-conjugated Goat Anti-Rabbit (Servicebio, Product Code: GB23303). TSA Fluorescence Dual Staining Kit (Servicebio, Product Code: G235-100T). High-Efficiency RIPA Lysis Buffer (Tissue/Cell) (Solarbio, Batch No.: 2311006). BCA Protein Concentration Determination Kit (Enhanced) (Beyotime, Batch No.: 060723230913). DAPI Staining Reagent (Wuhan Seville Biotechnology Co., Ltd., Batch No.: G1012). Xylene (Shanghai Lingfeng Chemical Reagent Co., Ltd., Batch No.: 20230609). Hematoxylin Staining Solution, Eosin Y Staining Solution (Servicebio, Product Codes: CR2301041-2, CR2303033-5). 2.5 Group Modeling Following a week of acclimatization, twenty rats were arbitrarily segregated into two groups: a control group comprising eight rats and an EMS group consisting of twelve rats. The EMS rat model was established using auto transplantation as per referenced literature [13] . After a week of post-model establishment acclimatization, exploratory laparotomy was performed for model assessment, followed by four weeks of standardized care, then the animals were euthanized by guillotine decapitation. Partial ectopic/eutopic endometrial tissues and endometrial tissues were removed and placed in glass Petri dishes with chilled saline solution for subsequent assays. Others were collected and stored at − 80°C until processing. 2.6 Hematoxylin and Eosin (H&E) Staining Initially, the paraffin-embedded tissue sections undergo dewaxing to the point of hydration. This involves sequential submersion in both xylene I and II for 20 minutes each, followed by immersion in anhydrous ethanol I and II for 5 minutes each, and then in 75% alcohol for another 5 minutes, with intermittent rinsing in tap water. Subsequently, the sections are stained with hematoxylin for 3–5 minutes, rinsed, differentiated, and blued, again with intermittent rinsing in tap water. Post-staining, the sections are dehydrated using increasing concentrations of alcohol (85% and 95%, for 5 minutes each) and then stained with eosin for 5 minutes. The concluding step includes multiple immersions in anhydrous ethanol (I, II, and III) and xylene (I and II), for 5 minutes each, to clarify the sections, followed by sealing with neutral resin. These sections are then ready for microscopic examination, image capture, and subsequent analysis. 2.7 Western Blot Analysis For tissue homogenate preparation, 20 mg of endometrial tissue is finely ground to ≤ 1mm particles. This is mixed with 180 µL of tissue protein lysis buffer and lysed on ice for an hour. Post-centrifugation of the homogenate for 15 minutes at 4°C and 12,000 rpm, the supernatant is collected. Protein concentration in the supernatant is quantified using the BCA assay. The proteins are then denatured by mixing with 5× loading buffer and boiling at 99°C for 10 minutes. Separation of these protein samples is achieved through 10% SDS-PAGE, followed by transfer onto a PVDF membrane. The membrane is blocked for 15 minutes and incubated overnight at 4°C with primary antibodies against NCOA4 (1:500), FTH1 (1:2000), LC3B (1:1000), P62 (1:1000), p-NF-KB (1:5000), and β-actin (1:500000). After triple rinses with TBST, each lasting 10 minutes, the membrane is incubated with corresponding secondary antibodies (1:3000) at room temperature for an hour. Visualization is accomplished using ECL substrate, and the resulting bands are quantitatively analyzed with Image J -win64 software. 2.8 Quantitative PCR (q-PCR) Analysis Endometrial tissue samples, previously stored at -80°C, were thawed for RNA extraction using the SPARKeasy Tissue/Cell RNA Rapid Extraction Kit. The extracted total RNA was reverse-transcribed into cDNA. The qRT-PCR reaction setup, as per the 2×SYBR Green qPCR Mix kit's protocol, included the addition of cDNA, specific primers for target and housekeeping genes (designed and synthesized by Shanghai Sangon Biotech Co., Ltd.), and other necessary reagents. Amplifications were performed on a qRT-PCR instrument. The mRNA expression levels of NCOA4, FTH1, LC3B, and P62 were quantified using the 2-∆∆Ct method, with β-actin serving as the internal control. The sequences of these primers are detailed in Table 1 . Table 1 Primer Sequences Gene Primer Sequence (5'-3') Product Length NCOA4 Forward ATATTAAGCCTCTGAGTTGCCTATGC 85 Reverse CTCTATGGTAATGTCACTGTGGGAAG FTH1 Forward TGCCATCAACCGCCAGATCAAC 155 Reverse TCAGTTTCTCAGCAIGTTCCCTCTC LC3 Forward CAAGCCTTCTTCCTCCTGGTGAAT 140 Reverse AGTGCTGTCCCGAACGTCTCC P62 Forward TGGTCGTGGGGTGTCTGTGAG 130 Reverse TCTGGTGATGGAGCCTCTTACTGG β-actin Forward CCCATCTATGAGGGTTACGC 150 Reverse TTTAATGTCACGCACGATTTC Note: NCOA4 refers to Nuclear Receptor Coactivator 4; FTH1 to the Heavy Chain of Ferritin; P62 denotes Sequestosome; LC3B stands for Microtubule-Associated Proteins 1A/1B Light Chain 3 Beta; P-NF-κB represents the phosphorylated Nuclear Factor kappa-light-chain-enhancer of activated B cells. 2.9 Determination of Free Iron Content The Iron (II) Ion Colorimetric Assay Kit (Elabscience, Lot No: GY12R0627507) was utilized to measure the free iron content in accordance with the manufacturer's guidelines. 2.10 Immunofluorescence Colocalization Study Eutopic (or control or ectopic) endometrial tissues, fixed in polyformaldehyde, were sectioned and deparaffinized. The sections underwent antigen retrieval and were processed through a series of steps including hydrogen peroxide and serum blocking the initial application of the primary antibody, succeeded by the respective HRP-conjugated secondary antibody and CY3-TSA. Post-microwave treatment, the second primary antibody was applied, succeeded by the corresponding secondary antibody and DAPI nuclear counterstaining. The slides were then treated for autofluorescence quenching and prepared for microscopic examination and photographic documentation. The results were analyzed using Aipathwell digital pathology image analysis software, utilizing techniques of tracing, color selection, and computational analysis [14–17] . 2.11 Statistical Methodology Data were processed using SPSS software (version 26.0). Quantitative data, adhering to a normal distribution, were expressed as mean ± standard deviation (x¯±s). For homogeneous variances, a one-way ANOVA was utilized for multi-group comparisons, with post-hoc pairwise comparisons conducted via the LSD method. In cases of heterogeneity of variance, the Welch test was employed, with intergroup comparisons conducted using the Kruskal-Wallis rank-sum test. Statistical significance was set at a p -value < 0.05. 3 Results 3.1 Differential Expression of NCOA4 in Eutopic and Ectopic Endometrial Tissues of EMS in the Training Set Figure 1 illustrates the expression patterns and diagnostic relevance of NCOA4 in both ectopic and eutopic endometrial tissues in EMS patients, utilizing data from GSE51981 and GSE58178 in the training set. The results demonstrate a notable decrease in NCOA4 levels in the eutopic endometrial tissues of EMS patients relative to those in the control group. ( P < 0.001, Fig. 1A). The AUROC for diagnosing eutopic endometrium in EMS was determined to be 0.68 (95% CI: 0.77 − 0.59, Fig. 1B). In contrast, NCOA4 was significantly upregulated in the ectopic endometrial tissues of EMS patients ( P < 0.05, Fig. 1C), with an AUROC for diagnosing ectopic endometrium in EMS at 0.83 (95% CI: 1.0-0.57, Fig. 1D). 3.2 Enhanced Expression of NCOA4 in Eutopic and Ectopic Endometrium of EMS in the Validation Set Figure 2 highlights the expression and diagnostic significance of NCOA4 in both eutopic and ectopic endometrial tissues of EMS in the validation datasetResults demonstrated a notable upregulation of NCOA4 in eutopic endometrial tissues of EMS patients compared to the control group ( P < 0.0001, Fig. 2A). The AUROC for diagnosing eutopic endometrium in EMS was 0.77 (95% CI: 0.84 − 0.69, Fig. 2B). Similarly, a significant upregulation of NCOA4 was observed in ectopic endometrial tissues of EMS patients ( P < 0.01, Fig. 2C), with an AUROC for diagnosing ectopic endometrium in EMS at 0.66 (95% CI: 0.75 − 0.57, Fig. 2D). 3.3 Differential Expression of Various Immune Cell Types and Aberrant Overexpression of Immune Checkpoint Genes in Eutopic and Ectopic Endometrium of EMS Patients The CIBERSORT algorithm was utilized to evaluate the variations in immune cells between eutopic and ectopic endometrial tissues of EMS patients in comparison to control eutopic endometrium. Figure 3 A illustrates the proportionate expression of 22 immune cell types in the eutopic endometrium of EMS patients versus the control eutopic endometrium, with the initial 77 cases representing EMS patient eutopic endometrium and the subsequent 71 cases representing control eutopic endometrium. Figure 3 B reveals significant differential expression in six immune cell types in eutopic endometrium of EMS patients compared to controls. Three cell types (Plasma cells, T cells CD8, NK cells resting) were more prevalent, while three types (T cells gamma delta, Macrophages M2, Dendritic cells activated) were less expressed in the eutopic endometrium of EMS patients. Figure 3 C displays the proportionate expression of 22 immune cell types in ectopic endometrium of EMS patients versus control eutopic endometrium, with the first 149 cases being ectopic endometrium of EMS patients and the last 43 being control eutopic endometrium. Figure 3 D indicates that 15 immune cell types demonstrated significant variance in expression in ectopic endometrium of EMS patients compared to controls, with eight types (B cells Memory, T cells CD4 memory resting/activated, Monocytes, Macrophages M1/M2, Mast cells resting, Neutrophils) exhibiting increased expression, and seven types (Plasma cells, T cells CD8, T cells follicular helper, Tregs, NK cells resting/activated, Dendritic cells activated) showing decreased expression. Further analysis of microarray data was conducted to explore the disparities in immune checkpoint gene expression between eutopic and ectopic endometrial tissues of EMS patients compared to the control group. The findings indicated that, relative to the control group, five out of eight immune checkpoint genes exhibited significant overexpression in the eutopic endometrium of EMS patients (Fig. 3 E), including CTLA4, LAG3, CD48, CD27, CD40. In the ectopic endometrium of EMS patients, six out of eight genes were significantly overexpressed (Fig. 3 F), comprising CTLA4, IDO1, LAG3, CD48, CD27, CD40. In summary, immune checkpoint genes showed anomalously high expression in both eutopic and ectopic endometrial tissues of EMS patients. 3.4 Correlation Between the Differential Expression of Key Iron Autophagy Genes NCOA4, FTH1, SQSTM1 (P62), MAP1LC3B (LC3B) and Immune Cells, Immune Checkpoint Genes in Ectopic and Eutopic Endometrium of Patients with EMS Figure 4A displays the correlation between four crucial iron autophagy genes (NCOA4, FTH1, SQSTM1(P62), MAP1LC3B(LC3B)) and immune cells in eutopic endometrium of EMS patients. NCOA4 exhibited significant correlations with 10 immune cell types, showing positive correlations with six and negative correlations with four, with the strongest correlations being with NK cells resting (r = -0.64, P < 0.001) and T cells gamma delta (r = 0.54, P < 0.001). FTH1 correlated significantly with six immune cell types, predominantly negative (4/6), with the strongest being with Plasma cells (r = -0.35, P < 0.01). SQSTM1(P62) correlated significantly with 11 immune cell types, positively with five and negatively with six, with the strongest correlations being with NK cells resting (r = 0.58, P < 0.001) and T cells gamma delta (r = -0.59, P < 0.001). MAP1LC3B(LC3B) showed significant correlations with six immune cell types, positively with three and negatively with three, with the strongest correlations being with T cells CD8 (r = -0.52, P < 0.01) and NK cells activated (r = 0.47, P < 0.01). Figure 4B illustrates the correlation between these key iron autophagy genes and immune cells in ectopic endometrium of EMS patients. NCOA4 showed negative correlations with four immune cell types, the strongest being with T cells CD4 memory activated (r = -0.2, P < 0.05). FTH1 negatively correlated with three immune cell types, with the strongest being with B cells memory (r = -0.22, P < 0.01). SQSTM1(P62) displayed no notable correlation with immune cells. MAP1LC3B(LC3B) was significantly correlated with three immune cell types, mostly negative (2/3), with the strongest being with B cells memory (r = -0.2, P < 0.05). In eutopic endometrium of EMS patients, the correlation of four key iron autophagy genes with immune checkpoint genes is shown in Fig. 4C. NCOA4 negatively correlated with CTLA4 (r = -0.25, P < 0.05), LMTK3 (r = -0.45, P < 0.001), LAG3 (r = -0.36, P < 0.01), CD48 (r = -0.24, P < 0.05), CD27 (r = -0.79, P < 0.0001), CD40 (r = -0.53, P < 0.001), and positively with IDO1 (r = 0.38, P < 0.01). FTH1 positively correlated with CD27 (r = 0.29, P < 0.05), CD40 (r = 0.25, P < 0.05). SQSTM1(P62) showed positive correlations with LMTK3 (r = 0.47, P < 0.001), LAG3 (r = 0.36, P < 0.01), CD48 (r = 0.26, P < 0.05), CD27 (r = 0.71, P < 0.0001), CD40 (r = 0.62, P < 0.001), and a negative correlation with IDO1 (r = -0.33, P < 0.01). MAP1LC3B(LC3B) negatively correlated with CTLA4 (r = -0.26, P < 0.05), CD27 (r = -0.44, P < 0.001), and positively with IDO1 (r = 0.76, P < 0.0001). In ectopic endometrium of EMS patients, the correlation of these genes with immune checkpoint genes is depicted in Fig. 4D. NCOA4 positively correlated with CTLA4 (r = 0.46, P < 0.001), IDO1 (r = 0.41, P < 0.001), LMTK3 (r = 0.73, P < 0.0001), LAG3 (r = 0.36, P < 0.001), CD48 (r = 0.66, P < 0.0001), CD27 (r = 0.42, P < 0.001), CD40 (r = 0.22, P < 0.01), and negatively with ICOS (r = -0.48, P < 0.001). FTH1 positively correlated with CTLA4 (r = 0.44, P < 0.001), IDO1 (r = 0.35, P < 0.001), LMTK3 (r = 0.67, P < 0.0001), LAG3 (r = 0.34, P < 0.001), CD48 (r = 0.72, P < 0.0001), CD27 (r = 0.37, P < 0.001), CD40 (r = 0.16, P < 0.05), and negatively with ICOS (r = -0.48, P < 0.001). SQSTM1(P62) showed positive correlations with CTLA4 (r = 0.33, P < 0.001), IDO1 (r = 0.79, P < 0.0001), LMTK3 (r = 0.75, P < 0.0001), LAG3 (r = 0.55, P < 0.0001), CD48 (r = 0.51, P < 0.0001), CD27 (r = 0.80, P < 0.0001), CD40 (r = 0.56, P < 0.0001), and MAP1LC3B(LC3B) positively correlated with CTLA4 (r = 0.46, P < 0.001), IDO1 (r = 0.56, P < 0.0001), LMTK3 (r = 0.76, P < 0.0001), LAG3 (r = 0.39, P < 0.001), CD48 (r = 0.67, P < 0.0001), CD27 (r = 0.58, P < 0.001), CD40 (r = 0.34, P < 0.001), and negatively with ICOS (r = -0.29, P < 0.001). In summary, in eutopic endometrial tissues of EMS patients, NCOA4 showed a notable positive association with one immune checkpoint gene and negative associations with six others; moreover, FTH1 showed positive correlations with two immune checkpoint genes; SQSTM1(P62) positively with five and negatively with one; and MAP1LC3B(LC3B) positively with one and negatively with two immune checkpoint genes. In ectopic endometrial tissues, NCOA4 showed a positive correlation with seven immune checkpoint genes, and a negative correlation with one; FTH1 positively with seven and negatively with one; SQSTM1(P62) positively with all seven; and MAP1LC3B(LC3B) positively with seven and negatively with one. 3.5 Histopathological Analysis To examine the histopathological conditions of eutopic and ectopic endometrial tissues in EMS rats, HE staining was conducted on tissue samples from the control group and the EMS group. Histopathological examination showed a profusion of endometrial and glandular epithelium (blue arrows), a dense stroma, and an abundance of matrix cells with some uterine glands in the control group. Conversely, ectopic endometrial sections from EMS rats displayed formations of small cavity structures in endometrial epithelium, extensive degenerative changes (blue arrows), loosely stained cytoplasm, increased matrix cells, and scattered granulocyte infiltration (red arrows), accompanied by infiltration of multinucleated giant cells and macrophages (yellow arrows). The HE-stained eutopic endometrial tissues in EMS rats did not exhibit notable differences relative to the control group, as illustrated in Fig. 5. 3.6 Variations in Free Iron Content in Eutopic and Ectopic Endometrium of EMS Rats The investigation of free iron content in the eutopic endometrium of the control group and in both eutopic and ectopic endometrium of EMS rats indicated a significant elevation in free iron content in the ectopic endometrium, while a noticeable reduction was observed in the eutopic endometrium of EMS rats compared to the control group. These findings imply disruptions in iron metabolism within eutopic as well as ectopic endometrial tissues in rats of EMS (refer to Table 2 ). Table 2 Quantification of Free Iron in Endometrial Tissues of Various Rat Groups (n = 3, mean ± SD) Group Healthy Rat Endometrium EMS Rat Eutopic Endometrium EMS Rat Ectopic Endometrium Free Iron Content (µmol/kg) 386.75 ± 42.6 165.3 ± 7.63 ### 756.01 ± 51.79 ### Note: Data are presented to two decimal places. Compared to the healthy rat endometrium, ###P < 0.001. 3.7 Altered Protein Levels of NCOA4, LC3B, FTH1, and P62 in Eutopic and Ectopic Endometrium of EMS Rats Iron autophagy, facilitated by NCOA4, involves the degradation of cellular ferritin FTH1 in autolysosomes, thus releasing free iron ions, pivotal in iron metabolism under both physiological and pathological states. To investigate the cause behind abnormal free iron levels in eutopic and ectopic endometrial tissues of EMS rats, the expression levels of iron autophagy-associated proteins such as NCOA4, LC3B, FTH1, and P62 were examined.. Compared to the control group, ectopic endometrial tissues in EMS rats exhibited increased expression of NCOA4 and LC3B proteins ( P < 0.01) and decreased expression of FTH1 and P62 proteins (P < 0.05). In contrast, eutopic endometrial tissues showed decreased expression of NCOA4 and LC3B proteins ( P < 0.01 or 0.001) and increased expression of FTH1 and P62 proteins ( P < 0.01), as illustrated by Fig. 6 and detailed within Table 3 . Table 3 Relative Expression Levels of NCOA4, LC3B II/I, FTH1, and P62 Proteins in Healthy, Eutopic, and Ectopic Endometrium of Rats (x¯±s) Group Number NCOA4 LC3BⅡ/Ⅰ FTH1 P62 Ectopic Endometrium (EMS) 4 1.05 ± 0.05 ** 4.17 ± 2.11 ** 0.44 ± 0.31 * 0.19 ± 0.31 * Healthy Endometrium 4 0.75 ± 0.19 1 ± 0.26 0.86 ± 0.07 0.75 ± 0.11 Eutopic Endometrium (EMS) 4 0.2 ± 0.18 *** 0.36 ± 0.33 ** 1.13 ± 0.07 ** 1.02 ± 0.07 ** Note: Data are presented to two decimal places. Compared to healthy endometrium, ***P < 0.001, **P < 0.01, *P < 0.05. 3.8 mRNA Expression Variations of NCOA4, LC3B, FTH1, and P62 in Eutopic and Ectopic Endometrium of EMS Rats Further analysis of mRNA expression for iron autophagy-related proteins NCOA4, LC3B, FTH1, and P62 was conducted in eutopic and ectopic endometrial tissues of EMS rats. Compared to healthy rat endometrium, ectopic endometrial tissues of EMS rats displayed an upward trend in NCOA4 mRNA expression, significant upregulation of LC3B mRNA (P < 0.01), and a downward trend in FTH1 and P62 mRNA. Conversely, eutopic endometrial tissues showed significant downregulation in NCOA4 mRNA ( P < 0.001), a downward trend in LC3B mRNA, and upregulation in FTH1 and P62 mRNA ( P < 0.05 or 0.00001), as detailed in Table 4 . Table 4 Comparative mRNA Expression Levels of NCOA4, LC3B, FTH1, and P62 in Healthy, Eutopic, and Ectopic Endometrial Tissues of Rats (x¯±s) Group Number NCOA4 mRNA Relative Expression levels LC3B mRNA Relative Expression levels FTH1 mRNA Relative Expression levels P62 mRNA Relative Expression levels Healthy Endometrium 3 0.94 ± 0.03 0.41 ± 0.06 1.04 ± 0.06 0.09 ± 0.1 Healthy Endometrium 3 0.28 ± 0.08 *** 0.28 ± 0.13 2.05 ± 0.44 * 1 ± 0.01 ***** Ectopic Endometrium 3 1.09 ± 0.55 1.01 ± 0.13 ** 1.05 ± 0.4 0.03 Note: Data are presented with two decimal places. Compared to healthy endometrium, *P < 0.05, **P < 0.01, ***P < 0.001, *****P < 0.00001. 3.9 Alterations in NCOA4 and LC3B Colocalization in Immunofluorescence Studies of EMS Rat Endometrium To further substantiate the activation status of the iron autophagy pathway in eutopic as well as ectopic endometrial tissues of EMS rats, we performed immunofluorescence colocalization analyses of NCOA4 and LC3B. Comparisons were drawn against healthy rat endometrial tissues. The results indicated a marked increase in the colocalization of NCOA4 and LC3B in ectopic endometrial tissues of EMS rats relative to the healthy rat endometrium. In contrast, eutopic endometrial tissues of EMS rats exhibited a significant reduction in the colocalization of these proteins. This finding indicates a suppressed iron autophagy signaling pathway in the eutopic endometrium, coupled with increased activation in the ectopic endometrium of EMS rats., as depicted in Fig. 7. 4 Discussion Iron, an indispensable trace element in the human body, is essential for maintaining normal physiological functions. Iron autophagy, a cellular process for iron ion metabolism, involves NCOA4 as its specific receptor. In iron-deficient conditions, NCOA4 forms a complex with ferritin and merges with autophagosomes, leading to lysosomal degradation of ferritin and subsequent release of free iron for reuse by the body [18] . Our study, utilizing the GEO database, revealed contrasting trends in the expression of NCOA4 in eutopic and ectopic endometrial tissues of EMS patients compared to healthy eutopic endometrium. In ectopic endometrium of EMS, NCOA4 was overexpressed, while it showed opposite trends in training and validation sets for eutopic endometrium. ROC curve analysis indicated potential diagnostic value of NCOA4 for EMS. In vitro studies suggest that NCOA4 deficiency makes cells more prone to stress injury and aging [19] . Overexpression of NCOA4 has been linked to various pathologies, such as its elevation in mouse neurons being associated with ischemic stroke [20] , and its high expression in cardiomyocytes correlating with myocardial damage [21] . Our animal study findings indicated that compared to healthy rats, EMS rat models showed reduced free iron content in eutopic endometrium and increased in ectopic endometrium, suggesting a local iron metabolism disorder in EMS rats. Yanmeng Li et al. found that intracellular free iron is a key regulator of ferritin expression and iron metabolism [22] . Low free iron levels are detrimental to cell survival, growth, proliferation, and embryonic development. Studies in periodontitis revealed that excess iron ions can produce a large amount of reactive oxygen species (ROS) via the Fenton reaction, leading to oxidative stress and tissue inflammation and destruction [23–25] . To further confirm the mechanisms leading to abnormal iron metabolism in EMS rats, we investigated the expression differences of the NCOA4-mediated iron autophagy pathway. The results indicated abnormalities in the iron autophagy pathway in both eutopic as well as ectopic endometrium of EMS rats, including inhibited autophagy in eutopic and abnormally activated in ectopic endometrium. Therefore, we speculate that local iron metabolism disorders in EMS rats may arise from abnormalities in the iron autophagy pathway within the microenvironment. Immune factors play a crucial role in the onset and progression of EMS. Agostinis et al. proposed that the development of endometriosis might depend on the complex interplay of genetics, immunity, inflammation, and environmental factors [26] . The presence of EMS pathology may be associated with immune imbalance [27] , with various immune surveillance and evasion mechanisms potentially modulating the immune response in EMS [28] . Our analysis revealed changes in immune cell infiltration in eutopic and ectopic endometrium of EMS patients compared to controls. Modern studies confirm that in the lesion microenvironment of ectopic endometrial tissues, the function of almost all types of immune cells (e.g., peritoneal macrophages, lymphocytes, natural killer cells) and the levels of various inflammatory mediators and growth factors in the peritoneal fluid are altered [29] , aligning with our results. Studies have shown that T cell subgroups Th17,regulatory T cells promote EMS progression by secreting various cytokines that regulate other immune cells, promote ectopic implantation and endometrial cell proliferation, and increase angiogenesis [30,31] . Increased numbers and activity of B lymphocytes may play an important role in endometriosis pathogenesis by regulating immune cell activity and producing a large number of anti-endometrial antibodies [32] . Xu H et al. found that reduced toxicity of NK cells facilitates survival of endometrial cells in the abdominal cavity, leading to further development of EMS [33] . McLaren J et al. discovered that macrophages are a significant source of vascular endothelial growth factor (VEGF), which can accelerate EMS progression by promoting vascular growth in EMS lesions [34] . Furthermore, our results show that key iron autophagy genes NCOA4, FTH1, P62, LCB are closely related to various immune cells and immune checkpoint genes in both eutopic and ectopic endometrial tissues of EMS patients, with eutopic endometrial tissues mainly correlating strongly with T lymphocytes and NK cells, and ectopic endometrial tissues mainly with B lymphocytes, T lymphocytes, macrophages. Sottile R et al. found that NCOA4 deficiency impairs IFN-γ receptor signaling, a major effector in activating T cells induced iron death in immunotherapy [35] . In chronic obstructive pulmonary disease, NCOA4 promotes macrophage polarization to the M2 type by targeting iron death [36] . FTH1 is known to interact with several transcription factors regulating the immune system, such as NF-κB [37] and AP-1 [38] , and can regulate the immune system through downstream signaling of these transcription factors. Studies have found that accumulation of FTH1, especially cFTH1, may enhance the inflammatory microenvironment of triple-negative breast cancer cells, leading to activation of CD8 + cytotoxic T cells, NK cell activation, and inhibition of angiogenesis [39] . Immune checkpoint analysis showed that compared to the control group, multiple immune checkpoint genes in both eutopic and ectopic endometrial tissues of EMS patients exhibit abnormal expression related to key iron autophagy genes NCOA4, FTH1, LC3B, P62. These results indicate that in endometriosis, key iron autophagy genes may have a potential regulatory relationship with immune cells, and iron autophagy may play an important role in the immune imbalance of EMS. In the future, restoring the iron homeostasis of the local or microenvironment in eutopic and ectopic endometrial tissues of EMS patients may be an important measure to improve the immune imbalance in EMS and block its progression. 5 Conclusions In summary", while the exact causes of EMS are still not fully understood, disorders in iron metabolism might offer fresh perspectives on the mechanisms underlying the development of EMS. Our study suggests that targeting the NCOA4-mediated iron autophagy pathway to restore the local or microenvironmental iron homeostasis in EMS patients may be a new approach to treat EMS. However, two different trends of up-regulation and down-regulation of NCOA4 in EMS in situ endosomes were observed, and it was hypothesized that NCOA4 might contribute to the development of EMS from different perspectives; in the present study, we only verified the down-regulation trend, and more experiments are still needed to validate the key roles that these two trends might play in the development of EMS. Abbreviations EMS endometriosis AUROC Area Under the Receiver Operating Characteristic Curve NCOA4 Nuclear Receptor Coactivator 4 FTH1 Heavy Chain of Ferritin P62/ SQSTM1 Sequestosome LC3B/ MAP1LC3B Microtubule-Associated Proteins 1A/1B Light Chain 3 Beta P-NF-κB phosphorylated Nuclear Factor kappa-light-chain-enhancer of activated B cells Declarations Ethics approval and consent to participate All experimental protocols were reviewed and approved by the Animal Ethics Committee of Shandong University of Traditional Chinese Medicine (Approval Number: AWE2022053) and carried out in strict accordance with the ARRIVE guidelines. Conflict of Interest Apart from the support of the funding project, all authors of this article have not received any third-party support or services and have no personal or corporate financial interests. Consent for publication Not applicable. Competing interests All authors declare no conflicts of interest. Author details 1 Shandong University of Traditional Chinese Medicine, Jinan, China.2 Affiliated Hospital of Shandong University of Traditional Chinese Medicine, Jinan, China.3 Harvard university. Funding This study was funded by the National Natural Science Foundation of China (81974577, 82174429). Author Contribution YML: Experimental design, conception, writing of the paperand ,and Paper revision; FL, YWZ: Experimental design and paper supervision. All authors have no objections to the published manuscript. Acknowledgement We are grateful to Experimental Center, Shandong University of Traditional Chinese Medicine, Jinan250355, PR China and the Sangerbox platform (http://sangerbox.com/) for their technical support. Data Availability The datasets used and/or analysed during the current study available from the corresponding author on reasonable request. References Tsamantioti ES, Mahdy H. Endometriosis. 2023 Jan 23. In: StatPearls [Internet]. Treasure Island (FL): StatPearls Publishing; 2023 Jan–. PMID: 33620854. Saunders PTK, Horne AW. Endometriosis: Etiology, pathobiology, and therapeutic prospects. Cell. 2021 May 27;184(11):2807–2824. doi: 10.1016/j.cell.2021.04.041. PMID: 34048704. Vercellini P, Viganò P, Somigliana E, et al. Endometriosis: pathogenesis and treatment. Nat Rev Endocrinol. 2014 May;10(5):261 − 75. doi: 10.1038/nrendo.2013.255. Epub 2013 Dec 24. PMID: 24366116. Ahn SH, Singh V, Tayade C. Biomarkers in endometriosis: challenges and opportunities. Fertil Steril. 2017 Mar;107(3):523–532. doi: 10.1016/j.fertnstert.2017.01.009. Epub 2017 Feb 8. PMID: 28189296. Surrey ES, Soliman AM, Yang H, Du EX, Su B. Treatment Patterns, Complications, and Health Care Utilization Among Endometriosis Patients Undergoing a Laparoscopy or a Hysterectomy: A Retrospective Claims Analysis. Adv Ther. 2017 Nov;34(11):2436–2451. doi: 10.1007/s12325-017-0619-3. Epub 2017 Oct 16. PMID: 29039055; PMCID: PMC5702365. Burghaus S, Schäfer SD, Beckmann MW, et al. Diagnosis and Treatment of Endometriosis. Guideline of the DGGG, SGGG and OEGGG (S2k Level, AWMF Registry Number 015/045, August 2020). Geburtshilfe Frauenheilkd. 2021 Apr;81(4):422–446. doi: 10.1055/a-1380-3693. Epub 2021 Apr 14. PMID: 33867562; PMCID: PMC8046516. Gu X,Lai D,Liu S,et al.Hub genes,diagnostic model,and predicted drugs related to iron metabolism in Alzheimer's disease[J].Front Aging Neurosci,2022,14:949083. doi:10.3389/fnagi.2022.949083. El Husseiny NM, Mehaney DA, El Kader Morad MA. New insights on iron study in myelodysplasia. Turk J Haematol. 2014 Dec 5;31(4):394-8. doi: 10.4274/tjh.2012.0154. PMID: 25541657; PMCID: PMC4454055. Stein J, Hartmann F, Dignass AU. Diagnosis and management of iron deficiency anemia in patients with IBD. Nat Rev Gastroenterol Hepatol. 2010 Nov;7(11):599–610. doi: 10.1038/nrgastro.2010.151. Epub 2010 Oct 5. PMID: 20924367. Yoshimoto C, Iwabuchi T, Shigetomi H, et al. Cyst fluid iron-related compounds as useful markers to distinguish malignant transformation from benign endometriotic cysts. Cancer Biomark. 2015;15(4):493-9. doi: 10.3233/CBM-150484. PMID: 25835178. Vallvé-Juanico J, Houshdaran S, Giudice LC. The endometrial immune environment of women with endometriosis. Hum Reprod Update. 2019 Sep 11;25(5):564–591. doi: 10.1093/humupd/dmz018. PMID: 31424502; PMCID: PMC6737540. Newman AM, Steen CB, Liu CL, et al. Determining cell type abundance and expression from bulk tissues with digital cytometry. Nat Biotechnol. 2019 Jul;37(7):773–782. doi: 10.1038/s41587-019-0114-2. Epub 2019 May 6. PMID: 31061481; PMCID: PMC6610714. Zheng P, Mei J, Leng J, et al. Evaluation of the brain functional activities in rats various location-endometriosis pain model. Ann Transl Med. 2019 Dec;7(23):767. doi: 10.21037/atm.2019.11.73. PMID: 32042783; PMCID: PMC6990036. Li L, Sun R, Miao Y, et al. PD-1/PD-L1 expression and interaction by automated quantitative immunofluorescent analysis show adverse prognostic impact in patients with diffuse large B-cell lymphoma having T-cell infiltration: a study from the International DLBCL Consortium Program. Mod Pathol. 2019;32(6):741–754.IF:7.842. Jiao X, Fei X, Li S, Lin D, Ma H, Zhang B. Design Mechanism and Property of the Novel Fluorescent Probes for the Identification of Microthrix Parvicella In Situ. Materials (Basel). 2017;10(7):804. Published 2017 Jul 15.IF:3.623. Grimm A, Cummins N, Götz J. Local Oxidative Damage in the Soma and Dendrites Quarantines Neuronal Mitochondria at the Site of Insult. iScience. 2018;6:114–127.IF:5.458. Zongfei J, Rongyi C, Xiaomeng C, et al. In vitro IL-6/IL-6R Trans-Signaling in Fibroblasts Releases Cytokines That May Be Linked to the Pathogenesis of IgG4-Related Disease. Front Immunol. 2020;11:1272. Published 2020 Jul 8.IF:7.561. Mancias JD, Wang X, Gygi SP, et al. Quantitative proteomics identifies NCOA4 as the cargo receptor mediating ferritinophagy. Nature. 2014 May 1;509(7498):105-9. doi: 10.1038/nature13148. Epub 2014 Mar 30. PMID: 24695223; PMCID: PMC4180099. Bellelli R, Castellone MD, Guida T,et al. NCOA4 transcriptional coactivator inhibits activation of DNA replication origins. Mol Cell. 2014 Jul 3;55(1):123 − 37. doi: 10.1016/j.molcel.2014.04.031. Epub 2014 Jun 5. PMID: 24910095. LI C, SUN G, CHEN B, et al. Nuclear receptor coactivator 4-mediated ferritinophagy contributes to cerebral ischemia-induced ferroptosis in ischemic stroke. Pharmacol Res. 2021 Dec; 174:105933. doi: 10.1016/j.phrs.2021.105933. Epub 2021 Oct 8. PMID: 34634471. LI N, WANG W, ZHOU H, et al. Ferritinophagy-mediated ferroptosis is involved in sepsis-induced cardiac injury. Free Radic Biol Med. 2020 Nov 20; 160:303–318. doi: 10.1016/j.freeradbiomed.2020.08.009. Epub 2020 Aug 23. PMID: 32846217. Li Y, Ouyang Q, Chen Z, et al. Intracellular labile iron is a key regulator of hepcidin expression and iron metabolism. Hepatol Int. 2023 Jun;17(3):636–647. doi: 10.1007/s12072-022-10452-2. Epub 2022 Dec 13. PMID: 36512269. Żukowski P, Maciejczyk M, Waszkiel D. Sources of free radicals and oxidative stress in the oral cavity. Arch Oral Biol. 2018 Aug;92:8–17. doi: 10.1016/j.archoralbio.2018.04.018. Epub 2018 May 1. PMID: 29729478. Guo W, Zhao Y, Li H, et al. NCOA4-mediated ferritinophagy promoted inflammatory responses in periodontitis. J Periodontal Res. 2021 Jun;56(3):523–534. doi: 10.1111/jre.12852. Epub 2021 Feb 3. PMID: 33533512. Liu C,Mo L,Niu Y, et al. The Role of Reactive Oxygen Species and Autophagy in Periodontitis and Their Potential Linkage. Front Physiol. 2017 Jun 23;8:439. doi: 10.3389/fphys.2017.00439. PMID: 28690552; PMCID: PMC5481360. Agostinis C, Balduit A, Mangogna A, et al. Immunological Basis of the Endometriosis: The Complement System as a Potential Therapeutic Target. Front Immunol. 2021 Jan 11; 11:599117. doi: 10.3389/fimmu.2020.599117. PMID: 33505394; PMCID: PMC7829336. Agostinis C, Balduit A, Mangogna A, et al. Immunological Basis of the Endometriosis: The Complement System as a Potential Therapeutic Target. Front Immunol. 2021 Jan 11; 11:599117. doi: 10.3389/fimmu.2020.599117. PMID: 33505394; PMCID: PMC7829336. Wang Y, Nicholes K, Shih IM. The Origin and Pathogenesis of Endometriosis. Annu Rev Pathol. 2020 Jan 24; 15:71–95. doi: 10.1146/annurev-pathmechdis-012419-032654. Epub 2019 Sep 3. PMID: 31479615; PMCID: PMC7980953. Hogg C, Horne AW, Greaves E. Endometriosis-Associated Macrophages: Origin, Phenotype, and Function. Front Endocrinol (Lausanne). 2020 Jan 23; 11:7. doi: 10.3389/fendo.2020.00007. PMID: 32038499; PMCID: PMC6989423. Khan K.N., Yamamoto K., Fujishita A., Muto H., Koshiba A., Kuroboshi H., Saito S., Teramukai S., Nakashima M., Kitawaki J. Differential Levels of Regulatory T Cells and T-Helper-17 Cells in Women with Early and Advanced Endometriosis. J. Clin. Endocrinol. Metab. 2019; 104:4715–4729. doi: 10.1210/jc.2019-00350. Hirata T, Osuga Y, Hamasaki K, et al. Interleukin (IL)-17A stimulates IL-8 secretion, cyclooxygensase-2 expression, and cell proliferation of endometriotic stromal cells. Endocrinology. 2008 Mar;149(3):1260-7. doi: 10.1210/en.2007-0749. Epub 2007 Dec 13. PMID: 18079209. Riccio L.G.C., Baracat E.C., Chapron C., Batteux F., Abrão M.S. The role of the B lymphocytes in endometriosis: A systematic review. J. Reprod. Immunol. 2017; 123:29–34. doi: 10.1016/j.jri.2017.09.001. Xu H. Expressions of natural cytotoxicity receptor, NKG2D and NKG2D ligands in endometriosis. J Reprod Immunol. 2019 Nov; 136:102615. doi: 10.1016/j.jri.2019.102615. Epub 2019 Sep 28. PMID: 31655348. McLaren J, Prentice A, Charnock-Jones DS, et al. Vascular endothelial growth factor is produced by peritoneal fluid macrophages in endometriosis and is regulated by ovarian steroids. J Clin Invest. 1996 Jul 15;98(2):482-9. doi: 10.1172/JCI118815. PMID: 8755660; PMCID: PMC507453. Sottile R, Federico G, Garofalo C, et al. Iron and ferritin modulate MHC class I expression and NK cell recognition. Front Immunol. 2019; 10:224. doi: 10.3389/fimmu.2019.00224. Liu J, Zhang Z, Yang Y, Di T, et al. NCOA4-Mediated Ferroptosis in Bronchial Epithelial Cells Promotes Macrophage M2 Polarization in COPD Emphysema. Int J Chron Obstruct Pulmon Dis. 2022 Mar 30; 17:667–681. doi: 10.2147/COPD.S354896. PMID: 35386390; PMCID: PMC8978690. Lin M, Rippe RA, Niemelä O, et al. Role of iron in NF-kappa B activation and cytokine gene expression by rat hepatic macrophages. Am J Physiol. 1997 Jun;272(6 Pt 1): G1355-64. doi: 10.1152/ajpgi.1997.272.6. G1355. PMID: 9227470. Kaomongkolgit R, Cheepsunthorn P, Pavasant P, et al. Iron increases MMP-9 expression through activation of AP-1 via ERK/Akt pathway in human head and neck squamous carcinoma cells. Oral Oncol. 2008 Jun;44(6):587 − 94. doi: 10.1016/j.oraloncology.2007.08.005. Epub 2007 Oct 23. PMID: 17936676. Liu NQ, De Marchi T, Timmermans AM, et al. Ferritin heavy chain in triple negative breast cancer: a favorable prognostic marker that relates to a cluster of differentiation 8 positive (CD8+) effector T-cell response. Mol Cell Proteomics. 2014 Jul;13(7):1814-27. doi: 10.1074/mcp.M113.037176. Epub 2014 Apr 17. PMID: 24742827; PMCID: PMC4083117. Additional Declarations No competing interests reported. Supplementary Files GSE1415491matrix.txt GSE1415492matrix.txt GSE1415493matrix.txt GSE1415494matrix.txt GSE1415495matrix.txt GSE1415496matrix.txt GSE1415497matrix.txt GSE51981.txt GSE58178seriesmatrix.txt fulllengthgelsandblots.pdf Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4016800","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":288453483,"identity":"be0abebe-4fb0-4c6f-b083-18e08c7b232d","order_by":0,"name":"YiMing Liu","email":"","orcid":"","institution":"Shandong University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"YiMing","middleName":"","lastName":"Liu","suffix":""},{"id":288453484,"identity":"642393a4-ac37-4e04-8320-1ca019e80d8f","order_by":1,"name":"Fang Lian","email":"","orcid":"","institution":"Affiliated Hospital of Shandong University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Fang","middleName":"","lastName":"Lian","suffix":""},{"id":288453485,"identity":"2236c62e-a0be-49c9-82e9-57823e1b258a","order_by":2,"name":"YueWen Zhao","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA3UlEQVRIiWNgGAWjYBCDBAYG5gNAWkKGFC1sCSAtPKRo4TEAMQhrMbiRfEzi4466PP72ns+vbtRY8DCwHz66Ab+WtDTJmWfYiiXOnN1mnXMM6DCetLQb+LXkmN3mbeNJbLiRu804hw2oRYLHjICW/G+3/7ZJJM6/kfPMOOcfUVpy2G4zthkkbriRw/w4t40ILZJnnpn/7G1LSNx45pgZc26fBA8bIb/wHU9+bPCzrS5x3vHmx59zvtXJ8bMfPoZXi8IBBJtNAkziUw4C8g0INvMHQqpHwSgYBaNgZAIAuZRNLm2xctEAAAAASUVORK5CYII=","orcid":"","institution":"Harvard University","correspondingAuthor":true,"prefix":"","firstName":"YueWen","middleName":"","lastName":"Zhao","suffix":""}],"badges":[],"createdAt":"2024-03-05 11:31:33","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4016800/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4016800/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":54312753,"identity":"38d75418-ef14-4751-9c85-f218d7980d16","added_by":"auto","created_at":"2024-04-08 17:24:28","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":49196,"visible":true,"origin":"","legend":"\u003cp\u003eExpression and Diagnostic Value of NCOA4 in Eutopic and Ectopic Endometrial Tissues of EMS in the Training Set. (A) Expression differences of NCOA4 between eutopic endometrium of EMS and control group. (B) Receiver Operating Characteristic (ROC) curve for NCOA4 in diagnosing eutopic endometrium of EMS patients. (C) Expression differences of NCOA4 between ectopic endometrium of EMS and control group. (D) ROC curve for NCOA4 in diagnosing ectopic endometrium of EMS patients. AUROC, Area Under the Receiver Operating Characteristic Curve; CI, Confidence Interval;\u003cem\u003e *P\u003c/em\u003e \u0026lt; 0.05, \u003cem\u003e***P\u003c/em\u003e\u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-4016800/v1/0dadf50752431ba6ab3a852c.png"},{"id":54312755,"identity":"d8ebc169-96a8-4ef8-b49a-251f494a85ed","added_by":"auto","created_at":"2024-04-08 17:24:29","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":57082,"visible":true,"origin":"","legend":"\u003cp\u003eExpression and Diagnostic Value of NCOA4 in Eutopic and Ectopic Endometrial Tissues of EMS in Validation Set GSE141549. (A) Comparison of NCOA4 expression between eutopic endometrium of EMS and control group. (B) ROC curve for NCOA4 in diagnosing eutopic endometrium of EMS patients. (C) Comparison of NCOA4 expression between ectopic endometrium of EMS and control group. (D) ROC curve for NCOA4 in diagnosing ectopic endometrium of EMS patients. AUROC, Area Under the Receiver Operating Characteristic Curve; CI, Confidence Interval; \u003cem\u003e**P\u003c/em\u003e \u0026lt; 0.01, \u003cem\u003e****P\u003c/em\u003e \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-4016800/v1/241008ed12a97aaffeaa6c70.png"},{"id":54312752,"identity":"5f47aee7-887b-4d19-a225-bca68b007fee","added_by":"auto","created_at":"2024-04-08 17:24:27","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":641340,"visible":true,"origin":"","legend":"\u003cp\u003eImmune Infiltration and Immune Checkpoint Gene Distribution \"Variation in immune infiltration and immune checkpoint gene expression across eutopic and ectopic endometrial tissues in patients with EMS and the control group based on GSE51981 (eutopic) and GSE141549 (ectopic) datasets. (A) Proportional expression of 22 immune cell markers in eutopic endometrium of EMS patients versus control eutopic endometrium. (B) Differential expression of immune cell markers between eutopic endometrium of EMS patients and control eutopic endometrium. (C) Proportional expression of 22 immune cell markers in ectopic endometrium of EMS patients versus control eutopic endometrium. (D) Differential expression of immune cell markers between ectopic endometrium of EMS patients and control eutopic endometrium. (E) Differential expression of immune checkpoint genes between eutopic endometrium of EMS patients and control group. (F) Differential expression of immune checkpoint genes between ectopic endometrium of EMS patients and control group. \u003cem\u003e*P\u003c/em\u003e \u0026lt; 0.05, \u003cem\u003e**P\u003c/em\u003e \u0026lt; 0.01, \u003cem\u003e***P\u003c/em\u003e\u0026lt; 0.001,\u003cem\u003e ****P\u003c/em\u003e \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-4016800/v1/8716d90f7bf223f824e9db0b.png"},{"id":54312760,"identity":"e516c39b-38ce-488f-8b3b-db8cda933cca","added_by":"auto","created_at":"2024-04-08 17:24:30","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":312098,"visible":true,"origin":"","legend":"\u003cp\u003eCorrelations Between Key Iron Autophagy Genes, Immune Cells, and Immune Checkpoint Genes (A) Correlation of key iron autophagy genes with immune cells in eutopic endometrial tissue. (B) Correlation of key iron autophagy genes with immune cells in ectopic endometrial tissue. (C) Correlation of key iron autophagy genes with immune checkpoint genes in eutopic endometrial tissue. (D) Correlation of key iron autophagy genes with immune checkpoint genes in ectopic endometrial tissue.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-4016800/v1/99990cac465730baf75048e9.png"},{"id":54312758,"identity":"2a655c2b-fc2e-448c-902d-a210a7596e89","added_by":"auto","created_at":"2024-04-08 17:24:29","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1519580,"visible":true,"origin":"","legend":"\u003cp\u003eLegend not included with this version.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-4016800/v1/f215b1ea6e309c8f431696fd.png"},{"id":54312762,"identity":"10cf6dc9-c6c8-46bf-a7dc-fce0344b05c2","added_by":"auto","created_at":"2024-04-08 17:24:31","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":91728,"visible":true,"origin":"","legend":"\u003cp\u003eNote: A: EMS rat ectopic endometrium; B: Healthy rat endometrium; C: EMS rat eutopic Endometrium. Immunoblotting confirming ectopic NCOA4、LC3B、P62、FTH1 expression in A、Band C. \u0026nbsp;β-actin served as the loading control, all the samples derive from the same experiment and that gels/blots were processed in parallel, and full-length gels and blots are included in a Supplementary Information file wherever possible.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-4016800/v1/5beb5560a598bbebc2982982.png"},{"id":54312763,"identity":"9ce4413c-0a4c-4f05-a632-c78a3431e353","added_by":"auto","created_at":"2024-04-08 17:24:31","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":2076771,"visible":true,"origin":"","legend":"\u003cp\u003eImmunofluorescence Colocalization （A）Healthy Rat Endometrium with NCOA4 (Red) on Left and LC3B (Green) on Right （B）Endometriosis Rat Model Ectopic Endometrium with NCOA4 (Red) on Left and LC3B (Green) on Right （C）EMS Rat Model Ectopic Endometrium with NCOA4 (Red) on Left and LC3B (Green) on Right\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-4016800/v1/7672697627edf6995fcd7353.png"},{"id":64741417,"identity":"482a3a71-25c5-4112-aafc-cb21f362f055","added_by":"auto","created_at":"2024-09-18 08:57:00","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":5023203,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4016800/v1/1169672c-4b77-4892-bc61-c2127aeabcf9.pdf"},{"id":54312756,"identity":"0dd7d33d-20d1-4d16-8719-373466243893","added_by":"auto","created_at":"2024-04-08 17:24:29","extension":"txt","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":31485549,"visible":true,"origin":"","legend":"","description":"","filename":"GSE1415491matrix.txt","url":"https://assets-eu.researchsquare.com/files/rs-4016800/v1/ca827b5876194772b455b25a.txt"},{"id":54312784,"identity":"1a6b9230-093c-46fb-b3b0-5c83ee72af25","added_by":"auto","created_at":"2024-04-08 17:24:32","extension":"txt","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":75589373,"visible":true,"origin":"","legend":"","description":"","filename":"GSE1415492matrix.txt","url":"https://assets-eu.researchsquare.com/files/rs-4016800/v1/867a09345a85b9eb69e2bad6.txt"},{"id":54312761,"identity":"88427edf-f945-47ec-8f56-b15b85de5afa","added_by":"auto","created_at":"2024-04-08 17:24:30","extension":"txt","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":42802577,"visible":true,"origin":"","legend":"","description":"","filename":"GSE1415493matrix.txt","url":"https://assets-eu.researchsquare.com/files/rs-4016800/v1/b33c30bdbb32d8e77605907c.txt"},{"id":54312764,"identity":"c23f2f88-6179-49c6-b4af-fbb8c981e729","added_by":"auto","created_at":"2024-04-08 17:24:31","extension":"txt","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":42889922,"visible":true,"origin":"","legend":"","description":"","filename":"GSE1415494matrix.txt","url":"https://assets-eu.researchsquare.com/files/rs-4016800/v1/b7515f171c9ff29e0177d504.txt"},{"id":54312786,"identity":"50d10af9-ef78-4ff7-9fd2-4da1d1ff707f","added_by":"auto","created_at":"2024-04-08 17:24:33","extension":"txt","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":53311560,"visible":true,"origin":"","legend":"","description":"","filename":"GSE1415495matrix.txt","url":"https://assets-eu.researchsquare.com/files/rs-4016800/v1/f778e27d519d9c3f03477dcc.txt"},{"id":54312785,"identity":"12b3e51d-1724-4458-8e48-b10f644860a7","added_by":"auto","created_at":"2024-04-08 17:24:33","extension":"txt","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":26942009,"visible":true,"origin":"","legend":"","description":"","filename":"GSE1415496matrix.txt","url":"https://assets-eu.researchsquare.com/files/rs-4016800/v1/e25858a01909457a81702c6a.txt"},{"id":54312759,"identity":"1e0232cb-60e1-4a90-856b-a51b69ed556f","added_by":"auto","created_at":"2024-04-08 17:24:30","extension":"txt","order_by":8,"title":"","display":"","copyAsset":false,"role":"supplement","size":24616252,"visible":true,"origin":"","legend":"","description":"","filename":"GSE1415497matrix.txt","url":"https://assets-eu.researchsquare.com/files/rs-4016800/v1/138c8d42a1525e255c055019.txt"},{"id":54312787,"identity":"198c2420-2e6d-4e9d-8c6c-f635cef226e1","added_by":"auto","created_at":"2024-04-08 17:24:33","extension":"txt","order_by":9,"title":"","display":"","copyAsset":false,"role":"supplement","size":40595602,"visible":true,"origin":"","legend":"","description":"","filename":"GSE51981.txt","url":"https://assets-eu.researchsquare.com/files/rs-4016800/v1/e0b0ea51bd36dabd9bd1d1dc.txt"},{"id":54312757,"identity":"47e1c9f7-1597-41b5-b2a0-9c1bab8580e6","added_by":"auto","created_at":"2024-04-08 17:24:29","extension":"txt","order_by":10,"title":"","display":"","copyAsset":false,"role":"supplement","size":7645428,"visible":true,"origin":"","legend":"","description":"","filename":"GSE58178seriesmatrix.txt","url":"https://assets-eu.researchsquare.com/files/rs-4016800/v1/609b6b9a5b51b90ce23ac9a6.txt"},{"id":54312765,"identity":"e8570b3c-8917-41b4-9852-e446e7d0e82f","added_by":"auto","created_at":"2024-04-08 17:24:31","extension":"pdf","order_by":11,"title":"","display":"","copyAsset":false,"role":"supplement","size":391040,"visible":true,"origin":"","legend":"","description":"","filename":"fulllengthgelsandblots.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4016800/v1/9897e77cc31b6a775f63ae39.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Immunological Dysregulation in Endometriosis Potentially Linked to Anomalies in NCOA4-Mediated Iron Autophagy Pathway","fulltext":[{"header":"1 Background","content":"\u003cp\u003eEndometriosis (EMS) is a prevalent gynecological disorder characterized by the aberrant growth of functional endometrial tissue outside the uterine lining, manifesting clinically as pain and infertility \u003csup\u003e[1\u0026ndash;2]\u003c/sup\u003e. The consensus among researchers points to the involvement of hormonal, inflammatory, immunological, genetic, and environmental factors in the onset and progression of EMS \u003csup\u003e[3]\u003c/sup\u003e. However, due to the enigmatic nature of EMS pathogenesis, current clinical diagnostics lack non-invasive biomarkers and definitive therapeutic interventions \u003csup\u003e[4\u0026ndash;6]\u003c/sup\u003e, rendering the identification of novel targets for EMS progression a critical area of research focus.\u003c/p\u003e \u003cp\u003eFerritin, the body's exclusive iron storage protein, undergoes degradation via the NCOA4-mediated iron autophagy pathway, a process integral to cellular iron homeostasis through the release and recycling of iron ions. Disruptions in iron homeostasis have been implicated in the pathogenesis of a spectrum of diseases, including Alzheimer's disease, myelodysplastic syndromes, and inflammatory bowel disease \u003csup\u003e[7\u0026ndash;9]\u003c/sup\u003e. Studies also indicate prevalent iron overload in the peritoneum, peritoneal fluid, ectopic endometrial lesions, and macrophages in EMS patients \u003csup\u003e[10]\u003c/sup\u003e. Nevertheless, the exact role of iron homeostasis imbalance in the EMS developmental trajectory remains elusive. This study, therefore, endeavors to investigate the expression and potential mechanistic roles of NCOA4 and its mediated iron autophagy signaling pathway with the goal of uncovering new pathways contributing to the development of EMS, focusing on both eutopic and ectopic endometrial tissues.\u003c/p\u003e"},{"header":"2 Experimental Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n\u003ch2\u003e2.1 Collection and Processing of Microarray Data\u003c/h2\u003e\n\u003cp\u003eDatasets from microarrays were sourced from the GEO database, with 'endometriosis' being the main keyword used for searching. The strategy employed was: (\u0026ldquo;endometriosis\u0026rdquo;[MeSH Terms] OR Endometriosis[All Fields]) AND \"Homo sapiens\"[porgn] AND \"Expression profiling by array\"[Filter]). In conducting the analysis that compares the eutopic endometrium in EMS patients with the corresponding tissue in healthy individuals, datasets GSE51981 (training set) and GSE141549 (validation set) were selected. GSE51981 comprises RNA samples from 77 eutopic endometrial tissues of EMS patients and 71 from control group eutopic endometrial tissues, whereas GSE141549 includes RNA samples from 104 EMS eutopic endometrial tissues and 43 controls. To compare ectopic endometrium in EMS patients with healthy control endometrium, GSE58178 (training set) and GSE141549 (validation set) were chosen. GSE58178 comprises RNA samples from six EMS patient ectopic endometrial tissues and an equal number from control group eutopic endometrial tissues. Conversely, GSE141549 encompasses 149 RNA samples from ectopic endometrial tissues of EMS patients and 43 from eutopic endometrial tissues of the control group.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\n\u003ch2\u003e2.2 Immune Infiltration and Immune Checkpoint Gene Dynamics in Endometriosis Versus Control Groups\u003c/h2\u003e\n\u003cp\u003eEMS is closely associated with immune system anomalies \u003csup\u003e[11]\u003c/sup\u003e. Consequently, we employed the CIBERSORT algorithm \u003csup\u003e[12]\u003c/sup\u003e to discern variances in the expression of immune cell markers between eutopic and ectopic endometrial tissues in EMS patients as compared to healthy controls. CIBERSORT is a robust tool that utilizes linear support vector regression to deconvolve the expression matrix of distinct human immune cell subtypes. This technique is grounded in a well-established reference set that characterizes gene expression patterns for 22 different immune cell subtypes. Furthermore, Pearson correlation analysis was conducted to explore the associations between NCOA4, LC3B, FTH1, P62 expression, and the immune cell subgroups and checkpoint genes within both the ectopic and eutopic endometrial tissues in individuals with EMS.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\n\u003ch2\u003e2.3 Laboratory Animals\u003c/h2\u003e\n\u003cp\u003eHealthy female Sprague-Dawley (SD) rats, of specific pathogen-free (SPF) grade, nulliparous, aged 8 weeks, and with a weight range of 180-220g, were procured from Jinan Pengyue Experimental Animal Breeding Co., Ltd., under the license number SCXK(Lu) 2019 0003. These creatures were accommodated in the Shandong University of Traditional Chinese Medicine Experimental Animal Center (SPF grade), with ambient conditions maintained at 21\u0026ndash;24\u0026deg;C and relative humidity at 40\u0026ndash;60%. Animals had ad libitum access to food and water. The animal use and care protocols adhered to the \u0026ldquo;Guide for the Care and Use of Laboratory Animals,\u0026rdquo; strictly observing the 3Rs principle. All experimental protocols were reviewed and approved by the Animal Ethics Committee of Shandong University of Traditional Chinese Medicine (Approval Number: AWE2022053) and we confirm that all methods were performed in accordance with the American Veterinary Medical Association (AVMA) Guidelines for the Euthanasia of Animals (2020) and ARRIVE guidelines.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\n\u003ch2\u003e2.4 Principal Instruments and Reagents\u003c/h2\u003e\n\u003cp\u003e\u003cstrong\u003eInstruments\u003c/strong\u003e: High-Speed Refrigerated Centrifuge (Dynamica, Model: VELOCITY 18R). Basic Electrophoresis Unit (Bio-Rad, Model: PowerPac Basic). Electrophoresis Tank (Junyi Dongfang Electrophoresis Equipment Co., Beijing, Model: JY300C). Gel Imaging System (Shanghai Tianneng Technology Co., Ltd., Model: Tanon 1600). Microspectrophotometer (Hangzhou Aosheng Instrument Co., Model: Nano-300). Standard PCR Machine (Likang Co., Model: K960). Real-Time Quantitative PCR System (Roche, Model: Roche LightCycler 480). Whole Slide Scanner (PANNORAMIC, Hungary, Models: DESK/MIDI/250/1000). Tissue Dehydrator (Leica, Germany, Model: ASP300S). Embedding Machine (Leica, Germany, Model: EG1160). Pathology Microtome (Thermo Fisher Scientific (Shanghai) Co., Ltd., Model: HM 325). Cryostat Microtome (Leica, Germany, Model: CM1860 UV). Upright Optical Microscope (Nikon, Japan, Model: ECLIPSE 80i). Microplate Reader (Molecular Devices, Model: Cmax Plus). Tissue Grinder (Jingxin Co., Model: JXFSTPRP-48L). Vertical Electrophoresis Unit, Transfer Electrophoresis Unit (Servicebio, Product Code: SVE-2).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eReagents\u003c/strong\u003e: Ferrous Ion Colorimetric Assay Kit (Elabscience, Batch No.: GY12R0627507). SPARKeasy Tissue/Cell RNA Rapid Extraction Kit, SPARKscript II All-in-one RT SuperMix for qPCR, 2\u0026times;SYBR Green qPCR Mix (SparkJade, Product Codes: AG0305, AH0104). Primary Antibodies for \u0026beta;-actin, NCOA4, FTH1), Sequestosome-1 (P62), Microtubule-Associated Proteins 1A/1B Light Chain 3B (LC3B) (all from ABclonal, Product Codes: AC026, A5695, A19544, A19700, A19665). Secondary Antibody HRP-conjugated Goat Anti-Rabbit (Servicebio, Product Code: GB23303). TSA Fluorescence Dual Staining Kit (Servicebio, Product Code: G235-100T). High-Efficiency RIPA Lysis Buffer (Tissue/Cell) (Solarbio, Batch No.: 2311006). BCA Protein Concentration Determination Kit (Enhanced) (Beyotime, Batch No.: 060723230913). DAPI Staining Reagent (Wuhan Seville Biotechnology Co., Ltd., Batch No.: G1012). Xylene (Shanghai Lingfeng Chemical Reagent Co., Ltd., Batch No.: 20230609). Hematoxylin Staining Solution, Eosin Y Staining Solution (Servicebio, Product Codes: CR2301041-2, CR2303033-5).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\n\u003ch2\u003e2.5 Group Modeling\u003c/h2\u003e\n\u003cp\u003eFollowing a week of acclimatization, twenty rats were arbitrarily segregated into two groups: a control group comprising eight rats and an EMS group consisting of twelve rats. The EMS rat model was established using auto transplantation as per referenced literature \u003csup\u003e[13]\u003c/sup\u003e. After a week of post-model establishment acclimatization, exploratory laparotomy was performed for model assessment, followed by four weeks of standardized care, then the animals were euthanized by guillotine decapitation. Partial ectopic/eutopic endometrial tissues and endometrial tissues were removed and placed in glass Petri dishes with chilled saline solution for subsequent assays. Others were collected and stored at \u0026minus;\u0026thinsp;80\u0026deg;C until processing.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\n\u003ch2\u003e2.6 Hematoxylin and Eosin (H\u0026amp;E) Staining\u003c/h2\u003e\n\u003cp\u003eInitially, the paraffin-embedded tissue sections undergo dewaxing to the point of hydration. This involves sequential submersion in both xylene I and II for 20 minutes each, followed by immersion in anhydrous ethanol I and II for 5 minutes each, and then in 75% alcohol for another 5 minutes, with intermittent rinsing in tap water. Subsequently, the sections are stained with hematoxylin for 3\u0026ndash;5 minutes, rinsed, differentiated, and blued, again with intermittent rinsing in tap water. Post-staining, the sections are dehydrated using increasing concentrations of alcohol (85% and 95%, for 5 minutes each) and then stained with eosin for 5 minutes. The concluding step includes multiple immersions in anhydrous ethanol (I, II, and III) and xylene (I and II), for 5 minutes each, to clarify the sections, followed by sealing with neutral resin. These sections are then ready for microscopic examination, image capture, and subsequent analysis.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\n\u003ch2\u003e2.7 Western Blot Analysis\u003c/h2\u003e\n\u003cp\u003eFor tissue homogenate preparation, 20 mg of endometrial tissue is finely ground to \u0026le;\u0026thinsp;1mm particles. This is mixed with 180 \u0026micro;L of tissue protein lysis buffer and lysed on ice for an hour. Post-centrifugation of the homogenate for 15 minutes at 4\u0026deg;C and 12,000 rpm, the supernatant is collected. Protein concentration in the supernatant is quantified using the BCA assay. The proteins are then denatured by mixing with 5\u0026times; loading buffer and boiling at 99\u0026deg;C for 10 minutes. Separation of these protein samples is achieved through 10% SDS-PAGE, followed by transfer onto a PVDF membrane. The membrane is blocked for 15 minutes and incubated overnight at 4\u0026deg;C with primary antibodies against NCOA4 (1:500), FTH1 (1:2000), LC3B (1:1000), P62 (1:1000), p-NF-KB (1:5000), and \u0026beta;-actin (1:500000). After triple rinses with TBST, each lasting 10 minutes, the membrane is incubated with corresponding secondary antibodies (1:3000) at room temperature for an hour. Visualization is accomplished using ECL substrate, and the resulting bands are quantitatively analyzed with Image J -win64 software.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\n\u003ch2\u003e2.8 Quantitative PCR (q-PCR) Analysis\u003c/h2\u003e\n\u003cp\u003eEndometrial tissue samples, previously stored at -80\u0026deg;C, were thawed for RNA extraction using the SPARKeasy Tissue/Cell RNA Rapid Extraction Kit. The extracted total RNA was reverse-transcribed into cDNA. The qRT-PCR reaction setup, as per the 2\u0026times;SYBR Green qPCR Mix kit's protocol, included the addition of cDNA, specific primers for target and housekeeping genes (designed and synthesized by Shanghai Sangon Biotech Co., Ltd.), and other necessary reagents. Amplifications were performed on a qRT-PCR instrument. The mRNA expression levels of NCOA4, FTH1, LC3B, and P62 were quantified using the 2-∆∆Ct method, with \u0026beta;-actin serving as the internal control. The sequences of these primers are detailed in Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003ctable id=\"Tab1\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003ePrimer Sequences\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eGene\u003c/p\u003e\n\u003c/th\u003e\n\u003cth colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003ePrimer Sequence (5'-3')\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eProduct Length\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003eNCOA4\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eForward ATATTAAGCCTCTGAGTTGCCTATGC\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e85\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eReverse CTCTATGGTAATGTCACTGTGGGAAG\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003eFTH1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eForward TGCCATCAACCGCCAGATCAAC\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e155\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eReverse TCAGTTTCTCAGCAIGTTCCCTCTC\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003eLC3\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eForward CAAGCCTTCTTCCTCCTGGTGAAT\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e140\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eReverse AGTGCTGTCCCGAACGTCTCC\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003eP62\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eForward TGGTCGTGGGGTGTCTGTGAG\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e130\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eReverse TCTGGTGATGGAGCCTCTTACTGG\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e\u0026beta;-actin\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eForward CCCATCTATGAGGGTTACGC\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e150\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eReverse TTTAATGTCACGCACGATTTC\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003ctfoot\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"4\"\u003eNote: NCOA4 refers to Nuclear Receptor Coactivator 4; FTH1 to the Heavy Chain of Ferritin; P62 denotes Sequestosome; LC3B stands for Microtubule-Associated Proteins 1A/1B Light Chain 3 Beta; P-NF-\u0026kappa;B represents the phosphorylated Nuclear Factor kappa-light-chain-enhancer of activated B cells.\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tfoot\u003e\n\u003c/table\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n\u003ch2\u003e2.9 Determination of Free Iron Content\u003c/h2\u003e\n\u003cp\u003eThe Iron (II) Ion Colorimetric Assay Kit (Elabscience, Lot No: GY12R0627507) was utilized to measure the free iron content in accordance with the manufacturer's guidelines.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n\u003ch2\u003e2.10 Immunofluorescence Colocalization Study\u003c/h2\u003e\n\u003cp\u003eEutopic (or control or ectopic) endometrial tissues, fixed in polyformaldehyde, were sectioned and deparaffinized. The sections underwent antigen retrieval and were processed through a series of steps including hydrogen peroxide and serum blocking the initial application of the primary antibody, succeeded by the respective HRP-conjugated secondary antibody and CY3-TSA. Post-microwave treatment, the second primary antibody was applied, succeeded by the corresponding secondary antibody and DAPI nuclear counterstaining. The slides were then treated for autofluorescence quenching and prepared for microscopic examination and photographic documentation. The results were analyzed using Aipathwell digital pathology image analysis software, utilizing techniques of tracing, color selection, and computational analysis \u003csup\u003e[14\u0026ndash;17]\u003c/sup\u003e.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\n\u003ch2\u003e2.11 Statistical Methodology\u003c/h2\u003e\n\u003cp\u003eData were processed using SPSS software (version 26.0). Quantitative data, adhering to a normal distribution, were expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (x\u0026macr;\u0026plusmn;s). For homogeneous variances, a one-way ANOVA was utilized for multi-group comparisons, with post-hoc pairwise comparisons conducted via the LSD method. In cases of heterogeneity of variance, the Welch test was employed, with intergroup comparisons conducted using the Kruskal-Wallis rank-sum test. Statistical significance was set at a \u003cem\u003ep\u003c/em\u003e-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"3 Results","content":"\u003cp\u003e\u003cstrong\u003e3.1 Differential Expression of NCOA4 in Eutopic and Ectopic Endometrial Tissues of EMS in the Training Set\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFigure 1 illustrates the expression patterns and diagnostic relevance of NCOA4 in both ectopic and eutopic endometrial tissues in EMS patients, utilizing data from GSE51981 and GSE58178 in the training set. The results demonstrate a notable decrease in NCOA4 levels in the eutopic endometrial tissues of EMS patients relative to those in the control group. (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001, Fig.\u0026nbsp;1A). The AUROC for diagnosing eutopic endometrium in EMS was determined to be 0.68 (95% CI: 0.77\u0026thinsp;\u0026minus;\u0026thinsp;0.59, Fig.\u0026nbsp;1B). In contrast, NCOA4 was significantly upregulated in the ectopic endometrial tissues of EMS patients (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;1C), with an AUROC for diagnosing ectopic endometrium in EMS at 0.83 (95% CI: 1.0-0.57, Fig.\u0026nbsp;1D).\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\n\u003ch2\u003e3.2 Enhanced Expression of NCOA4 in Eutopic and Ectopic Endometrium of EMS in the Validation Set\u003c/h2\u003e\n\u003cp\u003eFigure 2 highlights the expression and diagnostic significance of NCOA4 in both eutopic and ectopic endometrial tissues of EMS in the validation datasetResults demonstrated a notable upregulation of NCOA4 in eutopic endometrial tissues of EMS patients compared to the control group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001, Fig.\u0026nbsp;2A). The AUROC for diagnosing eutopic endometrium in EMS was 0.77 (95% CI: 0.84\u0026thinsp;\u0026minus;\u0026thinsp;0.69, Fig.\u0026nbsp;2B). Similarly, a significant upregulation of NCOA4 was observed in ectopic endometrial tissues of EMS patients (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01, Fig.\u0026nbsp;2C), with an AUROC for diagnosing ectopic endometrium in EMS at 0.66 (95% CI: 0.75\u0026thinsp;\u0026minus;\u0026thinsp;0.57, Fig.\u0026nbsp;2D).\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u003cstrong\u003e3.3 Differential Expression of Various Immune Cell Types and Aberrant Overexpression of Immune Checkpoint Genes in Eutopic and Ectopic Endometrium of EMS Patients\u003c/strong\u003e\u003c/div\u003e\n\u003c/div\u003e\n\u003cp\u003eThe CIBERSORT algorithm was utilized to evaluate the variations in immune cells between eutopic and ectopic endometrial tissues of EMS patients in comparison to control eutopic endometrium. Figure\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eA illustrates the proportionate expression of 22 immune cell types in the eutopic endometrium of EMS patients versus the control eutopic endometrium, with the initial 77 cases representing EMS patient eutopic endometrium and the subsequent 71 cases representing control eutopic endometrium. Figure\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eB reveals significant differential expression in six immune cell types in eutopic endometrium of EMS patients compared to controls. Three cell types (Plasma cells, T cells CD8, NK cells resting) were more prevalent, while three types (T cells gamma delta, Macrophages M2, Dendritic cells activated) were less expressed in the eutopic endometrium of EMS patients. Figure\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eC displays the proportionate expression of 22 immune cell types in ectopic endometrium of EMS patients versus control eutopic endometrium, with the first 149 cases being ectopic endometrium of EMS patients and the last 43 being control eutopic endometrium. Figure\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eD indicates that 15 immune cell types demonstrated significant variance in expression in ectopic endometrium of EMS patients compared to controls, with eight types (B cells Memory, T cells CD4 memory resting/activated, Monocytes, Macrophages M1/M2, Mast cells resting, Neutrophils) exhibiting increased expression, and seven types (Plasma cells, T cells CD8, T cells follicular helper, Tregs, NK cells resting/activated, Dendritic cells activated) showing decreased expression.\u003c/p\u003e\n\u003cp\u003eFurther analysis of microarray data was conducted to explore the disparities in immune checkpoint gene expression between eutopic and ectopic endometrial tissues of EMS patients compared to the control group. The findings indicated that, relative to the control group, five out of eight immune checkpoint genes exhibited significant overexpression in the eutopic endometrium of EMS patients (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eE), including CTLA4, LAG3, CD48, CD27, CD40. In the ectopic endometrium of EMS patients, six out of eight genes were significantly overexpressed (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eF), comprising CTLA4, IDO1, LAG3, CD48, CD27, CD40. In summary, immune checkpoint genes showed anomalously high expression in both eutopic and ectopic endometrial tissues of EMS patients.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.4 Correlation Between the Differential Expression of Key Iron Autophagy Genes NCOA4, FTH1, SQSTM1 (P62), MAP1LC3B (LC3B) and Immune Cells, Immune Checkpoint Genes in Ectopic and Eutopic Endometrium of Patients with EMS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFigure 4A displays the correlation between four crucial iron autophagy genes (NCOA4, FTH1, SQSTM1(P62), MAP1LC3B(LC3B)) and immune cells in eutopic endometrium of EMS patients. NCOA4 exhibited significant correlations with 10 immune cell types, showing positive correlations with six and negative correlations with four, with the strongest correlations being with NK cells resting (r = -0.64, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) and T cells gamma delta (r\u0026thinsp;=\u0026thinsp;0.54, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001). FTH1 correlated significantly with six immune cell types, predominantly negative (4/6), with the strongest being with Plasma cells (r = -0.35, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01). SQSTM1(P62) correlated significantly with 11 immune cell types, positively with five and negatively with six, with the strongest correlations being with NK cells resting (r\u0026thinsp;=\u0026thinsp;0.58, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) and T cells gamma delta (r = -0.59, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001). MAP1LC3B(LC3B) showed significant correlations with six immune cell types, positively with three and negatively with three, with the strongest correlations being with T cells CD8 (r = -0.52, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) and NK cells activated (r\u0026thinsp;=\u0026thinsp;0.47, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01).\u003c/p\u003e\n\u003cp\u003eFigure 4B illustrates the correlation between these key iron autophagy genes and immune cells in ectopic endometrium of EMS patients. NCOA4 showed negative correlations with four immune cell types, the strongest being with T cells CD4 memory activated (r = -0.2, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). FTH1 negatively correlated with three immune cell types, with the strongest being with B cells memory (r = -0.22, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01). SQSTM1(P62) displayed no notable correlation with immune cells. MAP1LC3B(LC3B) was significantly correlated with three immune cell types, mostly negative (2/3), with the strongest being with B cells memory (r = -0.2, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e\n\u003cp\u003eIn eutopic endometrium of EMS patients, the correlation of four key iron autophagy genes with immune checkpoint genes is shown in Fig.\u0026nbsp;4C. NCOA4 negatively correlated with CTLA4 (r = -0.25, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), LMTK3 (r = -0.45, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001), LAG3 (r = -0.36, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), CD48 (r = -0.24, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), CD27 (r = -0.79, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), CD40 (r = -0.53, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001), and positively with IDO1 (r\u0026thinsp;=\u0026thinsp;0.38, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01). FTH1 positively correlated with CD27 (r\u0026thinsp;=\u0026thinsp;0.29, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), CD40 (r\u0026thinsp;=\u0026thinsp;0.25, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). SQSTM1(P62) showed positive correlations with LMTK3 (r\u0026thinsp;=\u0026thinsp;0.47, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001), LAG3 (r\u0026thinsp;=\u0026thinsp;0.36, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), CD48 (r\u0026thinsp;=\u0026thinsp;0.26, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), CD27 (r\u0026thinsp;=\u0026thinsp;0.71, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), CD40 (r\u0026thinsp;=\u0026thinsp;0.62, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001), and a negative correlation with IDO1 (r = -0.33, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01). MAP1LC3B(LC3B) negatively correlated with CTLA4 (r = -0.26, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), CD27 (r = -0.44, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001), and positively with IDO1 (r\u0026thinsp;=\u0026thinsp;0.76, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001).\u003c/p\u003e\n\u003cp\u003eIn ectopic endometrium of EMS patients, the correlation of these genes with immune checkpoint genes is depicted in Fig.\u0026nbsp;4D. NCOA4 positively correlated with CTLA4 (r\u0026thinsp;=\u0026thinsp;0.46, P\u0026thinsp;\u0026lt;\u0026thinsp;0.001), IDO1 (r\u0026thinsp;=\u0026thinsp;0.41, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001), LMTK3 (r\u0026thinsp;=\u0026thinsp;0.73, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), LAG3 (r\u0026thinsp;=\u0026thinsp;0.36, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001), CD48 (r\u0026thinsp;=\u0026thinsp;0.66, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), CD27 (r\u0026thinsp;=\u0026thinsp;0.42, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001), CD40 (r\u0026thinsp;=\u0026thinsp;0.22, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), and negatively with ICOS (r = -0.48, P\u0026thinsp;\u0026lt;\u0026thinsp;0.001). FTH1 positively correlated with CTLA4 (r\u0026thinsp;=\u0026thinsp;0.44, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001), IDO1 (r\u0026thinsp;=\u0026thinsp;0.35, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001), LMTK3 (r\u0026thinsp;=\u0026thinsp;0.67, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), LAG3 (r\u0026thinsp;=\u0026thinsp;0.34, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001), CD48 (r\u0026thinsp;=\u0026thinsp;0.72, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), CD27 (r\u0026thinsp;=\u0026thinsp;0.37, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001), CD40 (r\u0026thinsp;=\u0026thinsp;0.16, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and negatively with ICOS (r = -0.48, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001). SQSTM1(P62) showed positive correlations with CTLA4 (r\u0026thinsp;=\u0026thinsp;0.33, P\u0026thinsp;\u0026lt;\u0026thinsp;0.001), IDO1 (r\u0026thinsp;=\u0026thinsp;0.79, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), LMTK3 (r\u0026thinsp;=\u0026thinsp;0.75, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), LAG3 (r\u0026thinsp;=\u0026thinsp;0.55, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), CD48 (r\u0026thinsp;=\u0026thinsp;0.51, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), CD27 (r\u0026thinsp;=\u0026thinsp;0.80, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), CD40 (r\u0026thinsp;=\u0026thinsp;0.56, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), and MAP1LC3B(LC3B) positively correlated with CTLA4 (r\u0026thinsp;=\u0026thinsp;0.46, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001), IDO1 (r\u0026thinsp;=\u0026thinsp;0.56, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), LMTK3 (r\u0026thinsp;=\u0026thinsp;0.76, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), LAG3 (r\u0026thinsp;=\u0026thinsp;0.39, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001), CD48 (r\u0026thinsp;=\u0026thinsp;0.67, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), CD27 (r\u0026thinsp;=\u0026thinsp;0.58, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001), CD40 (r\u0026thinsp;=\u0026thinsp;0.34, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001), and negatively with ICOS (r = -0.29, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001).\u003c/p\u003e\n\u003cp\u003eIn summary, in eutopic endometrial tissues of EMS patients, NCOA4 showed a notable positive association with one immune checkpoint gene and negative associations with six others; moreover, FTH1 showed positive correlations with two immune checkpoint genes; SQSTM1(P62) positively with five and negatively with one; and MAP1LC3B(LC3B) positively with one and negatively with two immune checkpoint genes. In ectopic endometrial tissues, NCOA4 showed a positive correlation with seven immune checkpoint genes, and a negative correlation with one; FTH1 positively with seven and negatively with one; SQSTM1(P62) positively with all seven; and MAP1LC3B(LC3B) positively with seven and negatively with one.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\n\u003ch2\u003e3.5 Histopathological Analysis\u003c/h2\u003e\n\u003cp\u003eTo examine the histopathological conditions of eutopic and ectopic endometrial tissues in EMS rats, HE staining was conducted on tissue samples from the control group and the EMS group. Histopathological examination showed a profusion of endometrial and glandular epithelium (blue arrows), a dense stroma, and an abundance of matrix cells with some uterine glands in the control group. Conversely, ectopic endometrial sections from EMS rats displayed formations of small cavity structures in endometrial epithelium, extensive degenerative changes (blue arrows), loosely stained cytoplasm, increased matrix cells, and scattered granulocyte infiltration (red arrows), accompanied by infiltration of multinucleated giant cells and macrophages (yellow arrows). The HE-stained eutopic endometrial tissues in EMS rats did not exhibit notable differences relative to the control group, as illustrated in Fig.\u0026nbsp;5.\u003c/p\u003e\n\u003ch2\u003e3.6 Variations in Free Iron Content in Eutopic and Ectopic Endometrium of EMS Rats\u003c/h2\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\n\u003cp\u003eThe investigation of free iron content in the eutopic endometrium of the control group and in both eutopic and ectopic endometrium of EMS rats indicated a significant elevation in free iron content in the ectopic endometrium, while a noticeable reduction was observed in the eutopic endometrium of EMS rats compared to the control group. These findings imply disruptions in iron metabolism within eutopic as well as ectopic endometrial tissues in rats of EMS (refer to Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003ctable id=\"Tab2\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003eQuantification of Free Iron in Endometrial Tissues of Various Rat Groups (n\u0026thinsp;=\u0026thinsp;3, mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD)\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eGroup\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eHealthy Rat Endometrium\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eEMS Rat Eutopic Endometrium\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eEMS Rat Ectopic Endometrium\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eFree Iron Content (\u0026micro;mol/kg)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e386.75\u0026thinsp;\u0026plusmn;\u0026thinsp;42.6\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e165.3\u0026thinsp;\u0026plusmn;\u0026thinsp;7.63\u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e756.01\u0026thinsp;\u0026plusmn;\u0026thinsp;51.79\u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003ctfoot\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"4\"\u003eNote: Data are presented to two decimal places. Compared to the healthy rat endometrium, \u003cem\u003e###P\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001.\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tfoot\u003e\n\u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003cstrong\u003e3.7 Altered Protein Levels of NCOA4, LC3B, FTH1, and P62 in Eutopic and Ectopic Endometrium of EMS Rats\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIron autophagy, facilitated by NCOA4, involves the degradation of cellular ferritin FTH1 in autolysosomes, thus releasing free iron ions, pivotal in iron metabolism under both physiological and pathological states. To investigate the cause behind abnormal free iron levels in eutopic and ectopic endometrial tissues of EMS rats, the expression levels of iron autophagy-associated proteins such as NCOA4, LC3B, FTH1, and P62 were examined.. Compared to the control group, ectopic endometrial tissues in EMS rats exhibited increased expression of NCOA4 and LC3B proteins (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) and decreased expression of FTH1 and P62 proteins (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). In contrast, eutopic endometrial tissues showed decreased expression of NCOA4 and LC3B proteins (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01 or 0.001) and increased expression of FTH1 and P62 proteins (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), as illustrated by Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e and detailed within Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003ctable id=\"Tab3\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003eRelative Expression Levels of NCOA4, LC3B II/I, FTH1, and P62 Proteins in Healthy, Eutopic, and Ectopic Endometrium of Rats (x\u0026macr;\u0026plusmn;s)\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eGroup\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eNumber\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eNCOA4\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eLC3BⅡ/Ⅰ\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eFTH1\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eP62\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eEctopic Endometrium (EMS)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e4\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1.05\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e4.17\u0026thinsp;\u0026plusmn;\u0026thinsp;2.11\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.44\u0026thinsp;\u0026plusmn;\u0026thinsp;0.31\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.19\u0026thinsp;\u0026plusmn;\u0026thinsp;0.31\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eHealthy Endometrium\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e4\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.75\u0026thinsp;\u0026plusmn;\u0026thinsp;0.19\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1\u0026thinsp;\u0026plusmn;\u0026thinsp;0.26\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.86\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.75\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eEutopic Endometrium (EMS)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e4\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.2\u0026thinsp;\u0026plusmn;\u0026thinsp;0.18\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.36\u0026thinsp;\u0026plusmn;\u0026thinsp;0.33\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1.13\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1.02\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003ctfoot\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"6\"\u003eNote: Data are presented to two decimal places. Compared to healthy endometrium, \u003cem\u003e***P\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001, \u003cem\u003e**P\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01, \u003cem\u003e*P\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tfoot\u003e\n\u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003cstrong\u003e3.8 mRNA Expression Variations of NCOA4, LC3B, FTH1, and P62 in Eutopic and Ectopic Endometrium of EMS Rats\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFurther analysis of mRNA expression for iron autophagy-related proteins NCOA4, LC3B, FTH1, and P62 was conducted in eutopic and ectopic endometrial tissues of EMS rats. Compared to healthy rat endometrium, ectopic endometrial tissues of EMS rats displayed an upward trend in NCOA4 mRNA expression, significant upregulation of LC3B mRNA \u003cem\u003e(P\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), and a downward trend in FTH1 and P62 mRNA. Conversely, eutopic endometrial tissues showed significant downregulation in NCOA4 mRNA (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001), a downward trend in LC3B mRNA, and upregulation in FTH1 and P62 mRNA (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 or 0.00001), as detailed in Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e.\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003ctable id=\"Tab4\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003eComparative mRNA Expression Levels of NCOA4, LC3B, FTH1, and P62 in Healthy, Eutopic, and Ectopic Endometrial Tissues of Rats (x\u0026macr;\u0026plusmn;s)\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eGroup\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eNumber\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eNCOA4 mRNA\u003c/p\u003e\n\u003cp\u003eRelative Expression levels\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eLC3B mRNA\u003c/p\u003e\n\u003cp\u003eRelative Expression levels\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eFTH1 mRNA\u003c/p\u003e\n\u003cp\u003eRelative Expression levels\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eP62 mRNA\u003c/p\u003e\n\u003cp\u003eRelative Expression levels\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eHealthy Endometrium\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e3\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.94\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.41\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1.04\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.09\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eHealthy Endometrium\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e3\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.28\u0026thinsp;\u0026plusmn;\u0026thinsp;0.08\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.28\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2.05\u0026thinsp;\u0026plusmn;\u0026thinsp;0.44\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003csup\u003e*****\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eEctopic Endometrium\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e3\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1.09\u0026thinsp;\u0026plusmn;\u0026thinsp;0.55\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1.01\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1.05\u0026thinsp;\u0026plusmn;\u0026thinsp;0.4\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.03\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003ctfoot\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"6\"\u003eNote: Data are presented with two decimal places. Compared to healthy endometrium, \u003cem\u003e*P\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, \u003cem\u003e**P\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01, \u003cem\u003e***P\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001, \u003cem\u003e*****P\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.00001.\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tfoot\u003e\n\u003c/table\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\n\u003ch2\u003e3.9 Alterations in NCOA4 and LC3B Colocalization in Immunofluorescence Studies of EMS Rat Endometrium\u003c/h2\u003e\n\u003cp\u003eTo further substantiate the activation status of the iron autophagy pathway in eutopic as well as ectopic endometrial tissues of EMS rats, we performed immunofluorescence colocalization analyses of NCOA4 and LC3B. Comparisons were drawn against healthy rat endometrial tissues. The results indicated a marked increase in the colocalization of NCOA4 and LC3B in ectopic endometrial tissues of EMS rats relative to the healthy rat endometrium. In contrast, eutopic endometrial tissues of EMS rats exhibited a significant reduction in the colocalization of these proteins. This finding indicates a suppressed iron autophagy signaling pathway in the eutopic endometrium, coupled with increased activation in the ectopic endometrium of EMS rats., as depicted in Fig.\u0026nbsp;7.\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003c/div\u003e"},{"header":"4 Discussion","content":"\u003cp\u003eIron, an indispensable trace element in the human body, is essential for maintaining normal physiological functions. Iron autophagy, a cellular process for iron ion metabolism, involves NCOA4 as its specific receptor. In iron-deficient conditions, NCOA4 forms a complex with ferritin and merges with autophagosomes, leading to lysosomal degradation of ferritin and subsequent release of free iron for reuse by the body \u003csup\u003e[18]\u003c/sup\u003e. Our study, utilizing the GEO database, revealed contrasting trends in the expression of NCOA4 in eutopic and ectopic endometrial tissues of EMS patients compared to healthy eutopic endometrium. In ectopic endometrium of EMS, NCOA4 was overexpressed, while it showed opposite trends in training and validation sets for eutopic endometrium. ROC curve analysis indicated potential diagnostic value of NCOA4 for EMS. In vitro studies suggest that NCOA4 deficiency makes cells more prone to stress injury and aging \u003csup\u003e[19]\u003c/sup\u003e. Overexpression of NCOA4 has been linked to various pathologies, such as its elevation in mouse neurons being associated with ischemic stroke \u003csup\u003e[20]\u003c/sup\u003e, and its high expression in cardiomyocytes correlating with myocardial damage \u003csup\u003e[21]\u003c/sup\u003e. Our animal study findings indicated that compared to healthy rats, EMS rat models showed reduced free iron content in eutopic endometrium and increased in ectopic endometrium, suggesting a local iron metabolism disorder in EMS rats. Yanmeng Li et al. found that intracellular free iron is a key regulator of ferritin expression and iron metabolism \u003csup\u003e[22]\u003c/sup\u003e. Low free iron levels are detrimental to cell survival, growth, proliferation, and embryonic development. Studies in periodontitis revealed that excess iron ions can produce a large amount of reactive oxygen species (ROS) via the Fenton reaction, leading to oxidative stress and tissue inflammation and destruction \u003csup\u003e[23\u0026ndash;25]\u003c/sup\u003e. To further confirm the mechanisms leading to abnormal iron metabolism in EMS rats, we investigated the expression differences of the NCOA4-mediated iron autophagy pathway. The results indicated abnormalities in the iron autophagy pathway in both eutopic as well as ectopic endometrium of EMS rats, including inhibited autophagy in eutopic and abnormally activated in ectopic endometrium. Therefore, we speculate that local iron metabolism disorders in EMS rats may arise from abnormalities in the iron autophagy pathway within the microenvironment.\u003c/p\u003e \u003cp\u003eImmune factors play a crucial role in the onset and progression of EMS. Agostinis et al. proposed that the development of endometriosis might depend on the complex interplay of genetics, immunity, inflammation, and environmental factors \u003csup\u003e[26]\u003c/sup\u003e. The presence of EMS pathology may be associated with immune imbalance \u003csup\u003e[27]\u003c/sup\u003e, with various immune surveillance and evasion mechanisms potentially modulating the immune response in EMS \u003csup\u003e[28]\u003c/sup\u003e. Our analysis revealed changes in immune cell infiltration in eutopic and ectopic endometrium of EMS patients compared to controls. Modern studies confirm that in the lesion microenvironment of ectopic endometrial tissues, the function of almost all types of immune cells (e.g., peritoneal macrophages, lymphocytes, natural killer cells) and the levels of various inflammatory mediators and growth factors in the peritoneal fluid are altered \u003csup\u003e[29]\u003c/sup\u003e, aligning with our results. Studies have shown that T cell subgroups Th17,regulatory T cells promote EMS progression by secreting various cytokines that regulate other immune cells, promote ectopic implantation and endometrial cell proliferation, and increase angiogenesis \u003csup\u003e[30,31]\u003c/sup\u003e. Increased numbers and activity of B lymphocytes may play an important role in endometriosis pathogenesis by regulating immune cell activity and producing a large number of anti-endometrial antibodies \u003csup\u003e[32]\u003c/sup\u003e. Xu H et al. found that reduced toxicity of NK cells facilitates survival of endometrial cells in the abdominal cavity, leading to further development of EMS \u003csup\u003e[33]\u003c/sup\u003e. McLaren J et al. discovered that macrophages are a significant source of vascular endothelial growth factor (VEGF), which can accelerate EMS progression by promoting vascular growth in EMS lesions \u003csup\u003e[34]\u003c/sup\u003e. Furthermore, our results show that key iron autophagy genes NCOA4, FTH1, P62, LCB are closely related to various immune cells and immune checkpoint genes in both eutopic and ectopic endometrial tissues of EMS patients, with eutopic endometrial tissues mainly correlating strongly with T lymphocytes and NK cells, and ectopic endometrial tissues mainly with B lymphocytes, T lymphocytes, macrophages. Sottile R et al. found that NCOA4 deficiency impairs IFN-γ receptor signaling, a major effector in activating T cells induced iron death in immunotherapy \u003csup\u003e[35]\u003c/sup\u003e. In chronic obstructive pulmonary disease, NCOA4 promotes macrophage polarization to the M2 type by targeting iron death \u003csup\u003e[36]\u003c/sup\u003e. FTH1 is known to interact with several transcription factors regulating the immune system, such as NF-κB \u003csup\u003e[37]\u003c/sup\u003e and AP-1 \u003csup\u003e[38]\u003c/sup\u003e, and can regulate the immune system through downstream signaling of these transcription factors. Studies have found that accumulation of FTH1, especially cFTH1, may enhance the inflammatory microenvironment of triple-negative breast cancer cells, leading to activation of CD8\u0026thinsp;+\u0026thinsp;cytotoxic T cells, NK cell activation, and inhibition of angiogenesis \u003csup\u003e[39]\u003c/sup\u003e. Immune checkpoint analysis showed that compared to the control group, multiple immune checkpoint genes in both eutopic and ectopic endometrial tissues of EMS patients exhibit abnormal expression related to key iron autophagy genes NCOA4, FTH1, LC3B, P62. These results indicate that in endometriosis, key iron autophagy genes may have a potential regulatory relationship with immune cells, and iron autophagy may play an important role in the immune imbalance of EMS. In the future, restoring the iron homeostasis of the local or microenvironment in eutopic and ectopic endometrial tissues of EMS patients may be an important measure to improve the immune imbalance in EMS and block its progression.\u003c/p\u003e"},{"header":"5 Conclusions","content":"\u003cp\u003eIn summary\", while the exact causes of EMS are still not fully understood, disorders in iron metabolism might offer fresh perspectives on the mechanisms underlying the development of EMS. Our study suggests that targeting the NCOA4-mediated iron autophagy pathway to restore the local or microenvironmental iron homeostasis in EMS patients may be a new approach to treat EMS. However, two different trends of up-regulation and down-regulation of NCOA4 in EMS in situ endosomes were observed, and it was hypothesized that NCOA4 might contribute to the development of EMS from different perspectives; in the present study, we only verified the down-regulation trend, and more experiments are still needed to validate the key roles that these two trends might play in the development of EMS.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eEMS\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eendometriosis\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eAUROC\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eArea Under the Receiver Operating Characteristic Curve\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eNCOA4\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eNuclear Receptor Coactivator 4\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eFTH1\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eHeavy Chain of Ferritin\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eP62/ SQSTM1\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eSequestosome\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eLC3B/ MAP1LC3B\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eMicrotubule-Associated Proteins 1A/1B Light Chain 3 Beta\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eP-NF-κB\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ephosphorylated Nuclear Factor kappa-light-chain-enhancer of activated B cells\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eEthics approval and consent to participate\u003c/h2\u003e \u003cp\u003e All experimental protocols were reviewed and approved by the Animal Ethics Committee of Shandong University of Traditional Chinese Medicine (Approval Number: AWE2022053) and carried out in strict accordance with the ARRIVE guidelines.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eConflict of Interest\u003c/strong\u003e \u003cp\u003eApart from the support of the funding project, all authors of this article have not received any third-party support or services and have no personal or corporate financial interests.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eConsent for publication\u003c/strong\u003e \u003cp\u003eNot applicable.\u003c/p\u003e \u003c/p\u003e\u003cp\u003e \u003ch2\u003eCompeting interests\u003c/h2\u003e \u003cp\u003eAll authors declare no conflicts of interest.\u003c/p\u003e \u003c/p\u003e\u003cp\u003e \u003ch2\u003eAuthor details\u003c/h2\u003e \u003cp\u003e1 Shandong University of Traditional Chinese Medicine, Jinan, China.2 Affiliated Hospital of Shandong University of Traditional Chinese Medicine, Jinan, China.3 Harvard university.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis study was funded by the National Natural Science Foundation of China (81974577, 82174429).\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eYML: Experimental design, conception, writing of the paperand ,and Paper revision; FL, YWZ: Experimental design and paper supervision. All authors have no objections to the published manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eWe are grateful to Experimental Center, Shandong University of Traditional Chinese Medicine, Jinan250355, PR China and the Sangerbox platform (http://sangerbox.com/) for their technical support.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eThe datasets used and/or analysed during the current study available from the corresponding author on reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003e Tsamantioti ES, Mahdy H. Endometriosis. 2023 Jan 23. In: StatPearls [Internet]. Treasure Island (FL): StatPearls Publishing; 2023 Jan\u0026ndash;. PMID: 33620854.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Saunders PTK, Horne AW. Endometriosis: Etiology, pathobiology, and therapeutic prospects. Cell. 2021 May 27;184(11):2807\u0026ndash;2824. doi: 10.1016/j.cell.2021.04.041. PMID: 34048704.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Vercellini P, Vigan\u0026ograve; P, Somigliana E, et al. Endometriosis: pathogenesis and treatment. Nat Rev Endocrinol. 2014 May;10(5):261\u0026thinsp;\u0026minus;\u0026thinsp;75. doi: 10.1038/nrendo.2013.255. Epub 2013 Dec 24. PMID: 24366116.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Ahn SH, Singh V, Tayade C. Biomarkers in endometriosis: challenges and opportunities. Fertil Steril. 2017 Mar;107(3):523\u0026ndash;532. doi: 10.1016/j.fertnstert.2017.01.009. Epub 2017 Feb 8. PMID: 28189296.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Surrey ES, Soliman AM, Yang H, Du EX, Su B. Treatment Patterns, Complications, and Health Care Utilization Among Endometriosis Patients Undergoing a Laparoscopy or a Hysterectomy: A Retrospective Claims Analysis. Adv Ther. 2017 Nov;34(11):2436\u0026ndash;2451. doi: 10.1007/s12325-017-0619-3. Epub 2017 Oct 16. PMID: 29039055; PMCID: PMC5702365.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Burghaus S, Sch\u0026auml;fer SD, Beckmann MW, et al. Diagnosis and Treatment of Endometriosis. Guideline of the DGGG, SGGG and OEGGG (S2k Level, AWMF Registry Number 015/045, August 2020). Geburtshilfe Frauenheilkd. 2021 Apr;81(4):422\u0026ndash;446. doi: 10.1055/a-1380-3693. Epub 2021 Apr 14. PMID: 33867562; PMCID: PMC8046516.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Gu X,Lai D,Liu S,et al.Hub genes,diagnostic model,and predicted drugs related to iron metabolism in Alzheimer's disease[J].Front Aging Neurosci,2022,14:949083. doi:10.3389/fnagi.2022.949083.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e El Husseiny NM, Mehaney DA, El Kader Morad MA. New insights on iron study in myelodysplasia. Turk J Haematol. 2014 Dec 5;31(4):394-8. doi: 10.4274/tjh.2012.0154. PMID: 25541657; PMCID: PMC4454055.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Stein J, Hartmann F, Dignass AU. Diagnosis and management of iron deficiency anemia in patients with IBD. Nat Rev Gastroenterol Hepatol. 2010 Nov;7(11):599\u0026ndash;610. doi: 10.1038/nrgastro.2010.151. Epub 2010 Oct 5. PMID: 20924367.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Yoshimoto C, Iwabuchi T, Shigetomi H, et al. Cyst fluid iron-related compounds as useful markers to distinguish malignant transformation from benign endometriotic cysts. Cancer Biomark. 2015;15(4):493-9. doi: 10.3233/CBM-150484. PMID: 25835178.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Vallv\u0026eacute;-Juanico J, Houshdaran S, Giudice LC. The endometrial immune environment of women with endometriosis. Hum Reprod Update. 2019 Sep 11;25(5):564\u0026ndash;591. doi: 10.1093/humupd/dmz018. PMID: 31424502; PMCID: PMC6737540.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Newman AM, Steen CB, Liu CL, et al. Determining cell type abundance and expression from bulk tissues with digital cytometry. Nat Biotechnol. 2019 Jul;37(7):773\u0026ndash;782. doi: 10.1038/s41587-019-0114-2. Epub 2019 May 6. PMID: 31061481; PMCID: PMC6610714.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Zheng P, Mei J, Leng J, et al. Evaluation of the brain functional activities in rats various location-endometriosis pain model. Ann Transl Med. 2019 Dec;7(23):767. doi: 10.21037/atm.2019.11.73. PMID: 32042783; PMCID: PMC6990036.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Li L, Sun R, Miao Y, et al. PD-1/PD-L1 expression and interaction by automated quantitative immunofluorescent analysis show adverse prognostic impact in patients with diffuse large B-cell lymphoma having T-cell infiltration: a study from the International DLBCL Consortium Program. Mod Pathol. 2019;32(6):741\u0026ndash;754.IF:7.842.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Jiao X, Fei X, Li S, Lin D, Ma H, Zhang B. Design Mechanism and Property of the Novel Fluorescent Probes for the Identification of Microthrix Parvicella In Situ. Materials (Basel). 2017;10(7):804. Published 2017 Jul 15.IF:3.623.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Grimm A, Cummins N, G\u0026ouml;tz J. Local Oxidative Damage in the Soma and Dendrites Quarantines Neuronal Mitochondria at the Site of Insult. iScience. 2018;6:114\u0026ndash;127.IF:5.458.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Zongfei J, Rongyi C, Xiaomeng C, et al. In vitro IL-6/IL-6R Trans-Signaling in Fibroblasts Releases Cytokines That May Be Linked to the Pathogenesis of IgG4-Related Disease. Front Immunol. 2020;11:1272. Published 2020 Jul 8.IF:7.561.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Mancias JD, Wang X, Gygi SP, et al. Quantitative proteomics identifies NCOA4 as the cargo receptor mediating ferritinophagy. Nature. 2014 May 1;509(7498):105-9. doi: 10.1038/nature13148. Epub 2014 Mar 30. PMID: 24695223; PMCID: PMC4180099.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Bellelli R, Castellone MD, Guida T,et al. NCOA4 transcriptional coactivator inhibits activation of DNA replication origins. Mol Cell. 2014 Jul 3;55(1):123\u0026thinsp;\u0026minus;\u0026thinsp;37. doi: 10.1016/j.molcel.2014.04.031. Epub 2014 Jun 5. PMID: 24910095.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e LI C, SUN G, CHEN B, et al. Nuclear receptor coactivator 4-mediated ferritinophagy contributes to cerebral ischemia-induced ferroptosis in ischemic stroke. Pharmacol Res. 2021 Dec; 174:105933. doi: 10.1016/j.phrs.2021.105933. Epub 2021 Oct 8. PMID: 34634471.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e LI N, WANG W, ZHOU H, et al. Ferritinophagy-mediated ferroptosis is involved in sepsis-induced cardiac injury. Free Radic Biol Med. 2020 Nov 20; 160:303\u0026ndash;318. doi: 10.1016/j.freeradbiomed.2020.08.009. Epub 2020 Aug 23. PMID: 32846217.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Li Y, Ouyang Q, Chen Z, et al. Intracellular labile iron is a key regulator of hepcidin expression and iron metabolism. Hepatol Int. 2023 Jun;17(3):636\u0026ndash;647. doi: 10.1007/s12072-022-10452-2. Epub 2022 Dec 13. PMID: 36512269.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Żukowski P, Maciejczyk M, Waszkiel D. Sources of free radicals and oxidative stress in the oral cavity. Arch Oral Biol. 2018 Aug;92:8\u0026ndash;17. doi: 10.1016/j.archoralbio.2018.04.018. Epub 2018 May 1. PMID: 29729478.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Guo W, Zhao Y, Li H, et al. NCOA4-mediated ferritinophagy promoted inflammatory responses in periodontitis. J Periodontal Res. 2021 Jun;56(3):523\u0026ndash;534. doi: 10.1111/jre.12852. Epub 2021 Feb 3. PMID: 33533512.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Liu C,Mo L,Niu Y, et al. The Role of Reactive Oxygen Species and Autophagy in Periodontitis and Their Potential Linkage. Front Physiol. 2017 Jun 23;8:439. doi: 10.3389/fphys.2017.00439. PMID: 28690552; PMCID: PMC5481360.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Agostinis C, Balduit A, Mangogna A, et al. Immunological Basis of the Endometriosis: The Complement System as a Potential Therapeutic Target. Front Immunol. 2021 Jan 11; 11:599117. doi: 10.3389/fimmu.2020.599117. PMID: 33505394; PMCID: PMC7829336.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Agostinis C, Balduit A, Mangogna A, et al. Immunological Basis of the Endometriosis: The Complement System as a Potential Therapeutic Target. Front Immunol. 2021 Jan 11; 11:599117. doi: 10.3389/fimmu.2020.599117. PMID: 33505394; PMCID: PMC7829336.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Wang Y, Nicholes K, Shih IM. The Origin and Pathogenesis of Endometriosis. Annu Rev Pathol. 2020 Jan 24; 15:71\u0026ndash;95. doi: 10.1146/annurev-pathmechdis-012419-032654. Epub 2019 Sep 3. PMID: 31479615; PMCID: PMC7980953.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Hogg C, Horne AW, Greaves E. Endometriosis-Associated Macrophages: Origin, Phenotype, and Function. Front Endocrinol (Lausanne). 2020 Jan 23; 11:7. doi: 10.3389/fendo.2020.00007. PMID: 32038499; PMCID: PMC6989423.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Khan K.N., Yamamoto K., Fujishita A., Muto H., Koshiba A., Kuroboshi H., Saito S., Teramukai S., Nakashima M., Kitawaki J. Differential Levels of Regulatory T Cells and T-Helper-17 Cells in Women with Early and Advanced Endometriosis. J. Clin. Endocrinol. Metab. 2019; 104:4715\u0026ndash;4729. doi: 10.1210/jc.2019-00350.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Hirata T, Osuga Y, Hamasaki K, et al. Interleukin (IL)-17A stimulates IL-8 secretion, cyclooxygensase-2 expression, and cell proliferation of endometriotic stromal cells. Endocrinology. 2008 Mar;149(3):1260-7. doi: 10.1210/en.2007-0749. Epub 2007 Dec 13. PMID: 18079209.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Riccio L.G.C., Baracat E.C., Chapron C., Batteux F., Abr\u0026atilde;o M.S. The role of the B lymphocytes in endometriosis: A systematic review. J. Reprod. Immunol. 2017; 123:29\u0026ndash;34. doi: 10.1016/j.jri.2017.09.001.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Xu H. Expressions of natural cytotoxicity receptor, NKG2D and NKG2D ligands in endometriosis. J Reprod Immunol. 2019 Nov; 136:102615. doi: 10.1016/j.jri.2019.102615. Epub 2019 Sep 28. PMID: 31655348.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e McLaren J, Prentice A, Charnock-Jones DS, et al. Vascular endothelial growth factor is produced by peritoneal fluid macrophages in endometriosis and is regulated by ovarian steroids. J Clin Invest. 1996 Jul 15;98(2):482-9. doi: 10.1172/JCI118815. PMID: 8755660; PMCID: PMC507453.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Sottile R, Federico G, Garofalo C, et al. Iron and ferritin modulate MHC class I expression and NK cell recognition. Front Immunol. 2019; 10:224. doi: 10.3389/fimmu.2019.00224.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Liu J, Zhang Z, Yang Y, Di T, et al. NCOA4-Mediated Ferroptosis in Bronchial Epithelial Cells Promotes Macrophage M2 Polarization in COPD Emphysema. Int J Chron Obstruct Pulmon Dis. 2022 Mar 30; 17:667\u0026ndash;681. doi: 10.2147/COPD.S354896. PMID: 35386390; PMCID: PMC8978690.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Lin M, Rippe RA, Niemel\u0026auml; O, et al. Role of iron in NF-kappa B activation and cytokine gene expression by rat hepatic macrophages. Am J Physiol. 1997 Jun;272(6 Pt 1): G1355-64. doi: 10.1152/ajpgi.1997.272.6. G1355. PMID: 9227470.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Kaomongkolgit R, Cheepsunthorn P, Pavasant P, et al. Iron increases MMP-9 expression through activation of AP-1 via ERK/Akt pathway in human head and neck squamous carcinoma cells. Oral Oncol. 2008 Jun;44(6):587\u0026thinsp;\u0026minus;\u0026thinsp;94. doi: 10.1016/j.oraloncology.2007.08.005. Epub 2007 Oct 23. PMID: 17936676.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Liu NQ, De Marchi T, Timmermans AM, et al. Ferritin heavy chain in triple negative breast cancer: a favorable prognostic marker that relates to a cluster of differentiation 8 positive (CD8+) effector T-cell response. Mol Cell Proteomics. 2014 Jul;13(7):1814-27. doi: 10.1074/mcp.M113.037176. Epub 2014 Apr 17. PMID: 24742827; PMCID: PMC4083117.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Endometriosis, Iron Autophagy, NCOA4, Immune Response, Eutopic Endometrium, Ectopic Endometrium, Rat Model","lastPublishedDoi":"10.21203/rs.3.rs-4016800/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4016800/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eObjective\u003c/h2\u003e \u003cp\u003eThis study aims to investigate the expression disparities of Nuclear Receptor Coactivator 4 (NCOA4) in endometriosis (EMS) patients, assessing its diagnostic potential. It also elucidate the correlation between the immune microenvironment in EMS patients and pivotal genes in iron autophagy,and seeks to corroborate the activation status of the NCOA4-mediated iron autophagy pathway in both ectopic and eutopic endometrial tissues in EMS,\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003e\"Data sets from microarrays pertaining to EMS patients were obtained from the GEO database. This was done to analyze the differential expression of NCOA4 in both ectopic and eutopic endometrial tissues, in comparison to normal endometrial tissues. The diagnostic efficacy of key iron autophagy genes in identifying EMS was projected using Area Under the Receiver Operating Characteristic Curve (AUROC). This study also further examined the differential immune landscape between ectopic and eutopic endometrial tissues of EMS patients and controls. Additionally, it analyzed the interplay between immune cells, immune checkpoint genes, and key iron autophagy genes in EMS patients. A rat model of EMS was employed to validate the expression patterns of the NCOA4-mediated iron autophagy pathway in ectopic and eutopic endometrium.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eNCOA4 was differentially expressed in endothelial tissues of EMS patients, including two diametrically opposed trends of up-regulation and down-regulation in the in situ endothelial tissues of EMS patients and up-regulation in the ectopic endothelial tissues; Immune infiltration analysis showed that a variety of immune cells and immune checkpoint genes were abnormal in the endothelial tissues of EMS patients, and most of the abnormal immune cells and immune checkpoint genes were strongly correlated with the key genes of iron autophagy, NCOA4, FTH1, LC3B, and P62; Animal results showed that iron autophagy signaling pathway activation was progressively enhanced from the in situ endometrium to the normal endometrium to the ectopic endometrium.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eRestoring the normal function of the NCOA4-mediated iron autophagy signaling pathway by regulating it can block the development of EMS, and its mechanism may be related to improving the local microenvironmental immune imbalance in EMS endothelial tissues.\u003c/p\u003e","manuscriptTitle":"Immunological Dysregulation in Endometriosis Potentially Linked to Anomalies in NCOA4-Mediated Iron Autophagy Pathway","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-04-08 17:24:22","doi":"10.21203/rs.3.rs-4016800/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"659868b9-d7df-480e-a6cf-bd757c90c5ca","owner":[],"postedDate":"April 8th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":30368498,"name":"Biological sciences/Cell biology"},{"id":30368499,"name":"Biological sciences/Immunology"},{"id":30368500,"name":"Health sciences/Pathogenesis"}],"tags":[],"updatedAt":"2024-09-18T08:48:51+00:00","versionOfRecord":[],"versionCreatedAt":"2024-04-08 17:24:22","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4016800","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4016800","identity":"rs-4016800","version":["v1"]},"buildId":"0U-iFTyB6qxOgVj8rjrZV","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}