MiR-30c-5p Directly Targets MAPK1 to Regulate the Proliferation, Migration and Invasion of Adenomyotic Epithelial Cells in Adenomyosis

article OA: bronze CC0 ⤵ 2 in-corpus citations
AI-generated summary by gemini-2.5-flash-lite, 2026-06-07

MiR-30c-5p is downregulated in adenomyosis and directly targets MAPK1 to inhibit the proliferation, migration, and invasion of adenomyotic epithelial cells.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

AI-generated deep summary by claude@2026-06, 2026-06-07 · read from full text

This study examined miR-30c-5p expression in ectopic and eutopic endometrial tissues from 23 adenomyosis patients undergoing hysterectomy, and evaluated its effects on adenomyotic epithelial cells using gain- and loss-of-function assays. The authors found miR-30c-5p was down-regulated in adenomyosis tissues and adenomyotic epithelial cells, correlating with dysmenorrhea, longer symptom duration, and greater menstrual bleeding, and that miR-30c-5p overexpression inhibited proliferation, migration, and invasion in vitro while knockdown had opposite effects. Using luciferase reporter assays plus qRT-PCR and Western blot, they confirmed MAPK1 as a direct target mediating these changes, but the work relied on a relatively small clinical sample and in vitro functional assays without in vivo validation. This paper is centrally about endometriosis/adenomyosis—specifically adenomyosis, focusing on how miR-30c-5p regulates adenomyotic epithelial proliferation, migration, and invasion via direct targeting of MAPK1.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

The purpose of our study was to elucidate the functions of miR-30c-5p on adenomyosis for exploring novel treatment strategies. We first detected the expression of miR-30c-5p in clinical adenomyotic tissues and isolated endometrial cells from adenomyotic tissues. Next, gain and loss-of-function assays were performed to detect the effect of miR-30c-5p on adenomyotic endometrial cells. Further, luciferase assay and real-time polymerase chain reaction as well as western blot were conducted to investigate the potential target of miR-30c-5p; and transwell assay, wound-healing assay and CCK-8 assay were used to evaluate the effects of miR-30c-5p and its target on regulating biological functions of adenomyotic endometrial cells. Our results found that miR-30c-5p was down-regulated in both adenomyosis tissues and adenomyotic epithelial cells, which correlated with dysmenorrhea, longer duration of symptoms and more menstrual bleeding. Moreover, the overexpression of miR-30c-5p inhibited the proliferation, migration and invasion of adenomyotic epithelial cells, where miR-30c-5p knockdown had an opposite effect. Furthermore, we confirmed mitogen-activated protein kinase 1 (MAPK1) was one of the direct targets of miR-30c-5p, indicating its important role in miR-30c-5p-mediated suppression of proliferation, invasion and migration in adenomyotic epithelial cells. This study showed that the interaction of miR-30c-5p with MAPK1 can regulate the proliferation, invasion and migration in adenomyotic epithelial cells.
Full text 33,857 characters · extracted from oa-pdf · 8 sections · click to expand

Abstract

The purpose of our study was to elucidate the functions of miR-30c-5p on adenomyosis for exploring novel treatment strategies. We first detected the expression of miR-30c-5p in clinical adenomyotic tissues and isolated endometrial cells from adenomyotic tissues. Next, gain and loss-of- function assays were performed to detect the effect of miR-30c-5p on adenomyotic endometrial cells. Further, luciferase assay and real-time polymerase chain reaction as well as western blot were conducted to investigate the potential target of miR-30c-5p; and transwell assay, wound-healing assay and CCK-8 assay were used to evaluate the effects of miR-30c-5p and its target on regulating biological functions of adenomyotic endometrial cells. Our results found that miR-30c-5p was down-regulated in both adenomyosis tissues and adenomyotic epithelial cells, which correlated with dysmenorrhea, longer duration of symptoms and more menstrual bleeding. Moreover, the overexpression of miR-30c-5p inhibited the proliferation, migration and invasion of adenomyotic epithelial cells, where miR-30c-5p knockdown had an opposite effect. Furthermore, we confirmed mitogen-activated protein kinase 1 (MAPK1) was one of the direct targets of miR-30c-5p, indicating its impor- tant role in miR-30c-5p-mediated suppression of proliferation, invasion and migration in adenomyotic epithelial cells. This study showed that the interaction of miR-30c-5p with MAPK1 can regulate the proliferation, invasion and migration in adenomyotic epithelial cells.

Keywords

Adenomyosis; miR-30c-5p; MAPK1; adenomyotic epithelial cells (Received 20 November 2020; accepted 13 January 2021; First Published online 29 March 2021) Adenomyosis is regarded as one of most common gynecological disorders, which has a morbidity of 8 –27% in women with repro- ductive age (Huang et al., 2015; Leyendecker et al., 2009). The pathological change of adenomyosis is characterized by ectopic endometrial glands and stroma invasion into myometrium of uterus, which can also be either diffuse or focal lesion (Bird et al., 1972). When the lesion in the myometrium exhibits limited nodules, the condition is then known as adenomyoma (Levy et al., 2013). The patients with adenomyoma usually suffer from dys- menorrhea, subfertility, chroni cp e l v i cp a i na n dm e n o r r h a g i a , leading to physical pain and qual ity of life reduction (Arnold et al., 1995;J u a n ge ta l . ,2007). Recent researches identified that estrogen could enhance the invasive and migratory ability of endometrial epithelial cells, which further results in the endo- metrium infiltrating the myometrial zone (Y.-J. Chen et al., 2010; Senturk & Imamoglu, 2015). Therefore, hormone therapy has become the mainstream treatment for adenomyosis, but it c a no n l yp a r t l yc o n t r o lt h es y m p t o m so ft h i sd i s e a s e ,s u c ha sd y s - menorrhea, and hysterectomy for severe adenomyosis is often required (Y.-J. Chen et al., 2010; Senturk & Imamoglu, 2015). Thus, a detailed molecular mechanism of the above pathological process is urgently needed to pro vide novel and potential thera- peutic strategies for adenomyosis. MicroRNAs (miRNAs) are defined as noncoding RNAs and consist of 22−25 nucleotides that function as a posttranscriptional controller of their target genes via binding the 3 ’-untranslated regions (3 0-UTRs; Simonson & Das, 2015). Accumulating evi- dence confirms that multiple miRNAs are involved in the occur- rence and development in adenomyosis; for instance, Hu et al. (2017) indicated that miR-17 was significantly up-regulated in endometrial tissues of patients with adenomyosis, which further influenced proliferation and apoptosis of adenomyotic endo- metrial cell by directly targeting phosphatase and tensin homolog (PTEN); T.-X. Xu et al. ( 2016) found that miR-210 could contrib- ute to pathological progression of endometriosis by targeting Bcl2/ Beclin-1 axis. The function of miR-30c has been extensively reported in numerous pathological processes such as lipid metabo- lism, cardiac remodeling, adipogenesis and progression of cancers (Irani & Hussain, 2015). At present, the latest research using microarray screen assay claims that miR-30c expression descends into ectopic endometrial lesions tissue instead of normal endo- metrium tissue, suggesting that miR-30c might be partly involved in pathologic change in adenomyosis (Guo et al., 2015). However, no relevant studies have focused on the exact role of miR-30c-5p in adenomyosis until now. Author for correspondence: Airong Zhang, Email: [email protected] Cite this article: Zhang A, Liu X, Wang J, Deng K, and Wang J. (2021) MiR-30c-5p Directly Targets MAPK1 to Regulate the Proliferation, Migration and Invasion of Adenomyotic Epithelial Cells in Adenomyosis. Twin Research and Human Genetics 24: 22–28, https://doi.org/10.1017/thg.2021.11 © The Author(s) 2021. Twin Research and Human Genetics (2021), 24,2 2 –28 doi:10.1017/thg.2021.11 https://doi.org/10.1017/thg.2021.11 Published online by Cambridge University Press Therefore, the aim of this study is to clarify the role of miR-30c- 5p in adenomyotic progression and further investigate the poten- tial downstream target of miR-30c-5p. Moreover, we intend to explore the interaction between miR-30c-5p and its target in regu- lating biological function of adenomyotic epithelial cells, providing a potential therapeutic method for adenomyosis.

Materials and methods

Patient Samples A total number of 23 patients (age range 29 −45 years old) with adenomyosis who underwent hysterectomy at our hospital from April 2016 to September 2018 were enrolled in this study. Ectopic and eutopic endometrial tissues from adenomyotic patients were collected. Meanwhile, endometrial tissues obtained from 20 patients who underwent a hysterectomy (age range 34−48 years old) with benign gynecological diseases, such as ute- rine prolapse and subserousal leiomyoma, were regarded as nor- mal controls. After surgery, the endometrial tissues were immediately collected and frozen in liquid nitrogen for further analysis. Before the hysterectomy, the clinicopathologic parame- ters of adenomyotic patients were recorded with a standard questionnaire using a visual analogue scale (VAS) and pictorial blood-loss assessment chart (PBAC). The Ethics Committee of our hospital reviewed and approved all protocols of this study, and all participants provided written informed consent. Cell Culture As previously described, ectopic and eutopic endometrial tissues and normal endometrium epithelial tissues were separated first (Zhang et al., 1995). Next, the isolated adenomyotic endometrial cells were cultured in DMEM (BD Biosciences, USA) supple- mented with 10% fetal bovine serum (FBS, Gibco, USA) in a humidified incubator with 5% CO 2 at 37° C. The HEK 293T cells were purchased from the Institute of Biochemistry and Cell Biology of the Chinese Academy of Sciences (Shanghai, China) and cultured in the same condition. Cell Transfection miR-30c-5p mimics, miR-30c-5p inhibitor, pcDNA3.1-MAPK1 and a corresponding negative control (NC) were obtained from GenePharma (Shanghai, China). After cell growth reached approx- imately 60 −80% confluence, the adenomyotic endometrial cells were then transfected with the above reagents using Lipofectamine 2000 (Thermo Fisher Scientific, USA) following the manufacturer’s instruction. After 48 h of transfection, the cells were collected for further analysis. Cell Proliferation Assay The CCK-8 assay and colony formation assay were used to detect cell proliferation rate. For CCK-8 assay, the transfected cells (1 × 10 3/per well) were seeded in 96-well plates and cultured for up to 72 h. Then, cell viability was proven using CCK-8 (Beyotime Biotechnology, China) at different time points (0, 24, 48 and 72 h) under a Multi-Detection Microplate Reader (Bio-Rad, USA). Cell Migration Assay Wound-healing assays were performed to assess cell migration. In brief, 5 × 10 4 cells were seeded in 6-well plates coated with fibronectin and cultured for 24 h until there was approximately 80% confluence. The scratches in each well were made by a 200- ul pipette tip, and then the cells were transfected with miR-30c- 5p mimics, miR-30c-5p inhibitor and pcDNA3.1-MAPK1 and controls. The migratory cells were observed in a selected area at 0 and 48 h after initial scratch under a light microscope (Olympus, Japan). Cell Invasion Assay The invasive ability of endometrial epithelial cells was measured as previously described using the Transwell system (Dong et al., 2008). Briefly, the transfected cells were suspended in a serum-free medium at density of 2 × 10 5 cells/ml and then seeded into the upper chamber of the Transwell system, while the complete medium was added into the lower chamber. After incubation for 24 h, the invaded cells were fixed with 10% formaldehyde for 30 min and then stained with 0.5% crystal violet for 10 min and counted for five random fields using a light microscope (Olympus, Japan). Luciferase Reporter Assay Luciferase reporter plasmid containing wild MAPK1-3 0-UTR (MAPK1-WT) or mutant MAPK1-3 0-UTR (MAPK1-MUT) were synthesized by Promega (Madison, USA) and then subcloned into the pmiRGLO vector (Promega, USA). Next, the HEK293 cells were co-tranfected with MAPK1-WT or MAPK1-MUT reporter plasmid together with miR-30c-5p mimics and mimics-NC using Lipofectamine 2000 (Invitrogen, USA). After 48 h of transfection, the luciferase activity was measured by Dual Luciferase Assay System (Promega, USA) according to the manufacturer’s specification. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR) Total RNAs were extracted from clinical tissues and cells using TRIZOL reagent (Thermo Fisher Scientific, USA). After that, cDNA was synthesized from RNAs using TaqMan MicroRNA Reverse Transcription Kit (Thermo Fisher Scientific, USA) accord- ing to the manufacturer ’s specification. Then, quantitative real- time polymerase chain reaction (qRT-PCR) was conducted using SYBR Green PCR Master Mix (BioRad, USA) under a CFX96 Real- Time Thermocycler system (BioRad, USA). U6 was represent as internal controls for miR-30c-5p, whereas GAPDH was repre- sented as an internal control for mitogen-activated protein kinase 1 (MAPK1). The relative expression of each mRNA or miRNA was analyzed using 2 −ΔΔCT method. All primer sequences are listed in Table 1. Western Blot Total proteins were extracted using RIPA lysis buffer (Beyotime, China) and qualified by a BCA detecting kit (Beyotime, China) fol- lowing the manufacturer ’s specifications. Subsequently, the extracted protein was separated on a 10% SDS-PAGE and then transferred onto PVDF membrane (Millipore, USA) blocked with 5% nonfat milk for 2 h at room temperature and incubated over- night with primary antibodies against MAPK1 (1: 1000, Abcam, UK) and GAPDH (1: 5000, Abcam, UK) at 37° C. Finally, the membrane was incubated with HRP-conjugated secondary anti- bodies (1:5000, Abcam, UK) at room temperature for 1 h. The blots were visualized using enhanced chemiluminescence (Bio-Rad, USA) and quantitative calculated using image J (National Institutes of Health, USA). Twin Research and Human Genetics 23 https://doi.org/10.1017/thg.2021.11 Published online by Cambridge University Press Statistical Analysis All experiments were carried out in triplicate. Data are pre- sented as the mean ± standard deviation ( SD), and the error bars represent the SD from three independent experiments. The stat- istical analysis was conducted using SPSS 21.0 (SPSS Inc, USA) or GraphPad Prism 7.1 software (N ational Institutes of Health, USA). Student ’s t test or one-way analysis of variance (ANOVA) was used for comparisons between groups. The correlation between miR-30c-5p and clinical-pathological parameters of adenomyotic patients were measured by Pearson ’sc o r r e l a t i o n methods. Statistical significance was determined as a p value less than .05.

Results

MiR-30c-5p Expression Is Down-Regulated Both in Human Adenomyosis Tissues and Adenomyotic Epithelial Cells To explore whether miR-30c-5p served an essential role in human adenomyosis, we first evaluated the expression of miR-30c-5p in adenomyosis tissues using qRT-PCR. Our results found that miR-30c-5p expression was significantly reduced in eutopic and ectopic tissue of adenomyosis compared with normal tissues (Figure 1A). As shown in Figure 1B, the level of miR-30c-5p was conspicuously down-regulated in isolated adenomyotic epi- thelial cells in comparison with normal endometrial cells, sug- gesting that miR-30c-5p might be involved in pathological process of adenomyosis. The Level of miR-30c-5p is Correlated with the Clinicopathological Parameters of Adenomyotic Patients On account of the above results, we tried to find the correlation between the expression level of miR-30c-5p with the clinicopatho- logical parameters of 23 adenomyotic patients, such as age, clinical symptoms (dysmenorrhea or menometrorrhagia or both), dura- tion of symptoms, VAS score for dysmenorrhea, as well as men- strual bleeding (PBAC score). As shown in Table 1, the lower expression level of miR-30c-5p was tightly correlated with dys- menorrhea ( p = .021), longer duration of symptoms ( p = .000) and more menstrual bleeding ( p = .001); however, the results showed that there was no significant relationship between age or VAS score for dysmenorrhea and miR-30c-5p expression in adenomyotic patients ( p > .05; Table 2). MiR-30c-5p Regulates Proliferation, Invasion and Migration of Adenomyotic Epithelial Cells From previous findings, we were conscious that the expression of miR-30c-5p might act as a pivotal role in development of adeno- myosis; hence, the relevant deep mechanism was further explored in adenomyotic epithelial cells. First, miR-30c-5p mimics and miR-30c-5p inhibitor were transfected into adenomyotic epithelial cells to verify their overexpression or down-expression efficiency. As shown in Figure 2A, miR-30c-5p mimics significantly up-regulated the miR-30c-5p expression, whereas miR-30c-5p inhibitor could knock down miR-30c-5p expression. Then, the proliferation of adenomyotic epithelial cells were measured by CCK-8 assay. Our

Results

found that overexpression of miR-30c-5p could distinctly inhibit the cell viability of adenomyotic epithelial cells, where miR-30c-5p inhibitor showed an enhanced effect on cell viability (Figure 2B and C). Moreover, the transwell invasion assay and wound-healing assay were conducted to assess the invasive and migratory ability of adenomyotic epithelial cells transfected with miR-30c-5p mimics or miR-30c-5p inhibitor. The data revealed that the cell invasion and migration were remarkably suppressed in the miR-30c-5p mimics group, which were dramatically expedited by transfection of miR-30c-5p inhibitor (Figure 2D and E). Taken together, our results identified that miR-30c-5p could regulate the proliferation and invasion, as well as migration of adenomyotic epi- thelial cells, and might play an important role in progression of adenomyosis. MAPK1 is Negatively Correlated with miR-30c-5p In order to determine the deeper mechanism, we first searched for the potential genes that are targeted by miR-30c-5p using bioinfor- matics tools. We found that MAPK1 is represented in miR-30c-5p recognition sites in its 3’-UTRs (Figure 3A). As shown in Figure 3B, luciferase reporter assays showed that luciferase activity was signifi- cantly inhibited in cells cotransfected with miR-30c-5p and MAPK1-3 0UTR (WT), while the luciferase activity of MAPK1- 3 0UTR (MUT) remained unchanged. Next, we estimated the sup- pressive efficiency of miR-30c-5p mimics on endogenous MAPK1 expression in adenomyotic epithelial cells using RT-PCR and western blot. Our results found that expression of MAPK1 was sig- nificantly decreased in miR-30c-5p mimics group, while the expres- sion of MAPK1 was significantly up-regulated in miR-30c-5p inhibitor group (Figure 3C and D). To sum up, our results proved that MAPK1 was considered as a directly target of miR-30c-5p. MAPK1 is Involved in miR-30c-5p-Mediated Suppression in Proliferation, Invasion and Migration To better understand the correlation between miR-30c-5p and MAPK1, we designed and conducted a series rescue assay. First, we verified the overexpression ability of pcDNA-MAPK1 in adenomyotic epithelial cells (Figure 4A). Accordingly, we detected that biological functions of cells cotransfected miR-30c-5p mimics or mimic-NC with pcDNA3.1-MAPK1 or empty vector. For cell viability, we could clearly find that MAPK1 overexpression remarkably alleviated miR-30c-5p-mediated facilitation, which was measured by CCK-8 assay (Figure 4B). In addition, our results validated that cells transfected with pcDNA3.1-MAPK1 also attenuated miR-30c-5p-mediated invasive and migratory auxo- action (Figure 4C and D). Taken together, our data clarified that Table 1. List of primers used for real-time polymerase chain reaction Name of genes Sequence (5'-3') miR-30c-5p Fwd: ATTGCAGGTTTGTGCCATG Rev: AGCTCAAACGAACAGAGACAG MAPK1 Fwd: TACACCAACCTCTCGTACATCG Rev: CATGTCTGAAGCGCAGTAAGATT U6 Fwd: CTCGCTTCG GCAGCAC Rev: AACGCTTCACGAATTTGCG GAPDH Fwd: TTCACCACCATGGAGAAGGC Rev: GGCATGGACTGTGGTCATGA 24 Airong Zhang et al. https://doi.org/10.1017/thg.2021.11 Published online by Cambridge University Press MAPK1 involved in miR-30c-5p triggered antiproliferative, anti- invasive and anti-migration roles in adenomyotic epithelial cells.

Discussion

Recently, accumulating evidence suggests that numerous miRNAs are involved in the occurrence and development of endometriotic lesion development (Dai & Di, 2011), as well as the formation of adenomyosis (Guo et al., 2015), such as miR-10, miR-142-3p, miR- 17, miR-191 and miR-29c and miR-210 (Guo et al., 2015; Hu et al., 2017; Ohlsson Teague et al., 2009; Tian et al., 2015). According to current knowledge, miRNAs serve as regulatory roles in the bio- logical function of endometrial cells, including proliferation, inva- sion, inflammation response, apoptosis and angiogenesis (Bjorkman & Taylor, 2019; Lin et al., 2012), which are considered to be the main causes of adenomyosis (Erkilinc et al.,2018; Ibrahim et al., 2015; Vannuccini et al., 2017); for example, Hu et al. ( 2017) declared that miR-17 dramatically promoted the proliferation but suppressed the apoptosis of adenomyotic endometrial cells; Guo et al. (2015) showed that miR-10b was significantly reduced in both adenomyotic epithelial tissues and cells, overexpression of which could inhibit the migration and invasion ability of adenomyotic epithelial cells by targeting ZEB1 and PIK3CA. MiR-30c-5p has previously been seen as participating in endo- metriotic-related diseases; for instance, Hu et al. ( 2017) first reported that miR-30c played a role as a tumor suppressor in regu- lating migration and proliferation of human endometrial cancer cells by directly targeting the metastasis-associated gene-1 (MTA-1), which might be modulated by the AKT/mTOR/4E- BP1 pathway (X. Xu et al., 2019; Zhou et al., 2012); X. Chen et al. ( 2017) also confirmed that miR-30c could inhibit cells pro- liferation, invasion and migration and induce apoptosis in endo- metrial cancer cells by negatively regulating plasminogen activator inhibitor type 1 (PAI-1); in our study, we found that Table 2. The correlation between relative miR-30c-5p expression and clinical features of patients with adenomyosis Characteristics Case number miR-30c-5p Relative expression p-Value Age (year) >30 21 8.35 ± 1.37 .944 ≤30 2 8.28 ± 0.53 Symptoms Menorrhagia alone 3 8.08 ± 0.11 .564 Dysmenorrhea alone 13 9.08 ± 2.19 .021 Both 7 7.86 ± 2.13 .538 Duration of symptoms (years) 11 7.24 ± 0.56 .000 ≤5 12 9.22 ± 1.31 VAS score for dysmenorrhea 0−4 7 8.76 ± 1.87 .543 4−7 8 8.42 ± 0.91 .665 7−10 8 8.22 ± 1.54 .773 Menstrual bleeding (PBAC score) 3 9.23 ± 0.25 .024 ≤100 20 7.78 ± 1.01 Fig. 1. MiR-30c-5p was significantly down-regulated both in human adenomyosis tissues and adenomyotic epithelial cells. (A) The expression levels of miR-30c-5p in adenomyotic tissue samples were down-regulated compared with normal tissues. (B) The expression levels of miR-30c-5p in adenomy- otic cells were down-regulated compared with normal cells. Data were represented as mean ± SD. Note: * p < . 05, ** p < . 01 versus control. Twin Research and Human Genetics 25 https://doi.org/10.1017/thg.2021.11 Published online by Cambridge University Press miR-30c-5p was remarkably down-regulated in adenomyotic tis- sues and isolated adenomyotic epithelial cells compared with nor- mal controls. Moreover, the expression level of miR-30c-5p was associated with the severity of clinical symptoms of adenomyosis as dysmenorrhea and menometrorrhagia. Furthermore, we explored the functional role of miR-30c-5p in regulating adenomy- otic epithelial cells and indicated that overexpression of miR-30c- 5p suppressed the cell proliferation, invasion and migration, while down-expression of miR-30c-5p showed opposite effects. Therefore, the present study was the first to investigate whether miR-30c-5p is involved in the development of adenomyosis and altering the biological functions of adenomyotic epithelial cells. As one of the most well-known members of the MAP kinase family, MAPK1 might act as a binding site for multiple biochemical signals, which has been reported in a wide range of cellular proc- esses, including cell proliferation, differentiation, migration and transcription development (Hoefen & Berk, 2002; Li et al., 2014; Sun et al., 2015; Wainstein & Seger, 2016). Current studies have claimed that MAPK1 is involved in endometrial cell-related disease via targeting different miRNAs, such as miR-381 (Tu et al., 2018), miR-143 (Chang et al., 2017) and miR-93 (Gao et al., 2019). More interestingly, we validated that miR-30c-5p directly targeted the 3'-UTRs of MAPK1 using luciferase reporter assay, RT-PCR and western blot. Using a series of rescue experiments, we further found that MAPK1 participated in miR-30c-5p-mediated suppres- sion of proliferation, migration and invasion in adenomyotic epi- thelial cells. Hence, we held the opinion that miR-30c-5p could limit bioactivity of aberrant epithelial cells via suppression of MAPK1 expression, which acted as an inhibitor of adenomyotic progression.

Conclusion

In summary, our study demonstrated that miR-30c-5p was down- regulated in adenomyotic tissues and cells, which correlated with some clinical symptoms of patients. In addition, miR-30c-5p could play a suppressor role on adenomyotic epithelial cells in prolifer- ation, migration and invasion by directly targeting MAPK1. Therefore, our results suggested that miR-30c-5p might be a poten- tial therapeutic target for adenomyosis. Data The datasets used or analyzed during the current study are avail- able from the corresponding author on reasonable request. Fig. 2. The level of miR-30c-5p is correlated with the clinicopathological parameters of adenomyotic patients. (A) Endometrial epithelial cells isolated from ectopic endometrial tissues of adenomyosis were transiently transfected with miR-30c-5p mimics or miR-30c-5p inhibitor. (B –C) CCK-8 assay was performed to measure the effect of miR-30c-5p on cell viability. (D) Transwell invasion assay was performed to evaluate the influence of miR-30c-5p on cell invasion capacity . (E) Wound-healing assay was employed to determine the effect of miR-30c-5p on cell migration capacity. Data were represented as mean ± SD. Note: * p < .05, ** p < .01 versus control. 26 Airong Zhang et al. https://doi.org/10.1017/thg.2021.11 Published online by Cambridge University Press Author contributions Guarantor of integrity of the entire study: Airong Zhang; Study con- cepts: Juan Wang; Study design: Xiujuan Li; Definition of intellectual content: Kui Deng; Literature research: Kui Deng; Clinical studies: Airong Zhang; Experimental studies:A i r o n gZ h a n g ;D a t aa c q u i s i t i o n : Jianghua Wang; Data analysis: Airong Zhang; Statistical analysis: Kui D e n g ;M a n u s c r i p tp r e p a r a t i o n :X i u j u a nL i ;M a n u s c r i p te d i t i n g :K u i Deng; Manuscript review: Juan Wang. Fig. 3. MAPK1 is a direct target of miR-30c-5p. (A) MAPK1 was predicted as a potential target of miR-30c-5p by bioinformatical tools. (B) The relative luciferase activity in cells co-transfected MAPK1-3 0 UTR(WT) or MAPK1-3 0 UTR(MUT) with miR-30c-5p mimics or miR-NC. (C –D) The relative mRNA and protein expression of MAPK1 in adenomyotic epithelial cells transfected with miR-30c-5p mimics, miR-30c-5p inhibitor or NC. Data were represented as mean ± SD. Note: * p < .05, ** p < .01 versus control. NC, negative control. Fig. 4. MAPK1 is involved in miR-30c-5p-mediated suppression of cell proliferation, migration and invasion. (A) The overexpression efficiency of pcDNA3.1-MAPK1 was verified by RT-PCR and western blot. (B) The cell proliferation of adenomyotic epithelial cells co-transfected miR-30c-5p mimics or mimics-NC with pcDNA3.1-MAPK1 or empty vector, which measured by CCK-8 assay. (C –D) The transwell invasion assay and wound-healing assay were performed to detect invasion and migration abilities of denomyotic epithelial cells co-transfected miR-30c-5p mimics or mimics-NC with pcDNA3.1-MAPK1 or empty vector. Data were represente d as mean ± SD. Note: * p < .05, ** p < .01 versus control. NC, negative control. Twin Research and Human Genetics 27 https://doi.org/10.1017/thg.2021.11 Published online by Cambridge University Press Financial support This study was supported by Quality Engineering Project of Anhui Province in 2019 and Academic Funding Project for Top-notch Talents in disciplines (Majors) of Universities of Anhui Province in 2020, (gxbjZD2020043). Conflicts of interest None. Ethical standards Ethics Committee of Anqing Medical College reviewed and approved all protocols of this study, and all participants had writ- ten the informed consents. Informed consent was obtained from all individual participants included in the study.

References

Arnold, L. L., Ascher, S. M., Schruefer, J. J., & Simon, J. A. (1995). The non- surgical diagnosis of adenomyosis. Obstetrics and Gynecology , 86, 461–465. Bird, C. C., McElin, T. W., & Manalo-Estrella, P. (1972). The elusive adeno- myosis of the uterus ¾ Revisited. American Journal of Obstetrics and Gynecology, 112, 583–593. Bjorkman, S., & Taylor, H. S. (2019). microRNAs in endometriosis: Biological function and emerging biomarker candidates. Biology of Reproduction , 100, 1135–1146. Chang, L., Zhang, D., Shi, H., Bian, Y., & Guo, R. (2017). MiR-143 inhibits endometrial cancer cell proliferation and metastasis by targeting MAPK1. Oncotarget, 8, 84384–84395. Chen, X., Jiang, Y., & Pan, D. (2017). miR-30c may serve a role in endometrio- sis by targeting plasminogen activator inhibitor-1. Experimental and Therapeutic Medicine, 14, 4846–4852. Chen, Y.-J., Li, H.-Y., Huang, C.-H., Twu, N.-F., Yen, M.-S., Wang, P.-H., Chou, T.-Y., Liu, Y.-N., Chao, K.-C., & Yang, M.-H. (2010). Oestrogen- induced epithelial-mesenchymal transition of endometrial epithelial cells contributes to the development of adenomyosis. The Journal of Pathology , 222, 261–270. Dai, L., & Di, W.(2011). Role of microRNA in the occurrence and development of endometriosis. Zhonghua fu chan ke za zhi , 46, 304–306. Dong, P.-X., Jia, N., Xu, Z.-J., Liu, Y.-T., Li, D.-J., & Feng, Y.-J. (2008). Silencing of IQGAP1 by shRNA inhibits the invasion of ovarian carcinoma HO-8910PM cells in vitro. Journal of Experimental & Clinical Cancer Research, 27, 77. Erkilinç, S., Taylan, E., Gülseren, V., Erkilinç, G., Karadeniz, T., Ba ğci, M., Temel, O., Solmaz, U., Gökçü, M., & Sanci, M. (2018). The effect of adeno- myosis in myometrial invasion and overall survival in endometrial cancer. International Journal of Gynecological Cancer , 28, 145–151. Gao, Y., Deng, K., Liu, X., Dai, M., Chen, X., Chen, J., Chen, J., Huang, Y., Dai, S., & Chen, J. (2019). Molecular mechanism and role of microRNA-93 in human cancers: A study based on bioinformatics analysis, meta-analysis, and quantitative polymerase chain reaction validation. Journal of Cellular Biochemistry, 120, 6370–6383. Guo, Y., Lang, X., Lu, Z., Wang, J., Li, T., Liao, Y., Jia, C., Zhao, W., & Fang, H. (2015). MiR-10b directly targets ZEB1 and PIK3CA to curb adenomyotic epithelial cell invasiveness via up-regulation of E-cadherin and inhibition of Akt phosphorylation. Cellular Physiology and Biochemistry, 35, 2169–2180. Hoefen, R. J., & Berk, B. C. (2002). The role of MAP kinases in endothelial activation. Vascular Pharmacology, 38, 271–273. Hu, H., Li, H., & He, Y. (2017). MicroRNA-17 downregulates expression of the PTEN gene to promote the occurrence and development of adenomyosis. Experimental and Therapeutic Medicine , 14, 3805–3811. Huang, X., Huang, Q., Chen, S., Zhang, J., Lin, K., & Zhang, X. (2015). Efficacy of laparoscopic adenomyomectomy using double-flap method for diffuse uterine adenomyosis. BMC Women’s Health, 15, 24. I b r a h i m ,M .G . ,C h i a n t e r a ,V . ,F r a n g i n i ,S . ,Y o u n e s ,S . ,K ö h l e r ,C . ,T a u b e ,E .T . , Plendl, J., & Mechsner, S.(2015). Ultramicro-trauma in the endometrial-myo- metrial junctional zone and pale cell migration in adenomyosis. Fertility and Sterility, 104,1 4 7 5–1483. Irani, S., & Hussain, M. M.(2015). Role of microRNA-30c in lipid metabolism, adipogenesis, cardiac remodeling and cancer. Current Opinion in Lipidology, 26, 139–146. Juang, C. M., Chou, P., Yen, M. S., Twu, N. F., Horng, H. C., & Hsu, W. L. (2007). Adenomyosis and risk of preterm delivery. BJOG, 114, 165–169. Levy, G., Dehaene, A., Laurent, N., Lernout, M., Collinet, P., Lucot, J. P., Lions, C., & Poncelet, E. (2013). An update on adenomyosis. Diagnostic and Interventional Imaging , 94,3 –25. Leyendecker, G., Wildt, L., & Mall, G. (2009). The pathophysiology of endo- metriosis and adenomyosis: Tissue injury and repair. Archives of Gynecology and Obstetrics, 280, 529–538. Li, Q., Chen, M., Liu, H., Yang, L., Yang, T., & He, G. (2014). The dual role of ERK signaling in the apoptosis of neurons. Frontiers in Bioscience , 19, 1411–1417. Lin, S.-C., Wang, C.-C., Wu, M.-H., Yang, S.-H., Li, Y.-H., & Tsai, S.-J. (2012). Hypoxia-induced microR NA-20a expression increases ERK phosphorylation and angiogenic gene expression in endometriotic stromal cells. The Journal of Clinical Endocrinology and Metabolism , 97, E1515 –E1523. Ohlsson Teague, E. M., Van der Hoek, K. H., Van der Hoek, M. B., Perry, N., Wagaarachchi, P., Robertson, S. A., Print, C. G., & Hull, L. M. (2009). MicroRNA-regulated pathways associated with endometriosis. Molecular Endocrinology, 23, 265–275. Senturk, L. M., & Imamoglu, M. (2015). Adenomyosis: What is new? Women’s Health, 11, 717 –724. Simonson, B., & Das, S. (2015). MicroRNA therapeutics: The next magic bul- let? Mini Reviews in Medicinal Chemistry , 15, 467 –474. Sun, Y., Liu, W.-Z., Liu T, Feng, X., Yang, N., & Zhou, H. F. (2015). Signaling pathway of MAPK/ERK in cell proliferation, differentiation, migration, sen- escence and apoptosis. Journal of Receptor and Signal Transduction Research, 35, 600–604. Tian, X., Xu, L., & Wang, P. (2015). MiR-191 inhibits TNF-alpha induced apoptosis of ovarian endometriosis and endometrioid carcinoma cells by tar- geting DAPK1. International Journal of Clinical and Experimental Pathology, 8, 4933–4942. Tu, C., Wang, F., & Wan, J. (2018). MicroRNA-381 inhibits cell proliferation and invasion in endometrial carcinoma by targeting the IGF-1R. Molecular Medicine Reports, 17, 4090–4098. Vannuccini, S., Tosti, C., Carmona, F., Huang, S. J., Chapron, C., Guo, S. W., Petraglia, F. (2017). Pathogenesis of adenomyosis: An update on molecular mechanisms. Reproductive Biomedicine Online , 35, 592 –601. Wainstein, E., & Seger, R.(2016). The dynamic subcellular localization of ERK: mechanisms of translocation and role in various organelles. Current Opinion in Cell Biology , 39,1 5–20. Xu, T.-X., Zhao, S.-Z., Dong, M., & Yu, X.-R. (2016). Hypoxia responsive miR-210 promotes cell survival and autophagy of endometriotic cells in hypoxia. European Review for Medical and Pharmacological Sciences , 20, 399–406. Xu, X., Kong, X., Liu, T., Zhou, L., Wu, J., Fu, J., Wang, Y., Zhu, M., Yao, S., Ding, Y., Ding, L., Li, R., Zhu, X., Tang, X., Zhang, Y., Yang, Q., Ling, J., & Zhou, H. (2019). Metastasis-associated protein 1, modulated by miR-30c, promotes endometrial cancer progression through AKT/mTOR/4E-BP1 pathway. Gynecologic Oncology, 154, 207–217. Zhang, L., Rees, M. C., & Bicknell, R. (1995). The isolation and long-term cul- ture of normal human endometrial epithelium and stroma. Expression of mRNAs for angiogenic polypeptides basally and on oestrogen and progester- one challenges. Journal of Cell Science , 108, 323–331. Z h o u ,H . ,X u ,X . ,X u n ,Q . ,Y u ,D . ,L i n g ,J . ,G u o ,F . ,Y a n ,Y . ,S h i ,J . , &H u ,Y . (2012). microRNA-30c negatively regulates endometrial cancer cells by targeting metasta sis-associated gene-1. Oncology Reports , 27, 807–812. 28 Airong Zhang et al. https://doi.org/10.1017/thg.2021.11 Published online by Cambridge University Press

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: oa-pdf

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Condition tags

adenomyosisdysmenorrhea

MeSH descriptors

Adenomyosis Adenomyosis MicroRNAs MicroRNAs Cell Movement Cell Movement Cell Proliferation Cell Proliferation Epithelial Cells Female Gene Expression Regulation, Neoplastic Humans Mitogen-Activated Protein Kinase 1

Citation neighborhood

Papers in the corpus that this work cites (lower rings, blue) and that cite this one (upper rings, green). Dot size scales with the paper's in-corpus citation count — bigger dot = more influential within the endo/adeno field. Click a dot to open that paper. [ expand to 2 hops ] — adds papers reached through this work's immediate citers/citees. Heavier; up to 60 extra dots.

References (39)

Cited by (3)

Source provenance

europepmc
last seen: 2026-09-12T06:55:35.949492+00:00
openalex
last seen: 2026-06-10T17:14:06.276822+00:00
pubmed
last seen: 2026-05-13T22:24:43.494969+00:00
License: CC0 · commercial use OK