{"paper_id":"233d077d-4b74-4372-892f-2aa47821f831","body_text":"Article\nMiR-30c-5p Directly Targets MAPK1 to Regulate the Proliferation,\nMigration and Invasion of Adenomyotic Epithelial Cells in\nAdenomyosis\nAirong Zhang1,2, Xiujuan Liu 2, Juan Wang 1, Kui Deng 3 and Jianghua Wang 4\n1Department of Clinical Medicine, Anqing Medical College, Anqing, China, 2Department of Gynaecology and Obstetrics, The First People ’s Hospital of Anqing,\nAnqing, China, 3Department of Epidemiology and Biostatistics, School of Public Health, Harbin Medical University, Harbin, China and 4Department of Nursing,\nNavy Anqing Hospital, Anqing, China\nAbstract\nThe purpose of our study was to elucidate the functions of miR-30c-5p on adenomyosis for exploring novel treatment strategies. We first detected\nthe expression of miR-30c-5p in clinical adenomyotic tissues and isolated endometrial cells from adenomyotic tissues. Next, gain and loss-of-\nfunction assays were performed to detect the effect of miR-30c-5p on adenomyotic endometrial cells. Further, luciferase assay and real-time\npolymerase chain reaction as well as western blot were conducted to investigate the potential target of miR-30c-5p; and transwell assay,\nwound-healing assay and CCK-8 assay were used to evaluate the effects of miR-30c-5p and its target on regulating biological functions of\nadenomyotic endometrial cells. Our results found that miR-30c-5p was down-regulated in both adenomyosis tissues and adenomyotic epithelial\ncells, which correlated with dysmenorrhea, longer duration of symptoms and more menstrual bleeding. Moreover, the overexpression of\nmiR-30c-5p inhibited the proliferation, migration and invasion of adenomyotic epithelial cells, where miR-30c-5p knockdown had an opposite\neffect. Furthermore, we confirmed mitogen-activated protein kinase 1 (MAPK1) was one of the direct targets of miR-30c-5p, indicating its impor-\ntant role in miR-30c-5p-mediated suppression of proliferation, invasion and migration in adenomyotic epithelial cells. This study showed that the\ninteraction of miR-30c-5p with MAPK1 can regulate the proliferation, invasion and migration in adenomyotic epithelial cells.\nKeywords: Adenomyosis; miR-30c-5p; MAPK1; adenomyotic epithelial cells\n(Received 20 November 2020; accepted 13 January 2021; First Published online 29 March 2021)\nAdenomyosis is regarded as one of most common gynecological\ndisorders, which has a morbidity of 8 –27% in women with repro-\nductive age (Huang et al., 2015; Leyendecker et al., 2009). The\npathological change of adenomyosis is characterized by ectopic\nendometrial glands and stroma invasion into myometrium of\nuterus, which can also be either diffuse or focal lesion (Bird\net al., 1972). When the lesion in the myometrium exhibits limited\nnodules, the condition is then known as adenomyoma (Levy et al.,\n2013). The patients with adenomyoma usually suffer from dys-\nmenorrhea, subfertility, chroni cp e l v i cp a i na n dm e n o r r h a g i a ,\nleading to physical pain and qual ity of life reduction (Arnold\net al., 1995;J u a n ge ta l . ,2007). Recent researches identified that\nestrogen could enhance the invasive and migratory ability of\nendometrial epithelial cells, which further results in the endo-\nmetrium infiltrating the myometrial zone (Y.-J. Chen et al.,\n2010; Senturk & Imamoglu, 2015). Therefore, hormone therapy\nhas become the mainstream treatment for adenomyosis, but it\nc a no n l yp a r t l yc o n t r o lt h es y m p t o m so ft h i sd i s e a s e ,s u c ha sd y s -\nmenorrhea, and hysterectomy for severe adenomyosis is often\nrequired (Y.-J. Chen et al., 2010; Senturk & Imamoglu, 2015).\nThus, a detailed molecular mechanism of the above pathological\nprocess is urgently needed to pro vide novel and potential thera-\npeutic strategies for adenomyosis.\nMicroRNAs (miRNAs) are defined as noncoding RNAs and\nconsist of 22−25 nucleotides that function as a posttranscriptional\ncontroller of their target genes via binding the 3 ’-untranslated\nregions (3\n0-UTRs; Simonson & Das, 2015). Accumulating evi-\ndence confirms that multiple miRNAs are involved in the occur-\nrence and development in adenomyosis; for instance, Hu et al.\n(2017) indicated that miR-17 was significantly up-regulated in\nendometrial tissues of patients with adenomyosis, which further\ninfluenced proliferation and apoptosis of adenomyotic endo-\nmetrial cell by directly targeting phosphatase and tensin homolog\n(PTEN); T.-X. Xu et al. ( 2016) found that miR-210 could contrib-\nute to pathological progression of endometriosis by targeting Bcl2/\nBeclin-1 axis. The function of miR-30c has been extensively\nreported in numerous pathological processes such as lipid metabo-\nlism, cardiac remodeling, adipogenesis and progression of cancers\n(Irani & Hussain, 2015). At present, the latest research using\nmicroarray screen assay claims that miR-30c expression descends\ninto ectopic endometrial lesions tissue instead of normal endo-\nmetrium tissue, suggesting that miR-30c might be partly involved\nin pathologic change in adenomyosis (Guo et al., 2015). However,\nno relevant studies have focused on the exact role of miR-30c-5p in\nadenomyosis until now.\nAuthor for correspondence: Airong Zhang, Email: ZAR158@163.com\nCite this article: Zhang A, Liu X, Wang J, Deng K, and Wang J. (2021) MiR-30c-5p\nDirectly Targets MAPK1 to Regulate the Proliferation, Migration and Invasion of\nAdenomyotic Epithelial Cells in Adenomyosis. Twin Research and Human Genetics 24:\n22–28, https://doi.org/10.1017/thg.2021.11\n© The Author(s) 2021.\nTwin Research and Human Genetics (2021), 24,2 2 –28\ndoi:10.1017/thg.2021.11\nhttps://doi.org/10.1017/thg.2021.11 Published online by Cambridge University Press\n\nTherefore, the aim of this study is to clarify the role of miR-30c-\n5p in adenomyotic progression and further investigate the poten-\ntial downstream target of miR-30c-5p. Moreover, we intend to\nexplore the interaction between miR-30c-5p and its target in regu-\nlating biological function of adenomyotic epithelial cells, providing\na potential therapeutic method for adenomyosis.\nMaterials and Methods\nPatient Samples\nA total number of 23 patients (age range 29 −45 years old) with\nadenomyosis who underwent hysterectomy at our hospital from\nApril 2016 to September 2018 were enrolled in this study.\nEctopic and eutopic endometrial tissues from adenomyotic\npatients were collected. Meanwhile, endometrial tissues obtained\nfrom 20 patients who underwent a hysterectomy (age range\n34−48 years old) with benign gynecological diseases, such as ute-\nrine prolapse and subserousal leiomyoma, were regarded as nor-\nmal controls. After surgery, the endometrial tissues were\nimmediately collected and frozen in liquid nitrogen for further\nanalysis. Before the hysterectomy, the clinicopathologic parame-\nters of adenomyotic patients were recorded with a standard\nquestionnaire using a visual analogue scale (VAS) and pictorial\nblood-loss assessment chart (PBAC). The Ethics Committee of\nour hospital reviewed and approved all protocols of this study,\nand all participants provided written informed consent.\nCell Culture\nAs previously described, ectopic and eutopic endometrial tissues\nand normal endometrium epithelial tissues were separated first\n(Zhang et al., 1995). Next, the isolated adenomyotic endometrial\ncells were cultured in DMEM (BD Biosciences, USA) supple-\nmented with 10% fetal bovine serum (FBS, Gibco, USA) in a\nhumidified incubator with 5% CO\n2 at 37° C. The HEK 293T cells\nwere purchased from the Institute of Biochemistry and Cell\nBiology of the Chinese Academy of Sciences (Shanghai, China)\nand cultured in the same condition.\nCell Transfection\nmiR-30c-5p mimics, miR-30c-5p inhibitor, pcDNA3.1-MAPK1\nand a corresponding negative control (NC) were obtained from\nGenePharma (Shanghai, China). After cell growth reached approx-\nimately 60 −80% confluence, the adenomyotic endometrial cells\nwere then transfected with the above reagents using\nLipofectamine 2000 (Thermo Fisher Scientific, USA) following\nthe manufacturer’s instruction. After 48 h of transfection, the cells\nwere collected for further analysis.\nCell Proliferation Assay\nThe CCK-8 assay and colony formation assay were used to detect\ncell proliferation rate. For CCK-8 assay, the transfected cells\n(1 × 10\n3/per well) were seeded in 96-well plates and cultured for\nup to 72 h. Then, cell viability was proven using CCK-8\n(Beyotime Biotechnology, China) at different time points (0, 24,\n48 and 72 h) under a Multi-Detection Microplate Reader\n(Bio-Rad, USA).\nCell Migration Assay\nWound-healing assays were performed to assess cell migration. In\nbrief, 5 × 10\n4 cells were seeded in 6-well plates coated with\nfibronectin and cultured for 24 h until there was approximately\n80% confluence. The scratches in each well were made by a 200-\nul pipette tip, and then the cells were transfected with miR-30c-\n5p mimics, miR-30c-5p inhibitor and pcDNA3.1-MAPK1 and\ncontrols. The migratory cells were observed in a selected area at\n0 and 48 h after initial scratch under a light microscope\n(Olympus, Japan).\nCell Invasion Assay\nThe invasive ability of endometrial epithelial cells was measured as\npreviously described using the Transwell system (Dong et al.,\n2008). Briefly, the transfected cells were suspended in a serum-free\nmedium at density of 2 × 10\n5 cells/ml and then seeded into the\nupper chamber of the Transwell system, while the complete\nmedium was added into the lower chamber. After incubation\nfor 24 h, the invaded cells were fixed with 10% formaldehyde for\n30 min and then stained with 0.5% crystal violet for 10 min and\ncounted for five random fields using a light microscope\n(Olympus, Japan).\nLuciferase Reporter Assay\nLuciferase reporter plasmid containing wild MAPK1-3\n0-UTR\n(MAPK1-WT) or mutant MAPK1-3 0-UTR (MAPK1-MUT) were\nsynthesized by Promega (Madison, USA) and then subcloned into\nthe pmiRGLO vector (Promega, USA). Next, the HEK293 cells were\nco-tranfected with MAPK1-WT or MAPK1-MUT reporter plasmid\ntogether with miR-30c-5p mimics and mimics-NC using\nLipofectamine 2000 (Invitrogen, USA). After 48 h of transfection,\nthe luciferase activity was measured by Dual Luciferase Assay\nSystem (Promega, USA) according to the manufacturer’s specification.\nQuantitative Real-Time Polymerase Chain Reaction (qRT-PCR)\nTotal RNAs were extracted from clinical tissues and cells using\nTRIZOL reagent (Thermo Fisher Scientific, USA). After that,\ncDNA was synthesized from RNAs using TaqMan MicroRNA\nReverse Transcription Kit (Thermo Fisher Scientific, USA) accord-\ning to the manufacturer ’s specification. Then, quantitative real-\ntime polymerase chain reaction (qRT-PCR) was conducted using\nSYBR Green PCR Master Mix (BioRad, USA) under a CFX96 Real-\nTime Thermocycler system (BioRad, USA). U6 was represent as\ninternal controls for miR-30c-5p, whereas GAPDH was repre-\nsented as an internal control for mitogen-activated protein kinase\n1 (MAPK1). The relative expression of each mRNA or miRNA was\nanalyzed using 2 −ΔΔCT method. All primer sequences are listed\nin Table 1.\nWestern Blot\nTotal proteins were extracted using RIPA lysis buffer (Beyotime,\nChina) and qualified by a BCA detecting kit (Beyotime, China) fol-\nlowing the manufacturer ’s specifications. Subsequently, the\nextracted protein was separated on a 10% SDS-PAGE and then\ntransferred onto PVDF membrane (Millipore, USA) blocked with\n5% nonfat milk for 2 h at room temperature and incubated over-\nnight with primary antibodies against MAPK1 (1: 1000, Abcam,\nUK) and GAPDH (1: 5000, Abcam, UK) at 37° C. Finally, the\nmembrane was incubated with HRP-conjugated secondary anti-\nbodies (1:5000, Abcam, UK) at room temperature for 1 h. The blots\nwere visualized using enhanced chemiluminescence (Bio-Rad,\nUSA) and quantitative calculated using image J (National\nInstitutes of Health, USA).\nTwin Research and Human Genetics 23\nhttps://doi.org/10.1017/thg.2021.11 Published online by Cambridge University Press\n\nStatistical Analysis\nAll experiments were carried out in triplicate. Data are pre-\nsented as the mean ± standard deviation ( SD), and the error bars\nrepresent the SD from three independent experiments. The stat-\nistical analysis was conducted using SPSS 21.0 (SPSS Inc, USA)\nor GraphPad Prism 7.1 software (N ational Institutes of Health,\nUSA). Student ’s t test or one-way analysis of variance (ANOVA)\nwas used for comparisons between groups. The correlation\nbetween miR-30c-5p and clinical-pathological parameters of\nadenomyotic patients were measured by Pearson ’sc o r r e l a t i o n\nmethods. Statistical significance was determined as a p value less\nthan .05.\nResults\nMiR-30c-5p Expression Is Down-Regulated Both in Human\nAdenomyosis Tissues and Adenomyotic Epithelial Cells\nTo explore whether miR-30c-5p served an essential role in human\nadenomyosis, we first evaluated the expression of miR-30c-5p in\nadenomyosis tissues using qRT-PCR. Our results found that\nmiR-30c-5p expression was significantly reduced in eutopic and\nectopic tissue of adenomyosis compared with normal tissues\n(Figure 1A). As shown in Figure 1B, the level of miR-30c-5p\nwas conspicuously down-regulated in isolated adenomyotic epi-\nthelial cells in comparison with normal endometrial cells, sug-\ngesting that miR-30c-5p might be involved in pathological\nprocess of adenomyosis.\nThe Level of miR-30c-5p is Correlated with the\nClinicopathological Parameters of Adenomyotic Patients\nOn account of the above results, we tried to find the correlation\nbetween the expression level of miR-30c-5p with the clinicopatho-\nlogical parameters of 23 adenomyotic patients, such as age, clinical\nsymptoms (dysmenorrhea or menometrorrhagia or both), dura-\ntion of symptoms, VAS score for dysmenorrhea, as well as men-\nstrual bleeding (PBAC score). As shown in Table 1, the lower\nexpression level of miR-30c-5p was tightly correlated with dys-\nmenorrhea ( p = .021), longer duration of symptoms ( p = .000)\nand more menstrual bleeding ( p = .001); however, the results\nshowed that there was no significant relationship between age or\nVAS score for dysmenorrhea and miR-30c-5p expression in\nadenomyotic patients ( p > .05; Table 2).\nMiR-30c-5p Regulates Proliferation, Invasion and Migration of\nAdenomyotic Epithelial Cells\nFrom previous findings, we were conscious that the expression of\nmiR-30c-5p might act as a pivotal role in development of adeno-\nmyosis; hence, the relevant deep mechanism was further explored\nin adenomyotic epithelial cells. First, miR-30c-5p mimics and\nmiR-30c-5p inhibitor were transfected into adenomyotic epithelial\ncells to verify their overexpression or down-expression efficiency. As\nshown in Figure 2A, miR-30c-5p mimics significantly up-regulated\nthe miR-30c-5p expression, whereas miR-30c-5p inhibitor could\nknock down miR-30c-5p expression. Then, the proliferation of\nadenomyotic epithelial cells were measured by CCK-8 assay. Our\nresults found that overexpression of miR-30c-5p could distinctly\ninhibit the cell viability of adenomyotic epithelial cells, where\nmiR-30c-5p inhibitor showed an enhanced effect on cell viability\n(Figure 2B and C). Moreover, the transwell invasion assay and\nwound-healing assay were conducted to assess the invasive and\nmigratory ability of adenomyotic epithelial cells transfected with\nmiR-30c-5p mimics or miR-30c-5p inhibitor. The data revealed that\nthe cell invasion and migration were remarkably suppressed in the\nmiR-30c-5p mimics group, which were dramatically expedited by\ntransfection of miR-30c-5p inhibitor (Figure 2D and E). Taken\ntogether, our results identified that miR-30c-5p could regulate the\nproliferation and invasion, as well as migration of adenomyotic epi-\nthelial cells, and might play an important role in progression of\nadenomyosis.\nMAPK1 is Negatively Correlated with miR-30c-5p\nIn order to determine the deeper mechanism, we first searched for\nthe potential genes that are targeted by miR-30c-5p using bioinfor-\nmatics tools. We found that MAPK1 is represented in miR-30c-5p\nrecognition sites in its 3’-UTRs (Figure 3A). As shown in Figure 3B,\nluciferase reporter assays showed that luciferase activity was signifi-\ncantly inhibited in cells cotransfected with miR-30c-5p and\nMAPK1-3\n0UTR (WT), while the luciferase activity of MAPK1-\n3 0UTR (MUT) remained unchanged. Next, we estimated the sup-\npressive efficiency of miR-30c-5p mimics on endogenous MAPK1\nexpression in adenomyotic epithelial cells using RT-PCR and\nwestern blot. Our results found that expression of MAPK1 was sig-\nnificantly decreased in miR-30c-5p mimics group, while the expres-\nsion of MAPK1 was significantly up-regulated in miR-30c-5p\ninhibitor group (Figure 3C and D). To sum up, our results proved\nthat MAPK1 was considered as a directly target of miR-30c-5p.\nMAPK1 is Involved in miR-30c-5p-Mediated Suppression in\nProliferation, Invasion and Migration\nTo better understand the correlation between miR-30c-5p and\nMAPK1, we designed and conducted a series rescue assay. First,\nwe verified the overexpression ability of pcDNA-MAPK1 in\nadenomyotic epithelial cells (Figure 4A). Accordingly, we detected\nthat biological functions of cells cotransfected miR-30c-5p mimics\nor mimic-NC with pcDNA3.1-MAPK1 or empty vector. For cell\nviability, we could clearly find that MAPK1 overexpression\nremarkably alleviated miR-30c-5p-mediated facilitation, which\nwas measured by CCK-8 assay (Figure 4B). In addition, our results\nvalidated that cells transfected with pcDNA3.1-MAPK1 also\nattenuated miR-30c-5p-mediated invasive and migratory auxo-\naction (Figure 4C and D). Taken together, our data clarified that\nTable 1. List of primers used for real-time polymerase chain reaction\nName of genes Sequence (5'-3')\nmiR-30c-5p Fwd: ATTGCAGGTTTGTGCCATG\nRev: AGCTCAAACGAACAGAGACAG\nMAPK1 Fwd: TACACCAACCTCTCGTACATCG\nRev: CATGTCTGAAGCGCAGTAAGATT\nU6 Fwd: CTCGCTTCG GCAGCAC\nRev: AACGCTTCACGAATTTGCG\nGAPDH Fwd: TTCACCACCATGGAGAAGGC\nRev: GGCATGGACTGTGGTCATGA\n24 Airong Zhang et al.\nhttps://doi.org/10.1017/thg.2021.11 Published online by Cambridge University Press\n\nMAPK1 involved in miR-30c-5p triggered antiproliferative, anti-\ninvasive and anti-migration roles in adenomyotic epithelial cells.\nDiscussion\nRecently, accumulating evidence suggests that numerous miRNAs\nare involved in the occurrence and development of endometriotic\nlesion development (Dai & Di, 2011), as well as the formation of\nadenomyosis (Guo et al., 2015), such as miR-10, miR-142-3p, miR-\n17, miR-191 and miR-29c and miR-210 (Guo et al., 2015; Hu et al.,\n2017; Ohlsson Teague et al., 2009; Tian et al., 2015). According to\ncurrent knowledge, miRNAs serve as regulatory roles in the bio-\nlogical function of endometrial cells, including proliferation, inva-\nsion, inflammation response, apoptosis and angiogenesis\n(Bjorkman & Taylor, 2019; Lin et al., 2012), which are considered\nto be the main causes of adenomyosis (Erkilinc et al.,2018; Ibrahim\net al., 2015; Vannuccini et al., 2017); for example, Hu et al. ( 2017)\ndeclared that miR-17 dramatically promoted the proliferation but\nsuppressed the apoptosis of adenomyotic endometrial cells; Guo\net al. (2015) showed that miR-10b was significantly reduced in both\nadenomyotic epithelial tissues and cells, overexpression of which\ncould inhibit the migration and invasion ability of adenomyotic\nepithelial cells by targeting ZEB1 and PIK3CA.\nMiR-30c-5p has previously been seen as participating in endo-\nmetriotic-related diseases; for instance, Hu et al. ( 2017) first\nreported that miR-30c played a role as a tumor suppressor in regu-\nlating migration and proliferation of human endometrial cancer\ncells by directly targeting the metastasis-associated gene-1\n(MTA-1), which might be modulated by the AKT/mTOR/4E-\nBP1 pathway (X. Xu et al., 2019; Zhou et al., 2012); X. Chen\net al. ( 2017) also confirmed that miR-30c could inhibit cells pro-\nliferation, invasion and migration and induce apoptosis in endo-\nmetrial cancer cells by negatively regulating plasminogen\nactivator inhibitor type 1 (PAI-1); in our study, we found that\nTable 2. The correlation between relative miR-30c-5p expression and clinical features of patients with adenomyosis\nCharacteristics Case number\nmiR-30c-5p\nRelative expression p-Value\nAge (year)\n>30 21 8.35 ± 1.37 .944\n≤30 2 8.28 ± 0.53\nSymptoms\nMenorrhagia alone 3 8.08 ± 0.11 .564\nDysmenorrhea alone 13 9.08 ± 2.19 .021\nBoth 7 7.86 ± 2.13 .538\nDuration of symptoms (years)\n11 7.24 ± 0.56 .000\n≤5 12 9.22 ± 1.31\nVAS score for dysmenorrhea\n0−4 7 8.76 ± 1.87 .543\n4−7 8 8.42 ± 0.91 .665\n7−10 8 8.22 ± 1.54 .773\nMenstrual bleeding (PBAC score)\n3 9.23 ± 0.25 .024\n≤100 20 7.78 ± 1.01\nFig. 1. MiR-30c-5p was significantly down-regulated both in\nhuman adenomyosis tissues and adenomyotic epithelial\ncells. (A) The expression levels of miR-30c-5p in adenomyotic\ntissue samples were down-regulated compared with normal\ntissues. (B) The expression levels of miR-30c-5p in adenomy-\notic cells were down-regulated compared with normal cells.\nData were represented as mean ± SD.\nNote: * p < . 05, ** p < . 01 versus control.\nTwin Research and Human Genetics 25\nhttps://doi.org/10.1017/thg.2021.11 Published online by Cambridge University Press\n\nmiR-30c-5p was remarkably down-regulated in adenomyotic tis-\nsues and isolated adenomyotic epithelial cells compared with nor-\nmal controls. Moreover, the expression level of miR-30c-5p was\nassociated with the severity of clinical symptoms of adenomyosis\nas dysmenorrhea and menometrorrhagia. Furthermore, we\nexplored the functional role of miR-30c-5p in regulating adenomy-\notic epithelial cells and indicated that overexpression of miR-30c-\n5p suppressed the cell proliferation, invasion and migration, while\ndown-expression of miR-30c-5p showed opposite effects.\nTherefore, the present study was the first to investigate whether\nmiR-30c-5p is involved in the development of adenomyosis and\naltering the biological functions of adenomyotic epithelial cells.\nAs one of the most well-known members of the MAP kinase\nfamily, MAPK1 might act as a binding site for multiple biochemical\nsignals, which has been reported in a wide range of cellular proc-\nesses, including cell proliferation, differentiation, migration and\ntranscription development (Hoefen & Berk, 2002; Li et al., 2014;\nSun et al., 2015; Wainstein & Seger, 2016). Current studies have\nclaimed that MAPK1 is involved in endometrial cell-related disease\nvia targeting different miRNAs, such as miR-381 (Tu et al., 2018),\nmiR-143 (Chang et al., 2017) and miR-93 (Gao et al., 2019). More\ninterestingly, we validated that miR-30c-5p directly targeted the\n3'-UTRs of MAPK1 using luciferase reporter assay, RT-PCR and\nwestern blot. Using a series of rescue experiments, we further\nfound that MAPK1 participated in miR-30c-5p-mediated suppres-\nsion of proliferation, migration and invasion in adenomyotic epi-\nthelial cells. Hence, we held the opinion that miR-30c-5p could\nlimit bioactivity of aberrant epithelial cells via suppression of\nMAPK1 expression, which acted as an inhibitor of adenomyotic\nprogression.\nConclusion\nIn summary, our study demonstrated that miR-30c-5p was down-\nregulated in adenomyotic tissues and cells, which correlated with\nsome clinical symptoms of patients. In addition, miR-30c-5p could\nplay a suppressor role on adenomyotic epithelial cells in prolifer-\nation, migration and invasion by directly targeting MAPK1.\nTherefore, our results suggested that miR-30c-5p might be a poten-\ntial therapeutic target for adenomyosis.\nData\nThe datasets used or analyzed during the current study are avail-\nable from the corresponding author on reasonable request.\nFig. 2. The level of miR-30c-5p is correlated with the clinicopathological parameters of adenomyotic patients. (A) Endometrial epithelial cells isolated from ectopic\nendometrial tissues of adenomyosis were transiently transfected with miR-30c-5p mimics or miR-30c-5p inhibitor. (B –C) CCK-8 assay was performed to measure the\neffect of miR-30c-5p on cell viability. (D) Transwell invasion assay was performed to evaluate the influence of miR-30c-5p on cell invasion capacity . (E) Wound-healing\nassay was employed to determine the effect of miR-30c-5p on cell migration capacity. Data were represented as mean ± SD.\nNote: * p < .05, ** p < .01 versus control.\n26 Airong Zhang et al.\nhttps://doi.org/10.1017/thg.2021.11 Published online by Cambridge University Press\n\nAuthor contributions\nGuarantor of integrity of the entire study: Airong Zhang; Study con-\ncepts: Juan Wang; Study design: Xiujuan Li; Definition of intellectual\ncontent: Kui Deng; Literature research: Kui Deng; Clinical studies:\nAirong Zhang; Experimental studies:A i r o n gZ h a n g ;D a t aa c q u i s i t i o n :\nJianghua Wang; Data analysis: Airong Zhang; Statistical analysis: Kui\nD e n g ;M a n u s c r i p tp r e p a r a t i o n :X i u j u a nL i ;M a n u s c r i p te d i t i n g :K u i\nDeng; Manuscript review: Juan Wang.\nFig. 3. MAPK1 is a direct target of miR-30c-5p. (A) MAPK1 was predicted as a potential target of miR-30c-5p by bioinformatical tools. (B) The relative luciferase activity\nin cells co-transfected MAPK1-3 0 UTR(WT) or MAPK1-3 0 UTR(MUT) with miR-30c-5p mimics or miR-NC. (C –D) The relative mRNA and protein expression of MAPK1 in\nadenomyotic epithelial cells transfected with miR-30c-5p mimics, miR-30c-5p inhibitor or NC. Data were represented as mean ± SD.\nNote: * p < .05, ** p < .01 versus control. NC, negative control.\nFig. 4. MAPK1 is involved in miR-30c-5p-mediated suppression of cell proliferation, migration and invasion. (A) The overexpression efficiency of pcDNA3.1-MAPK1 was\nverified by RT-PCR and western blot. (B) The cell proliferation of adenomyotic epithelial cells co-transfected miR-30c-5p mimics or mimics-NC with pcDNA3.1-MAPK1\nor empty vector, which measured by CCK-8 assay. (C –D) The transwell invasion assay and wound-healing assay were performed to detect invasion and migration\nabilities of denomyotic epithelial cells co-transfected miR-30c-5p mimics or mimics-NC with pcDNA3.1-MAPK1 or empty vector. Data were represente d as mean ± SD.\nNote: * p < .05, ** p < .01 versus control. NC, negative control.\nTwin Research and Human Genetics 27\nhttps://doi.org/10.1017/thg.2021.11 Published online by Cambridge University Press\n\nFinancial support\nThis study was supported by Quality Engineering Project of Anhui\nProvince in 2019 and Academic Funding Project for Top-notch\nTalents in disciplines (Majors) of Universities of Anhui\nProvince in 2020, (gxbjZD2020043).\nConflicts of interest\nNone.\nEthical standards\nEthics Committee of Anqing Medical College reviewed and\napproved all protocols of this study, and all participants had writ-\nten the informed consents. Informed consent was obtained from all\nindividual participants included in the study.\nReferences\nArnold, L. L., Ascher, S. M., Schruefer, J. J., & Simon, J. A. (1995). The non-\nsurgical diagnosis of adenomyosis. Obstetrics and Gynecology , 86, 461–465.\nBird, C. C., McElin, T. W., & Manalo-Estrella, P. (1972). The elusive adeno-\nmyosis of the uterus ¾ Revisited. American Journal of Obstetrics and\nGynecology, 112, 583–593.\nBjorkman, S., & Taylor, H. S. (2019). microRNAs in endometriosis: Biological\nfunction and emerging biomarker candidates. Biology of Reproduction , 100,\n1135–1146.\nChang, L., Zhang, D., Shi, H., Bian, Y., & Guo, R. (2017). MiR-143 inhibits\nendometrial cancer cell proliferation and metastasis by targeting MAPK1.\nOncotarget, 8, 84384–84395.\nChen, X., Jiang, Y., & Pan, D. (2017). miR-30c may serve a role in endometrio-\nsis by targeting plasminogen activator inhibitor-1. Experimental and\nTherapeutic Medicine, 14, 4846–4852.\nChen, Y.-J., Li, H.-Y., Huang, C.-H., Twu, N.-F., Yen, M.-S., Wang, P.-H.,\nChou, T.-Y., Liu, Y.-N., Chao, K.-C., & Yang, M.-H. (2010). Oestrogen-\ninduced epithelial-mesenchymal transition of endometrial epithelial cells\ncontributes to the development of adenomyosis. The Journal of Pathology ,\n222, 261–270.\nDai, L., & Di, W.(2011). Role of microRNA in the occurrence and development\nof endometriosis. Zhonghua fu chan ke za zhi , 46, 304–306.\nDong, P.-X., Jia, N., Xu, Z.-J., Liu, Y.-T., Li, D.-J., & Feng, Y.-J. (2008).\nSilencing of IQGAP1 by shRNA inhibits the invasion of ovarian carcinoma\nHO-8910PM cells in vitro. Journal of Experimental & Clinical Cancer\nResearch, 27, 77.\nErkilinç, S., Taylan, E., Gülseren, V., Erkilinç, G., Karadeniz, T., Ba ğci, M.,\nTemel, O., Solmaz, U., Gökçü, M., & Sanci, M. (2018). The effect of adeno-\nmyosis in myometrial invasion and overall survival in endometrial cancer.\nInternational Journal of Gynecological Cancer , 28, 145–151.\nGao, Y., Deng, K., Liu, X., Dai, M., Chen, X., Chen, J., Chen, J., Huang, Y.,\nDai, S., & Chen, J. (2019). Molecular mechanism and role of microRNA-93\nin human cancers: A study based on bioinformatics analysis, meta-analysis,\nand quantitative polymerase chain reaction validation. Journal of Cellular\nBiochemistry, 120, 6370–6383.\nGuo, Y., Lang, X., Lu, Z., Wang, J., Li, T., Liao, Y., Jia, C., Zhao, W., &\nFang, H.\n(2015). MiR-10b directly targets ZEB1 and PIK3CA to curb\nadenomyotic epithelial cell invasiveness via up-regulation of E-cadherin\nand inhibition of Akt phosphorylation. Cellular Physiology and\nBiochemistry, 35, 2169–2180.\nHoefen, R. J., & Berk, B. C. (2002). The role of MAP kinases in endothelial\nactivation. Vascular Pharmacology, 38, 271–273.\nHu, H., Li, H., & He, Y. (2017). MicroRNA-17 downregulates expression of the\nPTEN gene to promote the occurrence and development of adenomyosis.\nExperimental and Therapeutic Medicine , 14, 3805–3811.\nHuang, X., Huang, Q., Chen, S., Zhang, J., Lin, K., & Zhang, X. (2015).\nEfficacy of laparoscopic adenomyomectomy using double-flap method for\ndiffuse uterine adenomyosis. BMC Women’s Health, 15, 24.\nI b r a h i m ,M .G . ,C h i a n t e r a ,V . ,F r a n g i n i ,S . ,Y o u n e s ,S . ,K ö h l e r ,C . ,T a u b e ,E .T . ,\nPlendl, J., & Mechsner, S.(2015). Ultramicro-trauma in the endometrial-myo-\nmetrial junctional zone and pale cell migration in adenomyosis. Fertility and\nSterility, 104,1 4 7 5–1483.\nIrani, S., & Hussain, M. M.(2015). Role of microRNA-30c in lipid metabolism,\nadipogenesis, cardiac remodeling and cancer. Current Opinion in Lipidology,\n26, 139–146.\nJuang, C. M., Chou, P., Yen, M. S., Twu, N. F., Horng, H. C., & Hsu, W. L.\n(2007). Adenomyosis and risk of preterm delivery. BJOG, 114, 165–169.\nLevy, G., Dehaene, A., Laurent, N., Lernout, M., Collinet, P., Lucot, J. P.,\nLions, C., & Poncelet, E. (2013). An update on adenomyosis. Diagnostic\nand Interventional Imaging , 94,3 –25.\nLeyendecker, G., Wildt, L., & Mall, G. (2009). The pathophysiology of endo-\nmetriosis and adenomyosis: Tissue injury and repair. Archives of Gynecology\nand Obstetrics, 280, 529–538.\nLi, Q., Chen, M., Liu, H., Yang, L., Yang, T., & He, G. (2014). The dual role of\nERK signaling in the apoptosis of neurons. Frontiers in Bioscience , 19,\n1411–1417.\nLin, S.-C., Wang, C.-C., Wu, M.-H., Yang, S.-H., Li, Y.-H., & Tsai, S.-J.\n(2012). Hypoxia-induced microR NA-20a expression increases ERK\nphosphorylation and angiogenic gene expression in endometriotic\nstromal cells. The Journal of Clinical Endocrinology and Metabolism ,\n97, E1515 –E1523.\nOhlsson Teague, E. M., Van der Hoek, K. H., Van der Hoek, M. B., Perry, N.,\nWagaarachchi, P., Robertson, S. A., Print, C. G., & Hull, L. M. (2009).\nMicroRNA-regulated pathways associated with endometriosis. Molecular\nEndocrinology, 23, 265–275.\nSenturk, L. M., & Imamoglu, M. (2015). Adenomyosis: What is new? Women’s\nHealth, 11, 717 –724.\nSimonson, B., & Das, S. (2015). MicroRNA therapeutics: The next magic bul-\nlet? Mini Reviews in Medicinal Chemistry , 15, 467 –474.\nSun, Y., Liu, W.-Z., Liu T, Feng, X., Yang, N., & Zhou, H. F. (2015). Signaling\npathway of MAPK/ERK in cell proliferation, differentiation, migration, sen-\nescence and apoptosis. Journal of Receptor and Signal Transduction Research,\n35, 600–604.\nTian, X., Xu, L., & Wang, P. (2015). MiR-191 inhibits TNF-alpha induced\napoptosis of ovarian endometriosis and endometrioid carcinoma cells by tar-\ngeting DAPK1. International Journal of Clinical and Experimental Pathology,\n8, 4933–4942.\nTu, C., Wang, F., & Wan, J. (2018). MicroRNA-381 inhibits cell proliferation\nand invasion in endometrial carcinoma by targeting the IGF-1R. Molecular\nMedicine Reports, 17, 4090–4098.\nVannuccini, S., Tosti, C., Carmona, F., Huang, S. J., Chapron, C., Guo, S. W.,\nPetraglia, F. (2017). Pathogenesis of adenomyosis: An update on molecular\nmechanisms. Reproductive Biomedicine Online , 35, 592 –601.\nWainstein, E., & Seger, R.(2016). The dynamic subcellular localization of ERK:\nmechanisms of translocation and role in various organelles. Current Opinion\nin Cell Biology , 39,1 5–20.\nXu, T.-X., Zhao, S.-Z., Dong, M., & Yu, X.-R. (2016). Hypoxia responsive\nmiR-210 promotes cell survival and autophagy of endometriotic cells in\nhypoxia. European Review for Medical and Pharmacological Sciences , 20,\n399–406.\nXu, X., Kong, X., Liu, T., Zhou, L., Wu, J., Fu, J., Wang, Y., Zhu, M., Yao, S.,\nDing, Y., Ding, L., Li, R., Zhu, X., Tang, X., Zhang, Y., Yang, Q., Ling, J., &\nZhou, H. (2019). Metastasis-associated protein 1, modulated by miR-30c,\npromotes endometrial cancer progression through AKT/mTOR/4E-BP1\npathway.\nGynecologic Oncology, 154, 207–217.\nZhang, L., Rees, M. C., & Bicknell, R. (1995). The isolation and long-term cul-\nture of normal human endometrial epithelium and stroma. Expression of\nmRNAs for angiogenic polypeptides basally and on oestrogen and progester-\none challenges. Journal of Cell Science , 108, 323–331.\nZ h o u ,H . ,X u ,X . ,X u n ,Q . ,Y u ,D . ,L i n g ,J . ,G u o ,F . ,Y a n ,Y . ,S h i ,J . ,\n&H u ,Y . (2012). microRNA-30c negatively regulates endometrial cancer\ncells by targeting metasta sis-associated gene-1. Oncology Reports , 27,\n807–812.\n28 Airong Zhang et al.\nhttps://doi.org/10.1017/thg.2021.11 Published online by Cambridge University Press","source_license":"CC0","license_restricted":false}