Macrophage-derived Netrin-1 participates in endometriosis-associated pain

preprint OA: green CC0
AI-generated summary by claude@2026-06, 2026-06-08

This study found increased Netrin-1 in endometriosis patients' serum and lesions, correlating with pain, and Netrin-1 is produced by M1 macrophages within endometriotic lesions.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

AI-generated deep summary by claude@2026-06, 2026-06-10 · read from full text

This preprint investigated whether macrophage-derived Netrin-1 contributes to endometriosis-associated pain by comparing women with endometriosis (n=37) versus controls without endometriosis (n=23) using serum, peritoneal fluid, and endometrial tissue analyses. The study found higher Netrin-1 levels in serum and in endometriotic lesions in the endometriosis group, and these levels correlated with pain symptoms; Netrin-1 was co-expressed with the macrophage marker CD68, and in vitro Netrin-1 was synthesized and secreted by THP-1 and NR8383 cells during M1 polarization induced by LPS/IFN-γ. In endometriotic lesions, DCC and A2BAR were increased while UNC5B, UNC5C, and DSCAM were decreased. A key limitation is that the work is a non-peer-reviewed preprint and relies on observational patient comparisons plus in vitro macrophage polarization rather than direct in vivo functional testing of Netrin-1 in pain. This paper is centrally about endometriosis — it directly tests the role of macrophage-derived Netrin-1 and its receptors in endometriosis-associated pain.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Abstract Background: Endometriosis is a common disease in reproductive-age women and usually causes pelvic pain. Endometriosis pain is considered as a kind of neuropathic pain and infiltrating nerve fiber in endometriotic lesions may play an important role. Netrin-1 is widely reported as an axon guidance cue that regulates axonal attraction or rejection in neural injury and regeneration. In this study, we aim to determine the role of Netrin-1 in endometriosis-related pain. Methods: Peripheral blood, peritoneal fluid, and endometrial tissues were sampled from women with (n=37) and without (n=23) endometriosis. Serum Netrin-1 concentrations, endometrial expression levels of Netrin-1 and its receptors including DCC, A2BAR, UNC5B, UNC5C and DSCAM were assessed. The polarization phenotypes of the peritoneal macrophages were identified by detecting the marker expression of M1 (CD86+) /M2 (CD163+) macrophages via flow cytometry. Lipopolysaccharide (LPS) and interferon gamma (IFN-γ) stimulated human monocytic cell line (THP-1) and rat alveolar macrophage-derived cell line (NR8383) cells to induce M1 phenotype macrophages. The expression levels of M1 markers and Netrin-1 in THP-1/NR8383 cells were determined. Results: The expression levels of Netrin-1 in serum and endometriotic lesions were significantly higher in women with endometriosis when compared with those in women without endometriosis (P<.05), and both were correlated with pain symptoms (P<.05). Netrin-1 was co-expressed with CD 68 (a macrophage marker) in endometriotic lesions, and was synthesized and secreted by THP-1 and NR8383 cells in process of M1 polarization. In women with endometriosis, peritoneal macrophages were polarized towards M1 phenotype. In addition, increased expression of DCC and A2BAR, and decreased expression of UNC5B, UNC5C and DSCAM in endometriotic lesions were found. Conclusions: These results suggest that Netrin-1 production by macrophages in endometriotic lesions may play an important role in endometriosis pain.
Full text 164,789 characters · extracted from preprint-html · click to expand
Macrophage-derived Netrin-1 participates in endometriosis-associated pain | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Macrophage-derived Netrin-1 participates in endometriosis-associated pain Shaojie Ding, Xinyue Guo, Libo Zhu, Jianzhang Wang, Tiantian Li, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.2.17387/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background: Endometriosis is a common disease in reproductive-age women and usually causes pelvic pain. Endometriosis pain is considered as a kind of neuropathic pain and infiltrating nerve fiber in endometriotic lesions may play an important role. Netrin-1 is widely reported as an axon guidance cue that regulates axonal attraction or rejection in neural injury and regeneration. In this study, we aim to determine the role of Netrin-1 in endometriosis-related pain. Methods: Peripheral blood, peritoneal fluid, and endometrial tissues were sampled from women with (n=37) and without (n=23) endometriosis. Serum Netrin-1 concentrations, endometrial expression levels of Netrin-1 and its receptors including DCC, A2BAR, UNC5B, UNC5C and DSCAM were assessed. The polarization phenotypes of the peritoneal macrophages were identified by detecting the marker expression of M1 (CD86+) /M2 (CD163+) macrophages via flow cytometry. Lipopolysaccharide (LPS) and interferon gamma (IFN-γ) stimulated human monocytic cell line (THP-1) and rat alveolar macrophage-derived cell line (NR8383) cells to induce M1 phenotype macrophages. The expression levels of M1 markers and Netrin-1 in THP-1/NR8383 cells were determined. Results: The expression levels of Netrin-1 in serum and endometriotic lesions were significantly higher in women with endometriosis when compared with those in women without endometriosis (P<.05), and both were correlated with pain symptoms (P<.05). Netrin-1 was co-expressed with CD 68 (a macrophage marker) in endometriotic lesions, and was synthesized and secreted by THP-1 and NR8383 cells in process of M1 polarization. In women with endometriosis, peritoneal macrophages were polarized towards M1 phenotype. In addition, increased expression of DCC and A2BAR, and decreased expression of UNC5B, UNC5C and DSCAM in endometriotic lesions were found. Conclusions: These results suggest that Netrin-1 production by macrophages in endometriotic lesions may play an important role in endometriosis pain. Neurobiology of Disease Endometriosis pain Netrin-1 macrophage polarization Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Background Endometriosis is a common gynecological disease among women of childbearing age, characterized by pain and infertility [ 1 ]. Pain symptoms in patients with endometriosis include dysmenorrhea, dyspareunia, dysuria, defecation pain and chronic pelvic pain, which have a significant impact on women’s quality of life [ 2 ]. However, the exact mechanisms of endometriosis-associated pain remain unclear up to date despite extensive research efforts [ 3 , 4 ]. In 2000, Anaf et al. firstly reported S100-labeled nerves infiltrating in endometriotic lesions, and the percentages of nerves were significantly higher in the lesions of women suffered from severe endometriosis pain [ 5 ]. In subsequent studies, elevated specific makers for sensory, sympathetic, and parasympathetic nerves [ 6–8 ] and growth factors such as nerve growth factor (NGF), brain derived neurotrophic factor (BDNF) and neurite growth factor 2 (NEGF2) [ 9–11 ] were identified in different types of endometriotic lesions, which were correlated with endometriosis pain. Obviously, endometriosis pain may be considered as a kind of neuropathic pain. Moreover, in a rat model of endometriosis, auto-transplanted endometriotic lesions developed autonomic and sensory innervation [ 12 ]. Growth-associated protein 43 (GAP–43), a marker for neurite outgrowth and regeneration, was expressed in nerve fibers infiltrating in the endometriotic lesions of peritoneal and deep infiltrating endometriosis [ 13 , 14 ]. However, it is still unclear how the nerve fibers in endometriotic lesions sprout abnormally. Netrins is a member of the laminin superfamily and has a similar amino acid terminal sequence [ 15 ]. The name Netrin is derived from the Sanskrit Netr, meaning ‘guide’ as its role in axon guidance [ 16 ]. Until now, three secreted Netrins (Netrins 1, 3 and 4), and two glycosylphosphatidylinositol-anchored membrane proteins, Netrins G1 and G2, have been identified in mammals. Netrin Gs regulate axon guidance by forming synaptic interactions between neurons with the transmembrane Netrin G ligands NGL1 and 2. The secreted Netrins can bind to the receptors of Deleted in Colorectal Cancer (DCC), neogenin or Uncoordinated (UNC5) A–D, causing axonal attraction or rejection [ 17 , 18 ]. Recent studies have shown that Netrins also participate in angiogenesis, cell proliferation, migration and tumorigenesis by binding to the receptors of DCC, neogenin, UNC5, Down’s syndrome cell adhesion molecule (DSCAM), CD146 and A2B adenosine receptor (A2BAR) [ 19–22 ]. It has been demonstrated that Netrin–1, the most studied guidance cue, triggers attraction effect through DCC and neogenin, or repulsion effect via UNC5 A-D [ 15 ]. In the central nerve system, Netrin 1 is secreted by ventricular zone neural progenitors and floor-plate cells in the ventral embryonic spinal cord [ 23 , 24 ]. In the process of peripheral neural injury and regeneration, increased levels of Netrin–1 are mainly produced by Schwann cells [ 25 ]. Netrin–1 expression was increased in hypoxia conditions [ 22 ], inflammation and various diseases such as obesity [ 26 ], type 2 diabetes [ 27 ], acute lung injury [ 28 ], atherosclerosis [ 29 ] and abdominal aortic aneurysm (AAA) [ 30 ]. However, it is not clear whether Netrin–1 is involved in the pathogenesis of endometriosis. Co-localization of Netrin–1 and CD68, a marker of macrophage, is identified in atherosclerotic plaques [ 29 ], adipose tissues [ 26 ] and inflamed aortic vessel wall [ 30 ], suggesting that macrophages may participate in inflammation by secreting Netrin–1. In fact, the inflammatory microenvironment of endometriosis can promote macrophage infiltration [ 31 , 32 ], which play a crucial role in the etiology and pathogenesis of this disease including inflammatory response [ 33 ], angiogenesis [ 32 ], proliferation [ 34 ] and neurogenesis [ 35 ]. The interaction between macrophages and nerve fibers contributes to neuroinflammation and pain generation in endometriosis [ 35 ]. A large number of up-regulated molecules released by nerve fibers in endometriotic lesions such as monocyte chemotactic protein–1 (MCP–1), colony-stimulating factor 1 (CSF–1) and leukemia inhibitory factor (LIF), are responsible for the recruitment of macrophages from vessels within the lesions [ 36 , 37 ]. On the other hand, infiltrated macrophages in the lesions in turn mediate neurogenesis by secreting neurotrophins, semaphorins, and vascular epithelial growth factor (VEGF) [ 35 , 37 , 38 ]. Although macrophage activation is closely related to endometriosis, yet, macrophages differentiate into classically activated macrophages (pro-inflammatory, M1) or alternatively activated macrophages (anti-inflammatory, M2) [ 39 ], and the polarization of M1/M2 macrophages in endometriosis remains highly debated [ 31 , 32 , 40 , 41 ], Therefore, it is necessary to explore the role of macrophage-mediated Netrin–1 in the pathogenesis of endometriosis. In the present study, we aimed to investigate the role of Netrin–1 mediated by macrophages in endometriosis-associated pain. To do so, we firstly detected expressions of Netrin–1 and its receptors in endometriotic lesions. Secondly, we localized Netrin–1 and macrophages in endometriotic lesions. Thirdly, we determined polarization phenotypes of peritoneal macrophages. Finally, we observed the expression and secretion of Netrin–1 after macrophage M1 polarization was induced in vitro. Methods Patients A total of 60 women with (case group, n=37) and without endometriosis (other benign gynecologic diseases, control group, n=23) undergoing laparoscopic surgery at the Women’s Hospital between January 2018 and June 2018 were recruited in this study. In endometriosis group, 17 women were at stage I-II while 20 of them were at stage III-IV, according to the Revised American Fertility Society Scoring system. Pain symptoms were observed in 48.6% (n = 18) and 0% (n = 0) of the endometriosis and non-endometriosis group, while infertility was 24.3% (n = 9) and 17.4% (n = 4), respectively. None of participants have received hormone therapy 6 month before surgery. Samples Collection Peripheral blood samples were obtained 1 day before the surgery while endometriotic lesions and endometrial tissues were collected during the surgical procedure. The bloods or cell supernatants were centrifuged at 1000 g for 10 minutes, and the supernatants was transferred into 1.5 mL tubes and stored at -80°C until processing. Half of the endometrial tissue was frozen in -80°C for mRNA detection, and the other half was immersed in formalin (Solarbio) for further immunohistochemical and immunofluorescence staining. ELISA The concentrations of Netrin-1 in serum or culture supernatants were quantified by ELISA kits (Cusabio) according to the manufacturer's instructions. qRT-PCR and Western blot analyses Total RNA was extracted from endometrial samples or cells with TRIzol reagent (Takara) and reversed by PrimeScript Reverse Transcription (RT) reagent kit (Takara) according to the manufacturer's recommendations. SYBR Premix Ex Taq kit (Takara) was used to quantitative polymerase chain reaction (PCR) and the fold change was determined through 2 - △ △ Ct method. The primers for Netrin-1, receptors and inflammatory factors were synthesized from Generay and the sequences were listed in Table 1 and Table 2. Western blot analysis was used to test Netrin-1 protein expression levels with Netrin-1 antibody (Abcam) in THP-1 and NR8383 cells in M1 polarization process. Immuno hi stochemical Staining Specific antibody of Netrin-1 (Abcam), DCC (Bioss), UNC5B (Bioss) and A2BAR (Invitrogen) were used to access the expression levels and localization of Netrin-1 and its receptors in endometrial tissues by immunohistochemistry (IHC). The sum of the percentage (0-3) and intensity scores (0-3) were represented as IHC scores to show the expression levels of molecule. Detailed immunohistochemical process and scoring were described before [ 10 ]. Double Immunofluorescence Staining Slides of endometriotic lesions were incubated with primary antibody of Netrin-1 and CD68 (Abcam), and then were rinsed in PBS before mounted with corresponding fluorescent secondary antibody (Abcam). Flow cytometric analysis Peritoneal macrophages were washed with erythrocyte lysis buffer and incubated with Human Fc Block (BD Biosciences) on ice. Subsequently, the cells were incubated PE-Cy TM 7-conjugated anti-CD86 (BD Biosciences), and PE-conjugated anti-CD163 (BD Biosciences) antibody for 15 min. For intracellular staining, the cells were fixed and permeabilized in Fixation and Permeabilization Solution (BD Biosciences) for 20 min, and incubated with FITC-conjugated anti-CD68 (BD Biosciences) antibody for 1 h. The samples were then analyzed with a FACS Verse system and analyzed with BD FACS DIVA software (BD Biosciences, United States). PE-Cy TM 7-conjugated IgG1, PE-conjugated IgG1 and FITC-conjugated IgG2b (BD Biosciences) antibody served as control antibodies. CD68+CD86+CD163- macrophages were identified as M1 macrophages, while CD68+CD86-CD163+ cells were identified as M2 macrophages. Cells Intervention Human monocytic cell line THP-1 and rat alveolar macrophage-derived cell line NR8383 cells were purchased from Stem Cell Bank, Chinese Academy of Sciences. Cells were cultured with Dulbecco's modified Eagle Medium/F-12 containing 15% fetal calf sera (Gibco). THP-1 cells were induced to macrophages (M0) by phorbol-12-myristate-13-acetate (PMA, 20 ng/mL, Sigma). Then, differentiated human THP-1 macrophages and NR8383 cells were treated with lipopolysaccharide (LPS, 20 ng/mL, Sigma) and interferon gamma (IFN-γ, 20 ng/mL, Peprotech) to further induce M1 phenotype macrophages. Then expression levels of M1 phenotype markers tumor necrosis factor alpha (TNF)-α, interleukin (IL)-1β, IL-6, MCP-1 and nitric oxide synthase 2 (iNOS) were assessed at 1 h, 3 h, 6 h, 12 h, 24 h and 48 h after stimulation. Meanwhile, mRNA and protein expression levels of Netrin-1 as well as secreted Netrin-1 levels in cell supernatants were measured using qRT-PCR, Western blot and ELISA respectively. Statistics Data were analyzed using SPSS Version 24.0 (IBM). The continuous data variables were quantified as mean ± SEM. Differences in variables between two groups and multiple groups were analyzed using unpaired Student t test and one-way ANOVA, respectively. Nonparametric testing was used where sample sizes were insufficient to confirm normality of data distribution. Statistical tests (χ2 and Mann-Whitney U test) were performed to compare the frequency and median among groups. P values of <.05 were considered statistically significant. Results Characteristics of the Patient There were no significant differences between endometriosis group and non-endometriosis group with respect to their age, gravidity, parity, abortion, infertility, or cycle stage, except for pain symptoms (Table 3). Netrin–1 concentrations in serum is associated with endometriosis pain in the patients The serum concentrations of Netrin–1 in endometriosis women were significantly higher than those from women without endometriosis ( P <.05, Fig. 1A), and were correlated with endometriosis pain ( P <.05, Fig. 1B). Netrin–1 was over-expressed in endometriotic lesions Netrin–1 was not only expressed in epithelial and interstitial vascular endothelial cells, but also expressed in endometrial stromal cells in endometriotic lesions from endometriosis women with (Fig. 1E) or without (Fig. 1F) pain, and in endothelial cells in eutopic endometrium from women with (Fig. 1G) or without (Fig. 1H) endometriosis. The mRNA expression levels of Netrin–1 in endometriotic lesions were significantly higher than those in eutopic endometrium from women with (p<.01, Fig. 1C; p<.01) or without endometriosis (p<.01, Fig. 1C; p<.00001), and both were correlated with endometriosis pain (p<.01, Fig. 1D; p<.01). Moreover, Netrin–1 was co-expressed with CD 68 in endometriotic lesions (Fig. 1I-L). Endometriosis polarizes peritoneal macrophages towards the M1 phenotype CD68+ cells were recognized as peritoneal macrophage in women with endometriosis (Fig. 2 A, C) or without endometriosis (Fig. 2 B, D). Flow cytometry plots revealed a significantly higher proportion of M2 macrophages (CD86-CD163+) in non-endometriosis women compared to endometriosis women (Fig. 3C). The proportion of M1 macrophages (CD68+CD163-) was high in endometriosis women, but it did not reach statistical significance (Fig. 3A). In short, the proportion of CD86+ macrophages significantly increased in endometriosis patients compared with those without endometriosis, while the proportion of CD163+ macrophages did not differ (Fig. 3E, F). Netrin–1 was secreted by Macrophages PMA treatment induced significantly higher mRNA expression levels of IL–1β ( P <.01), IL–6 ( P <.05), iNOS ( P <.01) and lower TNF-α ( P .05) and Netrin–1 ( P >.05) mRNA expression levels in human THP–1 macrophages compared with untreated monocytic THP–1 cells. Then, mRNA expression levels of M1 phenotype markers TNF-α, IL–1β, IL–6, MCP–1 and iNOS were all significantly elevated after combined stimulation of LPS and IFN-γ within 48 h, reaching their pecks at 1 h ( P <.05; Fig. 4A), 1 h ( P <.01; Fig. 4B), 6 h ( P <.01; Fig. 4C), 24 h ( P <.01; Fig. 4D) and 48 h ( P <.01; Fig. 4E), respectively. The mRNA, protein expression levels and supernatant concentrations of Netrin–1 in PMA-differentiated human THP–1 macrophages were significantly higher at 12 h ( P <.05; Fig. 4F), 24 h ( P <.05; Fig. 4G) and 48 h ( P <.01; Fig. 4H) respectively after M1 polarization. In NR8383 cell line, the mRNA expression levels of TNF-α, IL–1β, IL–6, MCP–1 and iNOS all increased with 48 h after LPS and IFN-γ treatment, reaching their peck at 6 h ( P <.01; Fig. 4I), 6 h ( P <.05; Fig. 4J), 3 h ( P <.05; Fig. 4K), 6 h ( P <.05; Fig. 4L) and 12 h ( P <.05; Fig. 4M), respectively. Meanwhile, the mRNA and protein levels as well as supernatant concentrations of Netrin–1 in NR8383 cells were significantly elevated at 12 h ( P <.05; Fig. 4N), 24 h ( P <.05; Fig. 4O) and 48 h ( P <.0001; Fig. 4P) respectively after M1 polarization. Netrin–1 receptors was more expressed in endometriotic tissues The mRNA expression levels of DCC and A2BAR in endometriotic lesions were significantly higher than those in eutopic endometrium from women with ( P <.01; P <.05) or without ( P <.01; P <.01) endometriosis (Fig. 5A, I). On the contrary, UNC5B, UNC5C and DSCAM mRNA expression levels in endometriotic lesions were significantly lower than those in eutopic endometrium form women with ( P <.01; P <.0001; P <.01) or without ( P <.0001; P <.0001; P <.01) endometriosis (Fig. 5D, E, G). Eutopic endometrium from endometriosis women also showed a significantly higher UNC5C mRNA expression levels than those from non-endometriosis women ( P <.05; Fig. 5E). No statistical differences in UNC5A, UNC5B or CD146 mRNA expression levels among endometriotic lesions and eutopic endometrium from women with or without endometriosis were found (Fig. 5C, F, H). Immunohistochemistry results showed that DCC was mainly expressed in epithelial and stromal cells and interstitium in endometriotic lesions (Fig. 6A-C), and showed a higher IHC score in endometriotic lesions than those in eutopic endometrium form women with or without endometriosis ( P <.0001). UNC5B was mainly expressed in glandular epithelial cells (Fig. 6D-F) and was less expressed in endometriotic lesions than those in eutopic endometrium from women with ( P <.01) or without ( P <.05) endometriosis. A2BAR was widely expressed in endometriotic lesions (Fig. 6G-I), and the IHC scores were higher than those in eutopic endometrium from endometriosis ( P <.05) and non-endometriosis ( P <.05) women. Discussion This study demonstrated that Netrin–1 increased in serum and endometriotic lesions in endometriosis women. Since Netrin–1 is an axon guide molecule, we speculate that Netrin–1 mediates endometriosis pain by promoting nerve fiber infiltration in endometriotic lesions. Actually, Netrin–1 has bi-functionality on axonal guidance. It has been reported that Netrin–1 leads to axon attraction binding to DCC receptor or repulsion binding to UNC5A–D receptors in the same cells [ 15 ]. Neogenin, DSCAM and CD146 also show promoting effect on axon extension [ 18 ]. The bi-functionality on axon guidance is based on the crystal structure of Netrin–1 and its receptors [ 42 ]. Besides, cross-link with different receptor types and the charge changes on Netrin–1 and receptors also determine promotion or inhibition of Netrin–1 in axon guidance [ 18 ]. Our study demonstrated that endometriotic lesions showed a significantly higher expressions levels of DCC, neogenin and lower expression levels of UNC5B and UNC5C compared with eutopic endometrium, which further supported that Netrin–1 is responsible for endometriosis pain by promoting nerve infiltration in endometriotic lesions. Dorsal root ganglion (DRG) neurons express DCC, neogenin and UNC5A–D receptors [ 43 ]. In a rat model of sciatic nerve transection, the expression of DCC receptor is up-regulated while the expression of UNC5B and UNC5C is down-regulated in sensory neurons [ 43 ]. Transplantation of Netrin–1 overexpression bone marrow mesenchymal stem cells promotes axon regeneration and functional recovery of the sciatic nerve after crush injury [ 44 ]. However, Netrin–1 treatment (500 ng/mL) inhibits neurite outgrowth of adult DRG neurons in explant and dissociated cultures, which may be mediated by UNC5A-C receptors on DRG [ 45 ]. Thus, the effect of Netrin–1 on Nerve outgrowth is complex and the mechanism of Netrin–1 involved in endometriosis pain remains to be further studied. M1 macrophages, activated by IFN-γ, LPS or TNF-α, participate in tissue injury, inflammatory and immune responses by producing pro-inflammatory cytokines and chemokines [ 46 ]. In contrast, M2 macrophages can be activated by IL–4, IL–10, IL–13, or transforming growth factor-β (TGF-β), thus participating in tissue repair tumor angiogenesis and vessel normalization [ 47 ]. In endometriosis, several studies have reported that the macrophages in women with endometriosis are predominantly of M2 phenotype (CD163+/CD206+), which play an important role in the development of endometriosis [ 31 , 41 , 48–50 ]. As endometriosis is an estrogen-dependent disease, it has been reported that estrogen promotes M2 polarization through activation of the signal transducers and activators of transcription (STAT3) and P38-mitogen activated protein kinases (MAPK) pathway [ 51 , 52 ]. However, another study shows opposed result that 17β-estradiol represses suppressor for M2 polarization via inhibiting the JAK1-STAT6 signaling pathway [ 53 ]. Takebayashi et al. have reported that macrophage population slants toward M1 in the endometrium of endometriosis patients due to significantly lower ratio of the number of CD163+ or CD206+ macrophages to CD68+ macrophages [ 40 ]. In this study, we found that the peritoneal macrophages of endometriosis were mainly of CD86+CD163+ type, while those of non-endometriosis women were mainly of CD86-CD163+ type (M2). The percentage of CD86+ macrophages in endometriosis women was significantly higher than that in control group, which displayed a unique M1/M2 polarization signature that was skewed towards the classical M1 activation phenotype. This was consistent with the subsequent results of experiments in vitro that M1 polarization induced up-regulation of Netrin–1 synthesis and secretion in human and rat cell line. A recent study also has reported that Netrn–1 enriched macrophages are those that highly expressed pro-inflammatory markers as Netrin–1 mRNA expression levels are increased in CD68+/CD206− pro-inflammatory phenotypes rather than CD68+/CD206+ samples [ 30 ]. Actually, polarization is a dynamic process as the signals are temporally and dynamic, and the use of terms M1 and M2 is confusing due to the lack of specific phenotypic scoring criteria [ 54 , 55 ]. Many physiological or pathological macrophages did not show a clear M1 or M2 phenotype [ 56 ], or macrophages with combinations of M1 and M2 markers can be found during M1/M2 polarization [ 57 , 58 ]. New methods and technical advances are needed to reassess activation and classification of macrophage. Netrin–1 gene is a direct transcriptional target of nuclear factor (NF)-κB, which up-regulates Netrin–1 in colorectal carcinoma and mammary epithelial cells in response to inflammation [ 59 ]. However, another study has reported that activation of NF-κB represses Netrin–1 expression levels in adenocarcinomic alveolar epithelial cells and dermal microvessel endothelial cells [ 28 ]. Actually, macrophages from endometriosis patients show a statistically significant higher proportion of NF-κB nuclear translocation, and release various cytokines, growth factors and angiogenic factors to participate in endometrial fragment adhesion, proliferation and neovascularization [ 33 ]. Since we only tested cell lines in vitro, primary macrophages from endometriosis women are more valuable depending on the amount of cytokine, time of exposure, and the competition for cytokine [ 54 ]. Thus, the regulatory mechanism of Netrin–1 in endometriosis macrophages needs to be further studied. Netrin–1 also plays a role in angiogenesis, cell migration, cell proliferation and cell survival. The present study confirmed the higher expression of Netrin–1, constant expression of CD146 and lower expression of UNC5B in endometriotic lesions. Netrin–1 enriched macrophages also highly express pro-angiogenic markers [ 30 ] and treatment of Netrin–1 with low doses (50–200 ng/mL) on endothelial cells promotes proliferation, migration and tube formation via binds to high affinity receptor CD146 [ 19 ]. However, high concentrations of Netrin–1 (1000–2000 ng/mL) inhibit the above effects, possibly via UNC5B signaling pathway [ 19 ]. In endometriosis, nerve fibers are accompanied by immature blood vessels within endometriotic lesions [ 13 ]. Netrin–1 also dose-dependently regulates cell migration of Schwan cell, endothelial cell via activating or inhibiting MAPK pathway by CD146 or UNC5B receptor [ 19 , 60 , 61 ]. In inflammatory, it has been reported that Netrin–1 in endothelial cells inhibits inflammatory cell migration, such as leukocyte and macrophage [ 30 , 62 , 63 ]. This may be an anti-inflammatory response in the body, but it can lead to the accumulation of inflammatory cells in the lesions, resulting in AAA or atherosclerosis [ 29 , 30 ]. In endometriosis, macrophage retention in endometriotic lesions increases the local concentration of Netrin–1, which may play a role in the infiltration of nerve fibers. In tumorigenesis, Netrin–1 promotes cell survival, proliferation, invasion and migration in different types of cancer, such as prostate carcinoma, hepatocellular carcinoma, gastric cancer and breast cancer [ 64–67 ]. Although endometriosis is a benign gynecological disease, it has malignant behaviors in adhesion, proliferation, invasion, metastasis and recurrence [ 68–71 ]. Thus, elevated Netrin–1 may be also involved in the growth of endometriotic lesions. Conclusions In summary, the present study indicated that increased Netrin–1 in women with endometriosis may participate in endometriosis pain. Target therapy toward Netrin–1 and macrophages may not only interfere with the process of endometriosis pain, but also inhibit the progression of endometriosis. Abbreviations LPS: Lipopolysaccharide; IFN-γ: interferon gamma; NGF: nerve growth factor; BDNF: brain derived neurotrophic factor; NEGF2: neurite growth factor 2; GAP–43: Growth-associated protein 43; DCC: deleted in colorectal cancer; UNC5: uncoordinated; DSCAM: Down’s syndrome cell adhesion molecule; A2BAR: A2B adenosine receptor; AAA: abdominal aortic aneurysm; MCP–1: monocyte chemotactic protein–1; CSF–1: colony-stimulating factor 1; LIF: leukemia inhibitory factor; VEGF: vascular epithelial growth factor; TNF-α: tumor necrosis factor alpha; IL: interleukin; iNOS: nitric oxide synthase 2; DRG: dorsal root ganglion; TGF-β: transforming growth factor-β; MAPK: mitogen activated protein kinases. Declarations Acknowledgements We would like to acknowledge the skillful work of Qi Cheng in the running of ELISA measurements and the assistance of immunohistochemical facility of Caiyun Zhou. Authors’ contributions S. D., J.W and X. Z. designed research studies. S. D. and X. G. performed the majority of the experiment. L. Z., T. L. and Q. Y. acquired and analyzed data. S. D. and X. G. wrote the manuscript. J. W. and X. Z. edited the manuscript. Funding: This work was funded by National Key R&D Program of China (No. 2017YFC1001202) and National Natural Science Foundation of China (No. 81671429). Availability of data and materials The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request. Ethics approval and consent to participate This study was approved by the Human Ethics Committee of the Women’s Hospital, School of Medicine, Zhejiang University (no. 20190012). Consent for publication Written informed consent was obtained from each patient. Competing interests The authors declare that they have no competing interests. References 1.Kim JH, Han E: Endometriosis and Female Pelvic Pain. Semin Reprod Med 2018, 36: 143–151. 2.Fauconnier A, Chapron C: Endometriosis and pelvic pain: epidemiological evidence of the relationship and implications. Hum Reprod Update 2005, 11: 595–606. 3.Ferrero S, Barra F, Leone Roberti Maggiore U: Current and Emerging Therapeutics for the Management of Endometriosis. Drugs 2018, 78: 995–1012. 4.Falcone T, Flyckt R: Clinical Management of Endometriosis. Obstet Gynecol 2018, 131: 557–571. 5.Anaf V, Simon P, El Nakadi I, Fayt I, Buxant F, Simonart T, Peny MO, Noel JC: Relationship between endometriotic foci and nerves in rectovaginal endometriotic nodules. Hum Reprod 2000, 15: 1744–1750. 6.Berkley KJ, Rapkin AJ, Papka RE: The pains of endometriosis. Science 2005, 308: 1587–1589. 7.Zhang X, Yao H, Huang X, Lu B, Xu H, Zhou C: Nerve fibres in ovarian endometriotic lesions in women with ovarian endometriosis. Hum Reprod 2010, 25: 392–397. 8.McKinnon B, Bersinger NA, Wotzkow C, Mueller MD: Endometriosis-associated nerve fibers, peritoneal fluid cytokine concentrations, and pain in endometriotic lesions from different locations. Fertil Steril 2012, 97: 373–380. 9.Kajitani T, Maruyama T, Asada H, Uchida H, Oda H, Uchida S, Miyazaki K, Arase T, Ono M, Yoshimura Y: Possible involvement of nerve growth factor in dysmenorrhea and dyspareunia associated with endometriosis. Endocr J 2013, 60: 1155–1164. 10.Ding S, Zhu T, Tian Y, Xu P, Chen Z, Huang X, Zhang X: Role of Brain-Derived Neurotrophic Factor in Endometriosis Pain. Reprod Sci 2018, 25: 1045–1057. 11.Hirota Y, Osuga Y, Koga K, Yoshino O, Hirata T, Harada M, Morimoto C, Yano T, Tsutsumi O, Sakuma S, et al: Possible implication of midkine in the development of endometriosis. Hum Reprod 2005, 20: 1084–1089. 12.Berkley KJ, Dmitrieva N, Curtis KS, Papka RE: Innervation of ectopic endometrium in a rat model of endometriosis. Proc Natl Acad Sci U S A 2004, 101: 11094–11098. 13.Mechsner S, Schwarz J, Thode J, Loddenkemper C, Salomon DS, Ebert AD: Growth-associated protein 43-positive sensory nerve fibers accompanied by immature vessels are located in or near peritoneal endometriotic lesions. Fertil Steril 2007, 88: 581–587. 14.Wang G, Tokushige N, Russell P, Dubinovsky S, Markham R, Fraser IS: Hyperinnervation in intestinal deep infiltrating endometriosis. J Minim Invasive Gynecol 2009, 16: 713–719. 15.Lai Wing Sun K, Correia JP, Kennedy TE: Netrins: versatile extracellular cues with diverse functions. Development 2011, 138: 2153–2169. 16.Ishii N, Wadsworth WG, Stern BD, Culotti JG, Hedgecock EM: UNC–6, a laminin-related protein, guides cell and pioneer axon migrations in C. elegans. Neuron 1992, 9: 873–881. 17.Rajasekharan S, Kennedy TE: The netrin protein family. Genome Biol 2009, 10: 239. 18.Dun XP, Parkinson DB: Role of Netrin–1 Signaling in Nerve Regeneration. Int J Mol Sci 2017, 18. 19.Tu T, Zhang C, Yan H, Luo Y, Kong R, Wen P, Ye Z, Chen J, Feng J, Liu F, et al: CD146 acts as a novel receptor for netrin–1 in promoting angiogenesis and vascular development. Cell Res 2015, 25: 275–287. 20.Lee HK, Seo IA, Seo E, Seo SY, Lee HJ, Park HT: Netrin–1 induces proliferation of Schwann cells through Unc5b receptor. Biochem Biophys Res Commun 2007, 362: 1057–1062. 21.Grandin M, Meier M, Delcros JG, Nikodemus D, Reuten R, Patel TR, Goldschneider D, Orriss G, Krahn N, Boussouar A, et al: Structural Decoding of the Netrin–1/UNC5 Interaction and its Therapeutical Implications in Cancers. Cancer Cell 2016, 29: 173–185. 22.Rosenberger P, Schwab JM, Mirakaj V, Masekowsky E, Mager A, Morote-Garcia JC, Unertl K, Eltzschig HK: Hypoxia-inducible factor-dependent induction of netrin–1 dampens inflammation caused by hypoxia. Nat Immunol 2009, 10: 195–202. 23.Varadarajan SG, Kong JH, Phan KD, Kao TJ, Panaitof SC, Cardin J, Eltzschig H, Kania A, Novitch BG, Butler SJ: Netrin1 Produced by Neural Progenitors, Not Floor Plate Cells, Is Required for Axon Guidance in the Spinal Cord. Neuron 2017, 94: 790–799 e793. 24.Dominici C, Moreno-Bravo JA, Puiggros SR, Rappeneau Q, Rama N, Vieugue P, Bernet A, Mehlen P, Chedotal A: Floor-plate-derived netrin–1 is dispensable for commissural axon guidance. Nature 2017, 545: 350–354. 25.Madison RD, Zomorodi A, Robinson GA: Netrin–1 and peripheral nerve regeneration in the adult rat. Exp Neurol 2000, 161: 563–570. 26.Ramkhelawon B, Hennessy EJ, Menager M, Ray TD, Sheedy FJ, Hutchison S, Wanschel A, Oldebeken S, Geoffrion M, Spiro W, et al: Netrin–1 promotes adipose tissue macrophage retention and insulin resistance in obesity. Nat Med 2014, 20: 377–384. 27.Yim J, Kim G, Lee BW, Kang ES, Cha BS, Kim JH, Cho JW, Lee SG, Lee YH: Relationship Between Circulating Netrin–1 Concentration, Impaired Fasting Glucose, and Newly Diagnosed Type 2 Diabetes. Front Endocrinol (Lausanne) 2018, 9: 691. 28.Mirakaj V, Thix CA, Laucher S, Mielke C, Morote-Garcia JC, Schmit MA, Henes J, Unertl KE, Kohler D, Rosenberger P: Netrin–1 dampens pulmonary inflammation during acute lung injury. Am J Respir Crit Care Med 2010, 181: 815–824. 29.van Gils JM, Derby MC, Fernandes LR, Ramkhelawon B, Ray TD, Rayner KJ, Parathath S, Distel E, Feig JL, Alvarez-Leite JI, et al: The neuroimmune guidance cue netrin–1 promotes atherosclerosis by inhibiting the emigration of macrophages from plaques. Nat Immunol 2012, 13: 136–143. 30.Hadi T, Boytard L, Silvestro M, Alebrahim D, Jacob S, Feinstein J, Barone K, Spiro W, Hutchison S, Simon R, et al: Macrophage-derived netrin–1 promotes abdominal aortic aneurysm formation by activating MMP3 in vascular smooth muscle cells. Nat Commun 2018, 9: 5022. 31.Itoh F, Komohara Y, Takaishi K, Honda R, Tashiro H, Kyo S, Katabuchi H, Takeya M: Possible involvement of signal transducer and activator of transcription–3 in cell-cell interactions of peritoneal macrophages and endometrial stromal cells in human endometriosis. Fertil Steril 2013, 99: 1705–1713. 32.Bacci M, Capobianco A, Monno A, Cottone L, Di Puppo F, Camisa B, Mariani M, Brignole C, Ponzoni M, Ferrari S, et al: Macrophages are alternatively activated in patients with endometriosis and required for growth and vascularization of lesions in a mouse model of disease. Am J Pathol 2009, 175: 547–556. 33.Lousse JC, Van Langendonckt A, Gonzalez-Ramos R, Defrere S, Renkin E, Donnez J: Increased activation of nuclear factor-kappa B (NF-kappaB) in isolated peritoneal macrophages of patients with endometriosis. Fertil Steril 2008, 90: 217–220. 34.Gou Y, Li X, Li P, Zhang H, Xu T, Wang H, Wang B, Ma X, Jiang X, Zhang Z: Estrogen receptor beta upregulates CCL2 via NF-kappaB signaling in endometriotic stromal cells and recruits macrophages to promote the pathogenesis of endometriosis. Hum Reprod 2019. 35.Wu J, Xie H, Yao S, Liang Y: Macrophage and nerve interaction in endometriosis. J Neuroinflammation 2017, 14: 53. 36.Tofaris GK, Patterson PH, Jessen KR, Mirsky R: Denervated Schwann cells attract macrophages by secretion of leukemia inhibitory factor (LIF) and monocyte chemoattractant protein–1 in a process regulated by interleukin–6 and LIF. J Neurosci 2002, 22: 6696–6703. 37.Liang Y, Xie H, Wu J, Liu D, Yao S: Villainous role of estrogen in macrophage-nerve interaction in endometriosis. Reprod Biol Endocrinol 2018, 16: 122. 38.Cattin AL, Burden JJ, Van Emmenis L, Mackenzie FE, Hoving JJ, Garcia Calavia N, Guo Y, McLaughlin M, Rosenberg LH, Quereda V, et al: Macrophage-Induced Blood Vessels Guide Schwann Cell-Mediated Regeneration of Peripheral Nerves. Cell 2015, 162: 1127–1139. 39.Gordon S, Pluddemann A, Martinez Estrada F: Macrophage heterogeneity in tissues: phenotypic diversity and functions. Immunol Rev 2014, 262: 36–55. 40.Takebayashi A, Kimura F, Kishi Y, Ishida M, Takahashi A, Yamanaka A, Wu D, Zheng L, Takahashi K, Suginami H, Murakami T: Subpopulations of macrophages within eutopic endometrium of endometriosis patients. Am J Reprod Immunol 2015, 73: 221–231. 41.Cominelli A, Gaide Chevronnay HP, Lemoine P, Courtoy PJ, Marbaix E, Henriet P: Matrix metalloproteinase–27 is expressed in CD163+/CD206+ M2 macrophages in the cycling human endometrium and in superficial endometriotic lesions. Mol Hum Reprod 2014, 20: 767–775. 42.Finci LI, Kruger N, Sun X, Zhang J, Chegkazi M, Wu Y, Schenk G, Mertens HDT, Svergun DI, Zhang Y, et al: The crystal structure of netrin–1 in complex with DCC reveals the bifunctionality of netrin–1 as a guidance cue. Neuron 2014, 83: 839–849. 43.Webber CA, Christie KJ, Cheng C, Martinez JA, Singh B, Singh V, Thomas D, Zochodne DW: Schwann cells direct peripheral nerve regeneration through the Netrin–1 receptors, DCC and Unc5H2. Glia 2011, 59: 1503–1517. 44.Ke X, Li Q, Xu L, Zhang Y, Li D, Ma J, Mao X: Netrin–1 overexpression in bone marrow mesenchymal stem cells promotes functional recovery in a rat model of peripheral nerve injury. J Biomed Res 2015, 29: 380–389. 45.Park JI, Seo IA, Lee HK, Park HT, Shin SW, Park YM, Ahn KJ: Netrin inhibits regenerative axon growth of adult dorsal root ganglion neurons in vitro. J Korean Med Sci 2007, 22: 641–645. 46.Laskin DL, Sunil VR, Gardner CR, Laskin JD: Macrophages and tissue injury: agents of defense or destruction? Annu Rev Pharmacol Toxicol 2011, 51: 267–288. 47.Chen P, Bonaldo P: Role of macrophage polarization in tumor angiogenesis and vessel normalization: implications for new anticancer therapies. Int Rev Cell Mol Biol 2013, 301: 1–35. 48.Jensen AL, Collins J, Shipman EP, Wira CR, Guyre PM, Pioli PA: A subset of human uterine endometrial macrophages is alternatively activated. Am J Reprod Immunol 2012, 68: 374–386. 49.Wang Y, Fu Y, Xue S, Ai A, Chen H, Lyu Q, Kuang Y: The M2 polarization of macrophage induced by fractalkine in the endometriotic milieu enhances invasiveness of endometrial stromal cells. Int J Clin Exp Pathol 2014, 7: 194–203. 50.Nie MF, Xie Q, Wu YH, He H, Zou LJ, She XL, Wu XQ: Serum and Ectopic Endometrium from Women with Endometriosis Modulate Macrophage M1/M2 Polarization via the Smad2/Smad3 Pathway. J Immunol Res 2018, 2018: 6285813. 51.Campbell L, Emmerson E, Williams H, Saville CR, Krust A, Chambon P, Mace KA, Hardman MJ: Estrogen receptor-alpha promotes alternative macrophage activation during cutaneous repair. J Invest Dermatol 2014, 134: 2447–2457. 52.Wang Y, Chen H, Wang N, Guo H, Fu Y, Xue S, Ai A, Lyu Q, Kuang Y: Combined 17beta-Estradiol with TCDD Promotes M2 Polarization of Macrophages in the Endometriotic Milieu with Aid of the Interaction between Endometrial Stromal Cells and Macrophages. PLoS One 2015, 10: e0125559. 53.Yang W, Lu Y, Xu Y, Xu L, Zheng W, Wu Y, Li L, Shen P: Estrogen represses hepatocellular carcinoma (HCC) growth via inhibiting alternative activation of tumor-associated macrophages (TAMs). J Biol Chem 2012, 287: 40140–40149. 54.Murray PJ: Macrophage Polarization. Annu Rev Physiol 2017, 79: 541–566. 55.Martinez FO, Gordon S: The M1 and M2 paradigm of macrophage activation: time for reassessment. F1000Prime Rep 2014, 6: 13. 56.Ginhoux F, Schultze JL, Murray PJ, Ochando J, Biswas SK: New insights into the multidimensional concept of macrophage ontogeny, activation and function. Nat Immunol 2016, 17: 34–40. 57.Goldmann O, von Kockritz-Blickwede M, Holtje C, Chhatwal GS, Geffers R, Medina E: Transcriptome analysis of murine macrophages in response to infection with Streptococcus pyogenes reveals an unusual activation program. Infect Immun 2007, 75: 4148–4157. 58.Chan G, Bivins-Smith ER, Smith MS, Smith PM, Yurochko AD: Transcriptome analysis reveals human cytomegalovirus reprograms monocyte differentiation toward an M1 macrophage. J Immunol 2008, 181: 698–711. 59.Paradisi A, Maisse C, Bernet A, Coissieux MM, Maccarrone M, Scoazec JY, Mehlen P: NF-kappaB regulates netrin–1 expression and affects the conditional tumor suppressive activity of the netrin–1 receptors. Gastroenterology 2008, 135: 1248–1257. 60.Lv J, Sun X, Ma J, Ma X, Zhang Y, Li F, Li Y, Zhao Z: Netrin–1 induces the migration of Schwann cells via p38 MAPK and PI3K-Akt signaling pathway mediated by the UNC5B receptor. Biochem Biophys Res Commun 2015, 464: 263–268. 61.Castets M, Mehlen P: Netrin–1 role in angiogenesis: to be or not to be a pro-angiogenic factor? Cell Cycle 2010, 9: 1466–1471. 62.Ly NP, Komatsuzaki K, Fraser IP, Tseng AA, Prodhan P, Moore KJ, Kinane TB: Netrin–1 inhibits leukocyte migration in vitro and in vivo. Proc Natl Acad Sci U S A 2005, 102: 14729–14734. 63.Mao X, Xing H, Mao A, Jiang H, Cheng L, Liu Y, Quan X, Li L: Netrin–1 attenuates cardiac ischemia reperfusion injury and generates alternatively activated macrophages. Inflammation 2014, 37: 573–580. 64.Chen H, Chen Q, Luo Q: Expression of netrin–1 by hypoxia contributes to the invasion and migration of prostate carcinoma cells by regulating YAP activity. Exp Cell Res 2016, 349: 302–309. 65.Han P, Fu Y, Liu J, Wang Y, He J, Gong J, Li M, Tan Q, Li D, Luo Y, et al: Netrin–1 promotes cell migration and invasion by down-regulation of BVES expression in human hepatocellular carcinoma. Am J Cancer Res 2015, 5: 1396–1409. 66.Yin K, Wang L, Zhang X, He Z, Xia Y, Xu J, Wei S, Li B, Li Z, Sun G, et al: Netrin–1 promotes gastric cancer cell proliferation and invasion via the receptor neogenin through PI3K/AKT signaling pathway. Oncotarget 2017, 8: 51177–51189. 67.Fitamant J, Guenebeaud C, Coissieux MM, Guix C, Treilleux I, Scoazec JY, Bachelot T, Bernet A, Mehlen P: Netrin–1 expression confers a selective advantage for tumor cell survival in metastatic breast cancer. Proc Natl Acad Sci U S A 2008, 105: 4850–4855. 68.Zhang J, Wang H, Meng Q, Chen J, Wang J, Huang S: Expression of MTA1 in endometriosis and its relationship to the recurrence. Medicine (Baltimore) 2018, 97: e12115. 69.Bedir R, Sehitoglu I, Balik G, Kagitci M, Gucer H, Yurdakul C, Bagci P: The role of the adhesion molecule Nectin–4 in the pathogenesis of endometriosis. Clin Exp Obstet Gynecol 2016, 43: 463–466. 70.Timologou A, Zafrakas M, Grimbizis G, Miliaras D, Kotronis K, Stamatopoulos P, Tarlatzis BC: Immunohistochemical expression pattern of metastasis suppressors KAI1 and KISS1 in endometriosis and normal endometrium. Eur J Obstet Gynecol Reprod Biol 2016, 199: 110–115. 71.Rosa-e-Silva JC, Garcia SB, de Sa Rosa-e-Silva AC, Candido-dos-Reis FJ, Poli-Neto OB, Ferriani RA, Nogueira AA: Increased cell proliferation in experimentally induced endometriosis in rabbits. Fertil Steril 2010, 93: 1637–1642. Tables Table 1. Primer sequences of Netrin-1 receptors. Primer Forward (5’-3’) Reverse (5’-3’) Actin (h*) AGAAGGATTCCTATGTGGGCG GGATAGCACAGCCTGGATAGCA Netrin-1 (h) CGACCCCAAGAAGGCGCACCCGCCC CCTCCTGCTCGTTCTGCTTG DCC (h) AGCAGGGAGCTCTATGTCCA ACTGACTTCTTCCTGCTCCG Neogenin (h) CAGCCTGTGATTAGTGCCCA TCATAGGTGGGAGGTCCTGG UNC5A (h) CAAGGTTTGCTGAGCTGCTG GTCCAGGTGGAGTTTCTGGG UNC5B (h) TGTGCATGCAAATGCTGGAG TGTCTGTGTCGAAGTCACGG UNC5C (h) GCAAATGCTCGTGCTACCTG TCAATGCTCACTTCCCGGAC UNC5D (h) TCAATGGTGGGGCCTTTTGT ATTCGCTCCACACTTCCCAG DSCAM (h) CAAGAGGTAGTGTTTGCCAGC AGACGACAGTGATGTACGCC CD146 (h) CCCTCACACCAGACTCCAAC GTTCGCTCTTACGAGACGGG A2BAR (h) CTGCAGACGCCCACCAACTA ATTCGTGGTTCCATCCCAGG * h=huam. Table 2. Primer sequences of Netrin-1 and M1 phenotype markers. Primer Forward (5’-3’) Reverse (5’-3’) GAPDH (h*) GGAGCGAGATCCCTCCAAAAT GGCTGTTGTCATACTTCTCATGG Netrin-1 (h) CGACCCCAAGAAGGCGCACCCGCCC CCTCCTGCTCGTTCTGCTTG TNF-α (h) CGAGTGACAAGCCTGTAGCC TGAAGAGGACCTGGGAGTAGAT IL-1β (h) AGCTACGAATCTCCGACCAC CGTTATCCCATGTGTCGAAGAA IL-6 (h) ACTCACCTCTTCAGAACGAATTG CCATCTTTGGAAGGTTCAGGTTG MCP-1 (h) AAACTGAAGCTCGCACTCTCGC AGGTGACTGGGGCATTGATTG iNOS (h) TTCAGTATCACAACCTCAGCAAG TGGACCTGCAAGTTAAAATCCC Gapdh (r # ) CTCATGACCACAGTCCATGC TTCAGCTCTGGGATGACCTT Netrin-1 (r) CGTTACGCTCACTCTGTCGC GCCTCCTGCTCGTTCTGCT TNF-α (r) ACCATGAGCACGGAAAGCAT AACTGATGAGAGGGAGCCCA IL-1β (r) AGTGAGGAGAATGACCTGTTC CGAGATGCTGCTGTGAGATT IL-6 (r) GCCAGAGTCATTCAGAGCAATA GTTGGATGGTCTTGGTCCTTAG MCP-1 (r) TCGGCTGGAGAACTACAAGA GCTGAAGTCCTTAGGGTTGA iNOS (r) CTGCTTTGTGCGGAGTGTC ATTTCTTCCTGATAGAGGTGGT * h=huam; # r=rat. Table 3. Characteristics of patients. Parameters Endometriosis (n = 37) Controls (n = 23) P Age (years), mean ± SEM 33.5 ± 1.0 30.6 ± 1.2 0.07 Gravidity, median (rang) 3 (0-5) 2 (0-5) 0.16 Parity, median (rang) 1 (0-2) 1 (0-4) 0.94 Abortion, median (rang) 2 (0-4) 1 (0-3) 0.06 Menstrual cycle phase, n (%) 0.40 Proliferative 29 (78.4) 20 (87.0) Secretory 8 (21.6) 3 (13.0) Pain symptoms, n (%) 18 (48.6) 0 (0) <.0001 Infertility, n (%) 9 (24.3) 4 (17.4) 0.53 r-AFS I-II, n (%) 17 (45.9) - III -IV, n (%) 20 (54.1) - Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8021","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research","associatedPublications":[],"authors":[{"id":219014,"identity":"81327033-e851-41a8-92d7-0f8fb5c87098","order_by":1,"name":"Shaojie Ding","email":"","orcid":"","institution":"Women's hospital, School of medicine, Zhejiang University","correspondingAuthor":false,"prefix":"","firstName":"Shaojie","middleName":"","lastName":"Ding","suffix":""},{"id":219015,"identity":"fcbde362-3bb3-4304-9d9a-a424dda68c27","order_by":2,"name":"Xinyue Guo","email":"","orcid":"","institution":"Women's hospital, School of medicine, Zhejiang University","correspondingAuthor":false,"prefix":"","firstName":"Xinyue","middleName":"","lastName":"Guo","suffix":""},{"id":219016,"identity":"552cd34e-6049-4d69-a1b2-af43d48ebb85","order_by":3,"name":"Libo Zhu","email":"","orcid":"","institution":"Women's hospital, School of medicine, Zhejiang University","correspondingAuthor":false,"prefix":"","firstName":"Libo","middleName":"","lastName":"Zhu","suffix":""},{"id":219017,"identity":"ac3692e6-bd7a-468c-af7f-8d4289bbb401","order_by":4,"name":"Jianzhang Wang","email":"","orcid":"","institution":"Women's hospital, School of medicine, Zhejiang University","correspondingAuthor":false,"prefix":"","firstName":"Jianzhang","middleName":"","lastName":"Wang","suffix":""},{"id":219018,"identity":"cb1cec07-5502-419e-b3ad-4b93f4122ee7","order_by":5,"name":"Tiantian Li","email":"","orcid":"","institution":"Women's hospital, School of medicine, Zhejiang University","correspondingAuthor":false,"prefix":"","firstName":"Tiantian","middleName":"","lastName":"Li","suffix":""},{"id":219019,"identity":"16adfdcc-df7e-429e-aa34-6836a0f1ef21","order_by":6,"name":"Qin Yu","email":"","orcid":"","institution":"Women's hospital, School of medicine, Zhejiang University","correspondingAuthor":false,"prefix":"","firstName":"Qin","middleName":"","lastName":"Yu","suffix":""},{"id":219020,"identity":"08b11c01-1e1b-4742-a1c8-028f431d4850","order_by":7,"name":"Xinmei Zhang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA50lEQVRIiWNgGAWjYDACCRjJ3sBgAGQxNhCvhecAaVpAjAQwRViL/OzmZw+/tlnk6c58/qCYh8FGdsMB5mcP8GlhnHPM3FjmjESx2e2EBGMehjTjDQfYzA3waWGWSDCTlqiQSNx2O+EAUMvhxA0HeNgk8Glhk0j/Ji1hANRy82ADUMt/wlp4JHLMJD+AbLnBzADUcoCwFgmJnDJphjNALWfSGAznGCQbzzzMZoZXi/yM9G2SP9vqErcdP/7M4E2FnWzf8eZneLWAADMP1F8G4MhkJqQeCBh/QLU+IELxKBgFo2AUjEAAALmjRQkuHaSRAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0001-6474-3477","institution":"Women's Hospital, School of Medicine, Zhejiang University","correspondingAuthor":true,"prefix":"","firstName":"Xinmei","middleName":"","lastName":"Zhang","suffix":""}],"badges":[],"createdAt":"2019-11-15 11:39:42","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.2.17387/v1","doiUrl":"https://doi.org/10.21203/rs.2.17387/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":166792,"identity":"9798722c-25bd-42ea-b6af-36a3498fe691","added_by":"auto","created_at":"2019-11-19 01:51:42","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":10648693,"visible":true,"origin":"","legend":"Netrin-1 levels in women with endometriosis. (A-D) The Netrin-1 concentrations in serum (A, B) and mRNA expression levels in endometrial tissues (C, D) were tested using RT-qPCR and ELISA respectively. (E-H) The location and expression levels of Netrin-1 in endometriotic lesions (E, F) eutopic endometrium with (G) or without (H) endometriosis were analyzed by immunohistochemical staining. (I-K) The location of Netirn-1 and CD68 in endometriotic lesions were tested by immunofluorescence double staining. Error bars show mean ± SEM. * P\u003c.05, ** P\u003c.01, *** P\u003c.0001. (One way ANOVA and Student t test).","description":"","filename":"FIGURE1.jpg","url":"https://assets-eu.researchsquare.com/files/f78bbc81-3ebd-466e-8a6a-0769b127a5e3/v1/FIGURE 1.jpg"},{"id":166794,"identity":"850c91e9-7279-49ee-9fa8-e7fff1941f47","added_by":"auto","created_at":"2019-11-19 01:51:42","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":171317,"visible":true,"origin":"","legend":"Polarized phenotypes of peritoneal macrophages in women with or without endometriosis. Representative dot plot and statistical chart of CD68+ cells in peritoneal fluids from endometriosis (A, C, n=8) and non-endometriosis (B, D, n=6) women by flow cytometric analysis using CD86 and CD163 markers.","description":"","filename":"2.PNG","url":"https://assets-eu.researchsquare.com/files/f78bbc81-3ebd-466e-8a6a-0769b127a5e3/v1/2.PNG"},{"id":166795,"identity":"d2718127-9add-4099-9964-c7edbd33cfe4","added_by":"auto","created_at":"2019-11-19 01:51:43","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":62357,"visible":true,"origin":"","legend":"Different polarized phenotypes of peritoneal macrophages in endometriosis and non-endometriosis women. The percentages of CD86+CD163- (A), CD86+CD163+ (B), CD88-CD163+ (C), CD86-CD163- (D), CD86+ (E), and CD163+ (F) cells in each group. * P\u003c.05, *** P\u003c.0001. (Student t test).","description":"","filename":"3.PNG","url":"https://assets-eu.researchsquare.com/files/f78bbc81-3ebd-466e-8a6a-0769b127a5e3/v1/3.PNG"},{"id":166796,"identity":"cd12ab3a-aeb4-4a26-897a-c112ee017197","added_by":"auto","created_at":"2019-11-19 01:51:43","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":4238470,"visible":true,"origin":"","legend":"Expression levels of macrophage M1 phenotype markers and netrin-1 after M1 polarization in vitro. (A-H) The mRNA expression levels of TNF-α (A), IL-1β (B), IL-6 (C), MCP-1 (D) and iNOS (E) in THP-1 cells were tested using RT-qPCR after PMA stimulation and combined stimulation of LPS and IFN-γ; The mRNA (F) and protein levels (G) as well as supernatant concentrations (H) of Netrin-1 in THP-1 were measured using RT-qPCR, Western Blot and ELISA, respectively. (I-P) The mRNA expression levels of TNF-α (I), IL-1β (J), IL-6 (K), MCP-1 (L) and iNOS (M) in NR8383 cells were tested using RT-qPCR after combined stimulation of LPS and IFN-γ; The mRNA (M) and protein levels (O) as well as supernatant concentrations (P) of Netrin-1 in NR8383 cells were measured using RT-qPCR, Western Blot and ELISA, respectively. Error bars show mean ± SEM. # Compared with THP-1, # P\u003c.05, ## P\u003c.01, ### P\u003c.0001; * Compared with macrophage M0 phenotype, * P\u003c.05, ** P\u003c.01, *** P\u003c.0001. (Student t test).","description":"","filename":"FIGURE4.jpg","url":"https://assets-eu.researchsquare.com/files/f78bbc81-3ebd-466e-8a6a-0769b127a5e3/v1/FIGURE 4.jpg"},{"id":166797,"identity":"5641cdfe-e21a-4e75-8505-4de2b476dda8","added_by":"auto","created_at":"2019-11-19 01:51:43","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":4014275,"visible":true,"origin":"","legend":"Expression levels of Netrin-1 receptors in endometrial tissues. The mRNA expression levels of DCC (A), Neogenin (B), UNC5A (C), UNC5B (D), UNC5C (E), UNC5D (F), Dscam (G), CD146 (H) and A2BAR (I) in endometriotic lesions and eutopic endometrium from women with or without endometriosis were tested using RT-qRCR. Error bars show mean ± SEM. * P\u003c.05, ** P\u003c.01, *** P\u003c.0001. (One way ANOVA and Student t test).","description":"","filename":"FIGURE5.jpg","url":"https://assets-eu.researchsquare.com/files/f78bbc81-3ebd-466e-8a6a-0769b127a5e3/v1/FIGURE 5.jpg"},{"id":166798,"identity":"1b031a08-35fa-43a8-b11a-6d81cac785cb","added_by":"auto","created_at":"2019-11-19 01:51:43","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":2426334,"visible":true,"origin":"","legend":"DCC, UNC5B and A2BAR immunoreactive staining in endometrial tissues. The locations and expression levels of DCC (A-C), UNC5B (D-F) and A2BAR (G-I) in endometriotic lesions (A, D, G) and eutopic endometrium from women with (B, E, H) and without (C, F, I) endometriosis were measured using immunohistochemistry analysis.","description":"","filename":"FIGURE6.jpg","url":"https://assets-eu.researchsquare.com/files/f78bbc81-3ebd-466e-8a6a-0769b127a5e3/v1/FIGURE 6.jpg"},{"id":13479042,"identity":"e22995a8-dd25-4fa7-b26a-2be5e54b14ba","added_by":"auto","created_at":"2021-09-16 21:37:43","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1084645,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8021/v1/410c1e5f-42fb-46ec-b3b5-464abec9c4b6.pdf"}],"financialInterests":"","formattedTitle":"Macrophage-derived Netrin-1 participates in endometriosis-associated pain","fulltext":[{"header":"Background","content":"\u003cp\u003eEndometriosis is a common gynecological disease among women of childbearing age, characterized by pain and infertility [\u003ca href=\"#_ENREF_1\"\u003e1\u003c/a\u003e]. Pain symptoms in patients with endometriosis include dysmenorrhea, dyspareunia, dysuria, defecation pain and chronic pelvic pain, which have a significant impact on women’s quality of life [\u003ca href=\"#_ENREF_2\"\u003e2\u003c/a\u003e]. However, the exact mechanisms of endometriosis-associated pain remain unclear up to date despite extensive research efforts [\u003ca href=\"#_ENREF_3\"\u003e3\u003c/a\u003e, \u003ca href=\"#_ENREF_4\"\u003e4\u003c/a\u003e].\u003c/p\u003e\n\u003cp\u003eIn 2000, Anaf et al. firstly reported S100-labeled nerves infiltrating in endometriotic lesions, and the percentages of nerves were significantly higher in the lesions of women suffered from severe endometriosis pain [\u003ca href=\"#_ENREF_5\"\u003e5\u003c/a\u003e]. In subsequent studies, elevated specific makers for sensory, sympathetic, and parasympathetic nerves [\u003ca href=\"#_ENREF_6\"\u003e6–8\u003c/a\u003e] and growth factors such as nerve growth factor (NGF), brain derived neurotrophic factor (BDNF) and neurite growth factor 2 (NEGF2) [\u003ca href=\"#_ENREF_9\"\u003e9–11\u003c/a\u003e] were identified in different types of endometriotic lesions, which were correlated with endometriosis pain. Obviously, endometriosis pain may be considered as a kind of neuropathic pain. Moreover, in a rat model of endometriosis, auto-transplanted endometriotic lesions developed autonomic and sensory innervation [\u003ca href=\"#_ENREF_12\"\u003e12\u003c/a\u003e]. Growth-associated protein 43 (GAP–43), a marker for neurite outgrowth and regeneration, was expressed in nerve fibers infiltrating in the endometriotic lesions of peritoneal and deep infiltrating endometriosis [\u003ca href=\"#_ENREF_13\"\u003e13\u003c/a\u003e, \u003ca href=\"#_ENREF_14\"\u003e14\u003c/a\u003e]. However, it is still unclear how the nerve fibers in endometriotic lesions sprout abnormally.\u003c/p\u003e\n\u003cp\u003eNetrins is a member of the laminin superfamily and has a similar amino acid terminal sequence [\u003ca href=\"#_ENREF_15\"\u003e15\u003c/a\u003e]. The name Netrin is derived from the Sanskrit \u003cem\u003eNetr,\u003c/em\u003e meaning ‘guide’ as its role in axon guidance [\u003ca href=\"#_ENREF_16\"\u003e16\u003c/a\u003e]. Until now, three secreted Netrins (Netrins 1, 3 and 4), and two glycosylphosphatidylinositol-anchored membrane proteins, Netrins G1 and G2, have been identified in mammals. Netrin Gs regulate axon guidance by forming synaptic interactions between neurons with the transmembrane Netrin G ligands NGL1 and 2. The secreted Netrins can bind to the receptors of Deleted in Colorectal Cancer (DCC), neogenin or Uncoordinated (UNC5) A–D, causing axonal attraction or rejection [\u003ca href=\"#_ENREF_17\"\u003e17\u003c/a\u003e, \u003ca href=\"#_ENREF_18\"\u003e18\u003c/a\u003e]. Recent studies have shown that Netrins also participate in angiogenesis, cell proliferation, migration and tumorigenesis by binding to the receptors of DCC, neogenin, UNC5, Down’s syndrome cell adhesion molecule (DSCAM), CD146 and A2B adenosine receptor (A2BAR) [\u003ca href=\"#_ENREF_19\"\u003e19–22\u003c/a\u003e].\u003c/p\u003e\n\u003cp\u003eIt has been demonstrated that Netrin–1, the most studied guidance cue, triggers attraction effect through DCC and neogenin, or repulsion effect via UNC5 A-D [\u003ca href=\"#_ENREF_15\"\u003e15\u003c/a\u003e]. In the central nerve system, Netrin 1 is secreted by ventricular zone neural progenitors and floor-plate cells in the ventral embryonic spinal cord [\u003ca href=\"#_ENREF_23\"\u003e23\u003c/a\u003e, \u003ca href=\"#_ENREF_24\"\u003e24\u003c/a\u003e]. In the process of peripheral neural injury and regeneration, increased levels of Netrin–1 are mainly produced by Schwann cells [\u003ca href=\"#_ENREF_25\"\u003e25\u003c/a\u003e]. Netrin–1 expression was increased in hypoxia conditions [\u003ca href=\"#_ENREF_22\"\u003e22\u003c/a\u003e], inflammation and various diseases such as obesity [\u003ca href=\"#_ENREF_26\"\u003e26\u003c/a\u003e], type 2 diabetes [\u003ca href=\"#_ENREF_27\"\u003e27\u003c/a\u003e], acute lung injury [\u003ca href=\"#_ENREF_28\"\u003e28\u003c/a\u003e], atherosclerosis [\u003ca href=\"#_ENREF_29\"\u003e29\u003c/a\u003e] and abdominal aortic aneurysm (AAA) [\u003ca href=\"#_ENREF_30\"\u003e30\u003c/a\u003e]. However, it is not clear whether Netrin–1 is involved in the pathogenesis of endometriosis.\u003c/p\u003e\n\u003cp\u003eCo-localization of Netrin–1 and CD68, a marker of macrophage, is identified in atherosclerotic plaques [\u003ca href=\"#_ENREF_29\"\u003e29\u003c/a\u003e], adipose tissues [\u003ca href=\"#_ENREF_26\"\u003e26\u003c/a\u003e] and inflamed aortic vessel wall [\u003ca href=\"#_ENREF_30\"\u003e30\u003c/a\u003e], suggesting that macrophages may participate in inflammation by secreting Netrin–1. In fact, the inflammatory microenvironment of endometriosis can promote macrophage infiltration [\u003ca href=\"#_ENREF_31\"\u003e31\u003c/a\u003e, \u003ca href=\"#_ENREF_32\"\u003e32\u003c/a\u003e], which play a crucial role in the etiology and pathogenesis of this disease including inflammatory response [\u003ca href=\"#_ENREF_33\"\u003e33\u003c/a\u003e], angiogenesis [\u003ca href=\"#_ENREF_32\"\u003e32\u003c/a\u003e], proliferation [\u003ca href=\"#_ENREF_34\"\u003e34\u003c/a\u003e] and neurogenesis [\u003ca href=\"#_ENREF_35\"\u003e35\u003c/a\u003e]. The interaction between macrophages and nerve fibers contributes to neuroinflammation and pain generation in endometriosis [\u003ca href=\"#_ENREF_35\"\u003e35\u003c/a\u003e]. A large number of up-regulated molecules released by nerve fibers in endometriotic lesions such as monocyte chemotactic protein–1 (MCP–1), colony-stimulating factor 1 (CSF–1) and leukemia inhibitory factor (LIF), are responsible for the recruitment of macrophages from vessels within the lesions [\u003ca href=\"#_ENREF_36\"\u003e36\u003c/a\u003e, \u003ca href=\"#_ENREF_37\"\u003e37\u003c/a\u003e]. On the other hand, infiltrated macrophages in the lesions in turn mediate neurogenesis by secreting neurotrophins, semaphorins, and vascular epithelial growth factor (VEGF) [\u003ca href=\"#_ENREF_35\"\u003e35\u003c/a\u003e, \u003ca href=\"#_ENREF_37\"\u003e37\u003c/a\u003e, \u003ca href=\"#_ENREF_38\"\u003e38\u003c/a\u003e]. Although macrophage activation is closely related to endometriosis, yet, macrophages differentiate into classically activated macrophages (pro-inflammatory, M1) or alternatively activated macrophages (anti-inflammatory, M2) [\u003ca href=\"#_ENREF_39\"\u003e39\u003c/a\u003e], and the polarization of M1/M2 macrophages in endometriosis remains highly debated [\u003ca href=\"#_ENREF_31\"\u003e31\u003c/a\u003e, \u003ca href=\"#_ENREF_32\"\u003e32\u003c/a\u003e, \u003ca href=\"#_ENREF_40\"\u003e40\u003c/a\u003e, \u003ca href=\"#_ENREF_41\"\u003e41\u003c/a\u003e], Therefore, it is necessary to explore the role of macrophage-mediated Netrin–1 in the pathogenesis of endometriosis.\u003c/p\u003e\n\u003cp\u003eIn the present study, we aimed to investigate the role of Netrin–1 mediated by macrophages in endometriosis-associated pain. To do so, we firstly detected expressions of Netrin–1 and its receptors in endometriotic lesions. Secondly, we localized Netrin–1 and macrophages in endometriotic lesions. Thirdly, we determined polarization phenotypes of peritoneal macrophages. Finally, we observed the expression and secretion of Netrin–1 after macrophage M1 polarization was induced\u003cem\u003e in vitro.\u003c/em\u003e\u003c/p\u003e\n\n\n"},{"header":"Methods","content":"\u003cp\u003e\u003cstrong\u003ePatients\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA total of 60 women with (case group, n=37) and without endometriosis (other benign gynecologic diseases, control group, n=23) undergoing laparoscopic surgery at the Women\u0026rsquo;s Hospital between January 2018 and June 2018 were recruited in this study. In endometriosis group, 17 women were at stage I-II while 20 of them were at stage III-IV, according to the Revised American Fertility Society Scoring system. Pain symptoms were observed in 48.6% (n = 18) and 0% (n = 0) of the endometriosis and non-endometriosis group, while infertility was 24.3% (n = 9) and 17.4% (n = 4), respectively. None of participants have received hormone therapy 6 month before surgery.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSamples Collection\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePeripheral blood samples were obtained 1 day before the surgery while endometriotic lesions and endometrial tissues were collected during the surgical procedure. The bloods or cell supernatants were centrifuged at 1000 g for 10 minutes, and the supernatants was transferred into 1.5 mL tubes and stored at -80\u0026deg;C until processing. Half of the endometrial tissue was frozen in -80\u0026deg;C for mRNA detection, and the other half was immersed in formalin (Solarbio) for further immunohistochemical and immunofluorescence staining.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eELISA\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe concentrations of Netrin-1 in serum or culture supernatants were quantified by ELISA kits (Cusabio) according to the manufacturer's instructions.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eqRT-PCR and Western blot analyses\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was extracted from endometrial samples or cells with TRIzol reagent (Takara) and reversed by PrimeScript Reverse Transcription (RT) reagent kit (Takara) according to the manufacturer's recommendations. SYBR Premix Ex Taq kit (Takara) was used to quantitative polymerase chain reaction (PCR) and the fold change was determined through 2\u003csup\u003e-\u003c/sup\u003e\u003csup\u003e△\u003c/sup\u003e\u003csup\u003e△\u003c/sup\u003eCt method. The primers for Netrin-1, receptors and inflammatory factors were synthesized from Generay and the sequences were listed in Table 1 and Table 2. Western blot analysis was used to test Netrin-1 protein expression levels with Netrin-1 antibody (Abcam) in THP-1 and NR8383 cells in M1 polarization process.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eImmuno\u003c/strong\u003e\u003cstrong\u003ehi\u003c/strong\u003e\u003cstrong\u003estochemical Staining\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSpecific antibody of Netrin-1 (Abcam), DCC (Bioss), UNC5B (Bioss) and A2BAR (Invitrogen) were used to access the expression levels and localization of Netrin-1 and its receptors in endometrial tissues by immunohistochemistry (IHC). The sum of the percentage (0-3) and intensity scores (0-3) were represented as IHC scores to show the expression levels of molecule. Detailed immunohistochemical process and scoring were described before [\u003ca href=\"#_ENREF_10\"\u003e10\u003c/a\u003e].\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDouble Immunofluorescence Staining\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSlides of endometriotic lesions were incubated with primary antibody of Netrin-1 and CD68 (Abcam), and then were rinsed in PBS before mounted with corresponding fluorescent secondary antibody (Abcam).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFlow cytometric analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePeritoneal macrophages were washed with erythrocyte lysis buffer and incubated with Human Fc Block (BD Biosciences) on ice. Subsequently, the cells were incubated PE-Cy\u003csup\u003eTM\u003c/sup\u003e7-conjugated anti-CD86 (BD Biosciences), and PE-conjugated anti-CD163 (BD Biosciences) antibody for 15 min. For intracellular staining, the cells were fixed and permeabilized in Fixation and Permeabilization Solution (BD Biosciences) for 20 min, and incubated with FITC-conjugated anti-CD68 (BD Biosciences) antibody for 1 h. The samples were then analyzed with a FACS Verse system and analyzed with BD FACS DIVA software (BD Biosciences, United States). PE-Cy\u003csup\u003eTM\u003c/sup\u003e7-conjugated IgG1, PE-conjugated IgG1 and FITC-conjugated IgG2b (BD Biosciences) antibody served as control antibodies. CD68+CD86+CD163- macrophages were identified as M1 macrophages, while CD68+CD86-CD163+ cells were identified as M2 macrophages.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCells Intervention\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHuman monocytic cell line THP-1 and rat alveolar macrophage-derived cell line NR8383 cells were purchased from Stem Cell Bank, Chinese Academy of Sciences. Cells were cultured with Dulbecco's modified Eagle Medium/F-12 containing 15% fetal calf sera (Gibco). THP-1 cells were induced to macrophages (M0) by phorbol-12-myristate-13-acetate (PMA, 20 ng/mL, Sigma). Then, differentiated human THP-1 macrophages and NR8383 cells were treated with lipopolysaccharide (LPS, 20 ng/mL, Sigma) and interferon gamma (IFN-\u0026gamma;, 20 ng/mL, Peprotech) to further induce M1 phenotype macrophages. Then expression levels of M1 phenotype markers tumor necrosis factor alpha (TNF)-\u0026alpha;, interleukin (IL)-1\u0026beta;, IL-6, MCP-1 and nitric oxide synthase 2 (iNOS) were assessed at 1 h, 3 h, 6 h, 12 h, 24 h and 48 h after stimulation. Meanwhile, mRNA and protein expression levels of Netrin-1 as well as secreted Netrin-1 levels in cell supernatants were measured using qRT-PCR, Western blot and ELISA respectively.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistics\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData were analyzed using SPSS Version 24.0 (IBM). The continuous data variables were quantified as mean \u0026plusmn; SEM. Differences in variables between two groups and multiple groups were analyzed using unpaired Student t test and one-way ANOVA, respectively. Nonparametric testing was used where sample sizes were insufficient to confirm normality of data distribution. Statistical tests (\u0026chi;2 and Mann-Whitney U test) were performed to compare the frequency and median among groups. \u003cem\u003eP\u003c/em\u003e values of \u0026lt;.05 were considered statistically significant.\u003c/p\u003e\n"},{"header":"Results","content":"\u003ch3\u003eCharacteristics of the Patient\u003c/h3\u003e\n\u003cp\u003eThere were no significant differences between endometriosis group and non-endometriosis group with respect to their age, gravidity, parity, abortion, infertility, or cycle stage, except for pain symptoms (Table 3).\u003c/p\u003e\n\n\u003ch3\u003eNetrin–1 concentrations in serum is associated with endometriosis pain in the patients\u003c/h3\u003e\n\u003cp\u003eThe serum concentrations of Netrin–1 in endometriosis women were significantly higher than those from women without endometriosis (\u003cem\u003eP\u003c/em\u003e\u0026lt;.05, Fig. 1A), and were correlated with endometriosis pain (\u003cem\u003eP\u003c/em\u003e\u0026lt;.05, Fig. 1B).\u003c/p\u003e\n\n\u003ch3\u003eNetrin–1 was over-expressed in endometriotic lesions\u003c/h3\u003e\n\u003cp\u003eNetrin–1 was not only expressed in epithelial and interstitial vascular endothelial cells, but also expressed in endometrial stromal cells in endometriotic lesions from endometriosis women with (Fig. 1E) or without (Fig. 1F) pain, and in endothelial cells in eutopic endometrium from women with (Fig. 1G) or without (Fig. 1H) endometriosis. The mRNA expression levels of Netrin–1 in endometriotic lesions were significantly higher than those in eutopic endometrium from women with (p\u0026lt;.01, Fig. 1C; p\u0026lt;.01) or without endometriosis (p\u0026lt;.01, Fig. 1C; p\u0026lt;.00001), and both were correlated with endometriosis pain (p\u0026lt;.01, Fig. 1D; p\u0026lt;.01). Moreover, Netrin–1 was co-expressed with CD 68 in endometriotic lesions (Fig. 1I-L).\u003c/p\u003e\n\n\u003ch3\u003eEndometriosis polarizes peritoneal macrophages towards the M1 phenotype\u003c/h3\u003e\n\u003cp\u003eCD68+ cells were recognized as peritoneal macrophage in women with endometriosis (Fig. 2 A, C) or without endometriosis (Fig. 2 B, D). Flow cytometry plots revealed a significantly higher proportion of M2 macrophages (CD86-CD163+) in non-endometriosis women compared to endometriosis women (Fig. 3C). The proportion of M1 macrophages (CD68+CD163-) was high in endometriosis women, but it did not reach statistical significance (Fig. 3A). In short, the proportion of CD86+ macrophages significantly increased in endometriosis patients compared with those without endometriosis, while the proportion of CD163+ macrophages did not differ (Fig. 3E, F).\u003c/p\u003e\n\n\u003ch3\u003eNetrin–1 was secreted by Macrophages\u003c/h3\u003e\n\u003cp\u003ePMA treatment induced significantly higher mRNA expression levels of IL–1β (\u003cem\u003eP\u003c/em\u003e\u0026lt;.01), IL–6 (\u003cem\u003eP\u003c/em\u003e\u0026lt;.05), iNOS (\u003cem\u003eP\u003c/em\u003e\u0026lt;.01) and lower TNF-α (\u003cem\u003eP\u003c/em\u003e\u0026lt;.01) mRNA expression levels and unchanged MCP–1 (\u003cem\u003eP\u003c/em\u003e\u0026gt;.05) and Netrin–1 (\u003cem\u003eP\u003c/em\u003e\u0026gt;.05) mRNA expression levels in human THP–1 macrophages compared with untreated monocytic THP–1 cells. Then, mRNA expression levels of M1 phenotype markers TNF-α, IL–1β, IL–6, MCP–1 and iNOS were all significantly elevated after combined stimulation of LPS and IFN-γ within 48 h, reaching their pecks at 1 h (\u003cem\u003eP\u003c/em\u003e\u0026lt;.05; Fig. 4A), 1 h (\u003cem\u003eP\u003c/em\u003e\u0026lt;.01; Fig. 4B), 6 h (\u003cem\u003eP\u003c/em\u003e\u0026lt;.01; Fig. 4C), 24 h (\u003cem\u003eP\u003c/em\u003e\u0026lt;.01; Fig. 4D) and 48 h (\u003cem\u003eP\u003c/em\u003e\u0026lt;.01; Fig. 4E), respectively. The mRNA, protein expression levels and supernatant concentrations of Netrin–1 in PMA-differentiated human THP–1 macrophages were significantly higher at 12 h (\u003cem\u003eP\u003c/em\u003e\u0026lt;.05; Fig. 4F), 24 h (\u003cem\u003eP\u003c/em\u003e\u0026lt;.05; Fig. 4G) and 48 h (\u003cem\u003eP\u003c/em\u003e\u0026lt;.01; Fig. 4H) respectively after M1 polarization.\u003c/p\u003e\n\u003cp\u003eIn NR8383 cell line, the mRNA expression levels of TNF-α, IL–1β, IL–6, MCP–1 and iNOS all increased with 48 h after LPS and IFN-γ treatment, reaching their peck at 6 h (\u003cem\u003eP\u003c/em\u003e\u0026lt;.01; Fig. 4I), 6 h (\u003cem\u003eP\u003c/em\u003e\u0026lt;.05; Fig. 4J), 3 h (\u003cem\u003eP\u003c/em\u003e\u0026lt;.05; Fig. 4K), 6 h (\u003cem\u003eP\u003c/em\u003e\u0026lt;.05; Fig. 4L) and 12 h (\u003cem\u003eP\u003c/em\u003e\u0026lt;.05; Fig. 4M), respectively. Meanwhile, the mRNA and protein levels as well as supernatant concentrations of Netrin–1 in NR8383 cells were significantly elevated at 12 h (\u003cem\u003eP\u003c/em\u003e\u0026lt;.05; Fig. 4N), 24 h (\u003cem\u003eP\u003c/em\u003e\u0026lt;.05; Fig. 4O) and 48 h (\u003cem\u003eP\u003c/em\u003e\u0026lt;.0001; Fig. 4P) respectively after M1 polarization.\u003c/p\u003e\n\n\u003ch3\u003eNetrin–1 receptors was more expressed in endometriotic tissues\u003c/h3\u003e\n\u003cp\u003eThe mRNA expression levels of DCC and A2BAR in endometriotic lesions were significantly higher than those in eutopic endometrium from women with (\u003cem\u003eP\u003c/em\u003e\u0026lt;.01; \u003cem\u003eP\u003c/em\u003e\u0026lt;.05) or without (\u003cem\u003eP\u003c/em\u003e\u0026lt;.01; \u003cem\u003eP\u003c/em\u003e\u0026lt;.01) endometriosis (Fig. 5A, I). On the contrary, UNC5B, UNC5C and DSCAM mRNA expression levels in endometriotic lesions were significantly lower than those in eutopic endometrium form women with (\u003cem\u003eP\u003c/em\u003e\u0026lt;.01; \u003cem\u003eP\u003c/em\u003e\u0026lt;.0001; \u003cem\u003eP\u003c/em\u003e\u0026lt;.01) or without (\u003cem\u003eP\u003c/em\u003e\u0026lt;.0001; \u003cem\u003eP\u003c/em\u003e\u0026lt;.0001; \u003cem\u003eP\u003c/em\u003e\u0026lt;.01) endometriosis (Fig. 5D, E, G). Eutopic endometrium from endometriosis women also showed a significantly higher UNC5C mRNA expression levels than those from non-endometriosis women (\u003cem\u003eP\u003c/em\u003e\u0026lt;.05; Fig. 5E). No statistical differences in UNC5A, UNC5B or CD146 mRNA expression levels among endometriotic lesions and eutopic endometrium from women with or without endometriosis were found (Fig. 5C, F, H).\u003c/p\u003e\n\u003cp\u003eImmunohistochemistry results showed that DCC was mainly expressed in epithelial and stromal cells and interstitium in endometriotic lesions (Fig. 6A-C), and showed a higher IHC score in endometriotic lesions than those in eutopic endometrium form women with or without endometriosis (\u003cem\u003eP\u003c/em\u003e\u0026lt;.0001). UNC5B was mainly expressed in glandular epithelial cells (Fig. 6D-F) and was less expressed in endometriotic lesions than those in eutopic endometrium from women with (\u003cem\u003eP\u003c/em\u003e\u0026lt;.01) or without (\u003cem\u003eP\u003c/em\u003e\u0026lt;.05) endometriosis. A2BAR was widely expressed in endometriotic lesions (Fig. 6G-I), and the IHC scores were higher than those in eutopic endometrium from endometriosis (\u003cem\u003eP\u003c/em\u003e\u0026lt;.05) and non-endometriosis (\u003cem\u003eP\u003c/em\u003e\u0026lt;.05) women.\u003c/p\u003e\n\n"},{"header":"Discussion","content":"\u003cp\u003eThis study demonstrated that Netrin–1 increased in serum and endometriotic lesions in endometriosis women. Since Netrin–1 is an axon guide molecule, we speculate that Netrin–1 mediates endometriosis pain by promoting nerve fiber infiltration in endometriotic lesions. Actually, Netrin–1 has bi-functionality on axonal guidance. It has been reported that Netrin–1 leads to axon attraction binding to DCC receptor or repulsion binding to UNC5A–D receptors in the same cells [\u003ca href=\"#_ENREF_15\"\u003e15\u003c/a\u003e]. Neogenin, DSCAM and CD146 also show promoting effect on axon extension [\u003ca href=\"#_ENREF_18\"\u003e18\u003c/a\u003e]. The bi-functionality on axon guidance is based on the crystal structure of Netrin–1 and its receptors [\u003ca href=\"#_ENREF_42\"\u003e42\u003c/a\u003e]. Besides, cross-link with different receptor types and the charge changes on Netrin–1 and receptors also determine promotion or inhibition of Netrin–1 in axon guidance [\u003ca href=\"#_ENREF_18\"\u003e18\u003c/a\u003e]. Our study demonstrated that endometriotic lesions showed a significantly higher expressions levels of DCC, neogenin and lower expression levels of UNC5B and UNC5C compared with eutopic endometrium, which further supported that Netrin–1 is responsible for endometriosis pain by promoting nerve infiltration in endometriotic lesions. Dorsal root ganglion (DRG) neurons express DCC, neogenin and UNC5A–D receptors [\u003ca href=\"#_ENREF_43\"\u003e43\u003c/a\u003e]. In a rat model of sciatic nerve transection, the expression of DCC receptor is up-regulated while the expression of UNC5B and UNC5C is down-regulated in sensory neurons [\u003ca href=\"#_ENREF_43\"\u003e43\u003c/a\u003e]. Transplantation of Netrin–1 overexpression bone marrow mesenchymal stem cells promotes axon regeneration and functional recovery of the sciatic nerve after crush injury [\u003ca href=\"#_ENREF_44\"\u003e44\u003c/a\u003e]. However, Netrin–1 treatment (500 ng/mL) inhibits neurite outgrowth of adult DRG neurons in explant and dissociated cultures, which may be mediated by UNC5A-C receptors on DRG [\u003ca href=\"#_ENREF_45\"\u003e45\u003c/a\u003e]. Thus, the effect of Netrin–1 on Nerve outgrowth is complex and the mechanism of Netrin–1 involved in endometriosis pain remains to be further studied.\u003c/p\u003e\n\u003cp\u003eM1 macrophages, activated by IFN-γ, LPS or TNF-α, participate in tissue injury, inflammatory and immune responses by producing pro-inflammatory cytokines and chemokines [\u003ca href=\"#_ENREF_46\"\u003e46\u003c/a\u003e]. In contrast, M2 macrophages can be activated by IL–4, IL–10, IL–13, or transforming growth factor-β (TGF-β), thus participating in tissue repair tumor angiogenesis and vessel normalization [\u003ca href=\"#_ENREF_47\"\u003e47\u003c/a\u003e]. In endometriosis, several studies have reported that the macrophages in women with endometriosis are predominantly of M2 phenotype (CD163+/CD206+), which play an important role in the development of endometriosis [\u003ca href=\"#_ENREF_31\"\u003e31\u003c/a\u003e, \u003ca href=\"#_ENREF_41\"\u003e41\u003c/a\u003e, \u003ca href=\"#_ENREF_48\"\u003e48–50\u003c/a\u003e]. As endometriosis is an estrogen-dependent disease, it has been reported that estrogen promotes M2 polarization through activation of the signal transducers and activators of transcription (STAT3) and P38-mitogen activated protein kinases (MAPK) pathway [\u003ca href=\"#_ENREF_51\"\u003e51\u003c/a\u003e, \u003ca href=\"#_ENREF_52\"\u003e52\u003c/a\u003e]. However, another study shows opposed result that 17β-estradiol represses suppressor for M2 polarization via inhibiting the JAK1-STAT6 signaling pathway [\u003ca href=\"#_ENREF_53\"\u003e53\u003c/a\u003e]. Takebayashi et al. have reported that macrophage population slants toward M1 in the endometrium of endometriosis patients due to significantly lower ratio of the number of CD163+ or CD206+ macrophages to CD68+ macrophages [\u003ca href=\"#_ENREF_40\"\u003e40\u003c/a\u003e]. In this study, we found that the peritoneal macrophages of endometriosis were mainly of CD86+CD163+ type, while those of non-endometriosis women were mainly of CD86-CD163+ type (M2). The percentage of CD86+ macrophages in endometriosis women was significantly higher than that in control group, which displayed a unique M1/M2 polarization signature that was skewed towards the classical M1 activation phenotype. This was consistent with the subsequent results of experiments \u003cem\u003ein vitro\u003c/em\u003e that M1 polarization induced up-regulation of Netrin–1 synthesis and secretion in human and rat cell line. A recent study also has reported that Netrn–1 enriched macrophages are those that highly expressed pro-inflammatory markers as Netrin–1 mRNA expression levels are increased in CD68+/CD206− pro-inflammatory phenotypes rather than CD68+/CD206+ samples [\u003ca href=\"#_ENREF_30\"\u003e30\u003c/a\u003e]. Actually, polarization is a dynamic process as the signals are temporally and dynamic, and the use of terms M1 and M2 is confusing due to the lack of specific phenotypic scoring criteria [\u003ca href=\"#_ENREF_54\"\u003e54\u003c/a\u003e, \u003ca href=\"#_ENREF_55\"\u003e55\u003c/a\u003e]. Many physiological or pathological macrophages did not show a clear M1 or M2 phenotype [\u003ca href=\"#_ENREF_56\"\u003e56\u003c/a\u003e], or macrophages with combinations of M1 and M2 markers can be found during M1/M2 polarization [\u003ca href=\"#_ENREF_57\"\u003e57\u003c/a\u003e, \u003ca href=\"#_ENREF_58\"\u003e58\u003c/a\u003e]. New methods and technical advances are needed to reassess activation and classification of macrophage.\u003c/p\u003e\n\u003cp\u003eNetrin–1 gene is a direct transcriptional target of nuclear factor (NF)-κB, which up-regulates Netrin–1 in colorectal carcinoma and mammary epithelial cells in response to inflammation [\u003ca href=\"#_ENREF_59\"\u003e59\u003c/a\u003e]. However, another study has reported that activation of NF-κB represses Netrin–1 expression levels in adenocarcinomic alveolar epithelial cells and dermal microvessel endothelial cells [\u003ca href=\"#_ENREF_28\"\u003e28\u003c/a\u003e]. Actually, macrophages from endometriosis patients show a statistically significant higher proportion of NF-κB nuclear translocation, and release various cytokines, growth factors and angiogenic factors to participate in endometrial fragment adhesion, proliferation and neovascularization [\u003ca href=\"#_ENREF_33\"\u003e33\u003c/a\u003e]. Since we only tested cell lines \u003cem\u003ein vitro,\u003c/em\u003e primary macrophages from endometriosis women are more valuable depending on the amount of cytokine, time of exposure, and the competition for cytokine [\u003ca href=\"#_ENREF_54\"\u003e54\u003c/a\u003e]. Thus, the regulatory mechanism of Netrin–1 in endometriosis macrophages needs to be further studied.\u003c/p\u003e\n\u003cp\u003eNetrin–1 also plays a role in angiogenesis, cell migration, cell proliferation and cell survival. The present study confirmed the higher expression of Netrin–1, constant expression of CD146 and lower expression of UNC5B in endometriotic lesions. Netrin–1 enriched macrophages also highly express pro-angiogenic markers [\u003ca href=\"#_ENREF_30\"\u003e30\u003c/a\u003e] and treatment of Netrin–1 with low doses (50–200 ng/mL) on endothelial cells promotes proliferation, migration and tube formation via binds to high affinity receptor CD146 [\u003ca href=\"#_ENREF_19\"\u003e19\u003c/a\u003e]. However, high concentrations of Netrin–1 (1000–2000 ng/mL) inhibit the above effects, possibly via UNC5B signaling pathway [\u003ca href=\"#_ENREF_19\"\u003e19\u003c/a\u003e]. In endometriosis, nerve fibers are accompanied by immature blood vessels within endometriotic lesions [\u003ca href=\"#_ENREF_13\"\u003e13\u003c/a\u003e]. Netrin–1 also dose-dependently regulates cell migration of Schwan cell, endothelial cell via activating or inhibiting MAPK pathway by CD146 or UNC5B receptor [\u003ca href=\"#_ENREF_19\"\u003e19\u003c/a\u003e, \u003ca href=\"#_ENREF_60\"\u003e60\u003c/a\u003e, \u003ca href=\"#_ENREF_61\"\u003e61\u003c/a\u003e]. In inflammatory, it has been reported that Netrin–1 in endothelial cells inhibits inflammatory cell migration, such as leukocyte and macrophage [\u003ca href=\"#_ENREF_30\"\u003e30\u003c/a\u003e, \u003ca href=\"#_ENREF_62\"\u003e62\u003c/a\u003e, \u003ca href=\"#_ENREF_63\"\u003e63\u003c/a\u003e]. This may be an anti-inflammatory response in the body, but it can lead to the accumulation of inflammatory cells in the lesions, resulting in AAA or atherosclerosis [\u003ca href=\"#_ENREF_29\"\u003e29\u003c/a\u003e, \u003ca href=\"#_ENREF_30\"\u003e30\u003c/a\u003e]. In endometriosis, macrophage retention in endometriotic lesions increases the local concentration of Netrin–1, which may play a role in the infiltration of nerve fibers. In tumorigenesis, Netrin–1 promotes cell survival, proliferation, invasion and migration in different types of cancer, such as prostate carcinoma, hepatocellular carcinoma, gastric cancer and breast cancer [\u003ca href=\"#_ENREF_64\"\u003e64–67\u003c/a\u003e]. Although endometriosis is a benign gynecological disease, it has malignant behaviors in adhesion, proliferation, invasion, metastasis and recurrence [\u003ca href=\"#_ENREF_68\"\u003e68–71\u003c/a\u003e]. Thus, elevated Netrin–1 may be also involved in the growth of endometriotic lesions.\u003c/p\u003e\n\n"},{"header":"Conclusions","content":"\u003cp\u003eIn summary, the present study indicated that increased Netrin–1 in women with endometriosis may participate in endometriosis pain. Target therapy toward Netrin–1 and macrophages may not only interfere with the process of endometriosis pain, but also inhibit the progression of endometriosis.\u003c/p\u003e\n"},{"header":"Abbreviations","content":"\u003cp\u003eLPS: Lipopolysaccharide; IFN-γ: interferon gamma; NGF: nerve growth factor; BDNF: brain derived neurotrophic factor; NEGF2: neurite growth factor 2; GAP–43: Growth-associated protein 43; DCC: deleted in colorectal cancer; UNC5: uncoordinated; DSCAM: Down’s syndrome cell adhesion molecule; A2BAR: A2B adenosine receptor; AAA: abdominal aortic aneurysm; MCP–1: monocyte chemotactic protein–1; CSF–1: colony-stimulating factor 1; LIF: leukemia inhibitory factor; VEGF: vascular epithelial growth factor; TNF-α: tumor necrosis factor alpha; IL: interleukin; iNOS: nitric oxide synthase 2; DRG: dorsal root ganglion; TGF-β: transforming growth factor-β; MAPK: mitogen activated protein kinases.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch3\u003eAcknowledgements\u003c/h3\u003e\n\u003cp\u003eWe would like to acknowledge the skillful work of Qi Cheng in the running of ELISA measurements and the assistance of immunohistochemical facility of Caiyun Zhou.\u003c/p\u003e\n\n\u003ch3\u003eAuthors’ contributions\u003c/h3\u003e\n\u003cp\u003eS. D., J.W and X. Z. designed research studies. S. D. and X. G. performed the majority of the experiment. L. Z., T. L. and Q. Y. acquired and analyzed data. S. D. and X. G. wrote the manuscript. J. W. and X. Z. edited the manuscript.\u003c/p\u003e\n\n\u003ch3\u003eFunding:\u003c/h3\u003e\n\u003cp\u003eThis work was funded by National Key R\u0026amp;D Program of China (No. 2017YFC1001202) and National Natural Science Foundation of China (No. 81671429).\u003c/p\u003e\n\n\u003ch3\u003eAvailability of data and materials\u003c/h3\u003e\n\u003cp\u003eThe datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e\n\n\u003ch3\u003eEthics approval and consent to participate\u003c/h3\u003e\n\u003cp\u003eThis study was approved by the Human Ethics Committee of the Women’s Hospital, School of Medicine, Zhejiang University (no. 20190012).\u003c/p\u003e\n\n\u003ch3\u003eConsent for publication\u003c/h3\u003e\n\u003cp\u003eWritten informed consent was obtained from each patient.\u003c/p\u003e\n\n\u003ch3\u003eCompeting interests\u003c/h3\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003cp\u003e1.Kim JH, Han E: \u003cem\u003eEndometriosis and Female Pelvic Pain.\u003c/em\u003e \u003cem\u003eSemin Reprod Med \u003c/em\u003e2018, \u003cem\u003e36:\u003c/em\u003e143–151.\u003c/p\u003e\n\u003cp\u003e2.Fauconnier A, Chapron C: \u003cem\u003eEndometriosis and pelvic pain: epidemiological evidence of the relationship and implications.\u003c/em\u003e \u003cem\u003eHum Reprod Update \u003c/em\u003e2005, \u003cem\u003e11:\u003c/em\u003e595–606.\u003c/p\u003e\n\u003cp\u003e3.Ferrero S, Barra F, Leone Roberti Maggiore U: \u003cem\u003eCurrent and Emerging Therapeutics for the Management of Endometriosis.\u003c/em\u003e \u003cem\u003eDrugs \u003c/em\u003e2018, \u003cem\u003e78:\u003c/em\u003e995–1012.\u003c/p\u003e\n\u003cp\u003e4.Falcone T, Flyckt R: \u003cem\u003eClinical Management of Endometriosis.\u003c/em\u003e \u003cem\u003eObstet Gynecol \u003c/em\u003e2018, \u003cem\u003e131:\u003c/em\u003e557–571.\u003c/p\u003e\n\u003cp\u003e5.Anaf V, Simon P, El Nakadi I, Fayt I, Buxant F, Simonart T, Peny MO, Noel JC: \u003cem\u003eRelationship between endometriotic foci and nerves in rectovaginal endometriotic nodules.\u003c/em\u003e \u003cem\u003eHum Reprod \u003c/em\u003e2000, \u003cem\u003e15:\u003c/em\u003e1744–1750.\u003c/p\u003e\n\u003cp\u003e6.Berkley KJ, Rapkin AJ, Papka RE: \u003cem\u003eThe pains of endometriosis.\u003c/em\u003e \u003cem\u003eScience \u003c/em\u003e2005, \u003cem\u003e308:\u003c/em\u003e1587–1589.\u003c/p\u003e\n\u003cp\u003e7.Zhang X, Yao H, Huang X, Lu B, Xu H, Zhou C: \u003cem\u003eNerve fibres in ovarian endometriotic lesions in women with ovarian endometriosis.\u003c/em\u003e \u003cem\u003eHum Reprod \u003c/em\u003e2010, \u003cem\u003e25:\u003c/em\u003e392–397.\u003c/p\u003e\n\u003cp\u003e8.McKinnon B, Bersinger NA, Wotzkow C, Mueller MD: \u003cem\u003eEndometriosis-associated nerve fibers, peritoneal fluid cytokine concentrations, and pain in endometriotic lesions from different locations.\u003c/em\u003e \u003cem\u003eFertil Steril \u003c/em\u003e2012, \u003cem\u003e97:\u003c/em\u003e373–380.\u003c/p\u003e\n\u003cp\u003e9.Kajitani T, Maruyama T, Asada H, Uchida H, Oda H, Uchida S, Miyazaki K, Arase T, Ono M, Yoshimura Y: \u003cem\u003ePossible involvement of nerve growth factor in dysmenorrhea and dyspareunia associated with endometriosis.\u003c/em\u003e \u003cem\u003eEndocr J \u003c/em\u003e2013, \u003cem\u003e60:\u003c/em\u003e1155–1164.\u003c/p\u003e\n\u003cp\u003e10.Ding S, Zhu T, Tian Y, Xu P, Chen Z, Huang X, Zhang X: \u003cem\u003eRole of Brain-Derived Neurotrophic Factor in Endometriosis Pain.\u003c/em\u003e \u003cem\u003eReprod Sci \u003c/em\u003e2018, \u003cem\u003e25:\u003c/em\u003e1045–1057.\u003c/p\u003e\n\u003cp\u003e11.Hirota Y, Osuga Y, Koga K, Yoshino O, Hirata T, Harada M, Morimoto C, Yano T, Tsutsumi O, Sakuma S, et al: \u003cem\u003ePossible implication of midkine in the development of endometriosis.\u003c/em\u003e \u003cem\u003eHum Reprod \u003c/em\u003e2005, \u003cem\u003e20:\u003c/em\u003e1084–1089.\u003c/p\u003e\n\u003cp\u003e12.Berkley KJ, Dmitrieva N, Curtis KS, Papka RE: \u003cem\u003eInnervation of ectopic endometrium in a rat model of endometriosis.\u003c/em\u003e \u003cem\u003eProc Natl Acad Sci U S A \u003c/em\u003e2004, \u003cem\u003e101:\u003c/em\u003e11094–11098.\u003c/p\u003e\n\u003cp\u003e13.Mechsner S, Schwarz J, Thode J, Loddenkemper C, Salomon DS, Ebert AD: \u003cem\u003eGrowth-associated protein 43-positive sensory nerve fibers accompanied by immature vessels are located in or near peritoneal endometriotic lesions.\u003c/em\u003e \u003cem\u003eFertil Steril \u003c/em\u003e2007, \u003cem\u003e88:\u003c/em\u003e581–587.\u003c/p\u003e\n\u003cp\u003e14.Wang G, Tokushige N, Russell P, Dubinovsky S, Markham R, Fraser IS: \u003cem\u003eHyperinnervation in intestinal deep infiltrating endometriosis.\u003c/em\u003e \u003cem\u003eJ Minim Invasive Gynecol \u003c/em\u003e2009, \u003cem\u003e16:\u003c/em\u003e713–719.\u003c/p\u003e\n\u003cp\u003e15.Lai Wing Sun K, Correia JP, Kennedy TE: \u003cem\u003eNetrins: versatile extracellular cues with diverse functions.\u003c/em\u003e \u003cem\u003eDevelopment \u003c/em\u003e2011, \u003cem\u003e138:\u003c/em\u003e2153–2169.\u003c/p\u003e\n\u003cp\u003e16.Ishii N, Wadsworth WG, Stern BD, Culotti JG, Hedgecock EM: \u003cem\u003eUNC–6, a laminin-related protein, guides cell and pioneer axon migrations in C. elegans.\u003c/em\u003e \u003cem\u003eNeuron \u003c/em\u003e1992, \u003cem\u003e9:\u003c/em\u003e873–881.\u003c/p\u003e\n\u003cp\u003e17.Rajasekharan S, Kennedy TE: \u003cem\u003eThe netrin protein family.\u003c/em\u003e \u003cem\u003eGenome Biol \u003c/em\u003e2009, \u003cem\u003e10:\u003c/em\u003e239.\u003c/p\u003e\n\u003cp\u003e18.Dun XP, Parkinson DB: \u003cem\u003eRole of Netrin–1 Signaling in Nerve Regeneration.\u003c/em\u003e \u003cem\u003eInt J Mol Sci \u003c/em\u003e2017, \u003cem\u003e18.\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e19.Tu T, Zhang C, Yan H, Luo Y, Kong R, Wen P, Ye Z, Chen J, Feng J, Liu F, et al: \u003cem\u003eCD146 acts as a novel receptor for netrin–1 in promoting angiogenesis and vascular development.\u003c/em\u003e \u003cem\u003eCell Res \u003c/em\u003e2015, \u003cem\u003e25:\u003c/em\u003e275–287.\u003c/p\u003e\n\u003cp\u003e20.Lee HK, Seo IA, Seo E, Seo SY, Lee HJ, Park HT: \u003cem\u003eNetrin–1 induces proliferation of Schwann cells through Unc5b receptor.\u003c/em\u003e \u003cem\u003eBiochem Biophys Res Commun \u003c/em\u003e2007, \u003cem\u003e362:\u003c/em\u003e1057–1062.\u003c/p\u003e\n\u003cp\u003e21.Grandin M, Meier M, Delcros JG, Nikodemus D, Reuten R, Patel TR, Goldschneider D, Orriss G, Krahn N, Boussouar A, et al: \u003cem\u003eStructural Decoding of the Netrin–1/UNC5 Interaction and its Therapeutical Implications in Cancers.\u003c/em\u003e \u003cem\u003eCancer Cell \u003c/em\u003e2016, \u003cem\u003e29:\u003c/em\u003e173–185.\u003c/p\u003e\n\u003cp\u003e22.Rosenberger P, Schwab JM, Mirakaj V, Masekowsky E, Mager A, Morote-Garcia JC, Unertl K, Eltzschig HK: \u003cem\u003eHypoxia-inducible factor-dependent induction of netrin–1 dampens inflammation caused by hypoxia.\u003c/em\u003e \u003cem\u003eNat Immunol \u003c/em\u003e2009, \u003cem\u003e10:\u003c/em\u003e195–202.\u003c/p\u003e\n\u003cp\u003e23.Varadarajan SG, Kong JH, Phan KD, Kao TJ, Panaitof SC, Cardin J, Eltzschig H, Kania A, Novitch BG, Butler SJ: \u003cem\u003eNetrin1 Produced by Neural Progenitors, Not Floor Plate Cells, Is Required for Axon Guidance in the Spinal Cord.\u003c/em\u003e \u003cem\u003eNeuron \u003c/em\u003e2017, \u003cem\u003e94:\u003c/em\u003e790–799 e793.\u003c/p\u003e\n\u003cp\u003e24.Dominici C, Moreno-Bravo JA, Puiggros SR, Rappeneau Q, Rama N, Vieugue P, Bernet A, Mehlen P, Chedotal A: \u003cem\u003eFloor-plate-derived netrin–1 is dispensable for commissural axon guidance.\u003c/em\u003e \u003cem\u003eNature \u003c/em\u003e2017, \u003cem\u003e545:\u003c/em\u003e350–354.\u003c/p\u003e\n\u003cp\u003e25.Madison RD, Zomorodi A, Robinson GA: \u003cem\u003eNetrin–1 and peripheral nerve regeneration in the adult rat.\u003c/em\u003e \u003cem\u003eExp Neurol \u003c/em\u003e2000, \u003cem\u003e161:\u003c/em\u003e563–570.\u003c/p\u003e\n\u003cp\u003e26.Ramkhelawon B, Hennessy EJ, Menager M, Ray TD, Sheedy FJ, Hutchison S, Wanschel A, Oldebeken S, Geoffrion M, Spiro W, et al: \u003cem\u003eNetrin–1 promotes adipose tissue macrophage retention and insulin resistance in obesity.\u003c/em\u003e \u003cem\u003eNat Med \u003c/em\u003e2014, \u003cem\u003e20:\u003c/em\u003e377–384.\u003c/p\u003e\n\u003cp\u003e27.Yim J, Kim G, Lee BW, Kang ES, Cha BS, Kim JH, Cho JW, Lee SG, Lee YH: \u003cem\u003eRelationship Between Circulating Netrin–1 Concentration, Impaired Fasting Glucose, and Newly Diagnosed Type 2 Diabetes.\u003c/em\u003e \u003cem\u003eFront Endocrinol (Lausanne) \u003c/em\u003e2018, \u003cem\u003e9:\u003c/em\u003e691.\u003c/p\u003e\n\u003cp\u003e28.Mirakaj V, Thix CA, Laucher S, Mielke C, Morote-Garcia JC, Schmit MA, Henes J, Unertl KE, Kohler D, Rosenberger P: \u003cem\u003eNetrin–1 dampens pulmonary inflammation during acute lung injury.\u003c/em\u003e \u003cem\u003eAm J Respir Crit Care Med \u003c/em\u003e2010, \u003cem\u003e181:\u003c/em\u003e815–824.\u003c/p\u003e\n\u003cp\u003e29.van Gils JM, Derby MC, Fernandes LR, Ramkhelawon B, Ray TD, Rayner KJ, Parathath S, Distel E, Feig JL, Alvarez-Leite JI, et al: \u003cem\u003eThe neuroimmune guidance cue netrin–1 promotes atherosclerosis by inhibiting the emigration of macrophages from plaques.\u003c/em\u003e \u003cem\u003eNat Immunol \u003c/em\u003e2012, \u003cem\u003e13:\u003c/em\u003e136–143.\u003c/p\u003e\n\u003cp\u003e30.Hadi T, Boytard L, Silvestro M, Alebrahim D, Jacob S, Feinstein J, Barone K, Spiro W, Hutchison S, Simon R, et al: \u003cem\u003eMacrophage-derived netrin–1 promotes abdominal aortic aneurysm formation by activating MMP3 in vascular smooth muscle cells.\u003c/em\u003e \u003cem\u003eNat Commun \u003c/em\u003e2018, \u003cem\u003e9:\u003c/em\u003e5022.\u003c/p\u003e\n\u003cp\u003e31.Itoh F, Komohara Y, Takaishi K, Honda R, Tashiro H, Kyo S, Katabuchi H, Takeya M: \u003cem\u003ePossible involvement of signal transducer and activator of transcription–3 in cell-cell interactions of peritoneal macrophages and endometrial stromal cells in human endometriosis.\u003c/em\u003e \u003cem\u003eFertil Steril \u003c/em\u003e2013, \u003cem\u003e99:\u003c/em\u003e1705–1713.\u003c/p\u003e\n\u003cp\u003e32.Bacci M, Capobianco A, Monno A, Cottone L, Di Puppo F, Camisa B, Mariani M, Brignole C, Ponzoni M, Ferrari S, et al: \u003cem\u003eMacrophages are alternatively activated in patients with endometriosis and required for growth and vascularization of lesions in a mouse model of disease.\u003c/em\u003e \u003cem\u003eAm J Pathol \u003c/em\u003e2009, \u003cem\u003e175:\u003c/em\u003e547–556.\u003c/p\u003e\n\u003cp\u003e33.Lousse JC, Van Langendonckt A, Gonzalez-Ramos R, Defrere S, Renkin E, Donnez J: \u003cem\u003eIncreased activation of nuclear factor-kappa B (NF-kappaB) in isolated peritoneal macrophages of patients with endometriosis.\u003c/em\u003e \u003cem\u003eFertil Steril \u003c/em\u003e2008, \u003cem\u003e90:\u003c/em\u003e217–220.\u003c/p\u003e\n\u003cp\u003e34.Gou Y, Li X, Li P, Zhang H, Xu T, Wang H, Wang B, Ma X, Jiang X, Zhang Z: \u003cem\u003eEstrogen receptor beta upregulates CCL2 via NF-kappaB signaling in endometriotic stromal cells and recruits macrophages to promote the pathogenesis of endometriosis.\u003c/em\u003e \u003cem\u003eHum Reprod \u003c/em\u003e2019.\u003c/p\u003e\n\u003cp\u003e35.Wu J, Xie H, Yao S, Liang Y: \u003cem\u003eMacrophage and nerve interaction in endometriosis.\u003c/em\u003e \u003cem\u003eJ Neuroinflammation \u003c/em\u003e2017, \u003cem\u003e14:\u003c/em\u003e53.\u003c/p\u003e\n\u003cp\u003e36.Tofaris GK, Patterson PH, Jessen KR, Mirsky R: \u003cem\u003eDenervated Schwann cells attract macrophages by secretion of leukemia inhibitory factor (LIF) and monocyte chemoattractant protein–1 in a process regulated by interleukin–6 and LIF.\u003c/em\u003e \u003cem\u003eJ Neurosci \u003c/em\u003e2002, \u003cem\u003e22:\u003c/em\u003e6696–6703.\u003c/p\u003e\n\u003cp\u003e37.Liang Y, Xie H, Wu J, Liu D, Yao S: \u003cem\u003eVillainous role of estrogen in macrophage-nerve interaction in endometriosis.\u003c/em\u003e \u003cem\u003eReprod Biol Endocrinol \u003c/em\u003e2018, \u003cem\u003e16:\u003c/em\u003e122.\u003c/p\u003e\n\u003cp\u003e38.Cattin AL, Burden JJ, Van Emmenis L, Mackenzie FE, Hoving JJ, Garcia Calavia N, Guo Y, McLaughlin M, Rosenberg LH, Quereda V, et al: \u003cem\u003eMacrophage-Induced Blood Vessels Guide Schwann Cell-Mediated Regeneration of Peripheral Nerves.\u003c/em\u003e \u003cem\u003eCell \u003c/em\u003e2015, \u003cem\u003e162:\u003c/em\u003e1127–1139.\u003c/p\u003e\n\u003cp\u003e39.Gordon S, Pluddemann A, Martinez Estrada F: \u003cem\u003eMacrophage heterogeneity in tissues: phenotypic diversity and functions.\u003c/em\u003e \u003cem\u003eImmunol Rev \u003c/em\u003e2014, \u003cem\u003e262:\u003c/em\u003e36–55.\u003c/p\u003e\n\u003cp\u003e40.Takebayashi A, Kimura F, Kishi Y, Ishida M, Takahashi A, Yamanaka A, Wu D, Zheng L, Takahashi K, Suginami H, Murakami T: \u003cem\u003eSubpopulations of macrophages within eutopic endometrium of endometriosis patients.\u003c/em\u003e \u003cem\u003eAm J Reprod Immunol \u003c/em\u003e2015, \u003cem\u003e73:\u003c/em\u003e221–231.\u003c/p\u003e\n\u003cp\u003e41.Cominelli A, Gaide Chevronnay HP, Lemoine P, Courtoy PJ, Marbaix E, Henriet P: \u003cem\u003eMatrix metalloproteinase–27 is expressed in CD163+/CD206+ M2 macrophages in the cycling human endometrium and in superficial endometriotic lesions.\u003c/em\u003e \u003cem\u003eMol Hum Reprod \u003c/em\u003e2014, \u003cem\u003e20:\u003c/em\u003e767–775.\u003c/p\u003e\n\u003cp\u003e42.Finci LI, Kruger N, Sun X, Zhang J, Chegkazi M, Wu Y, Schenk G, Mertens HDT, Svergun DI, Zhang Y, et al: \u003cem\u003eThe crystal structure of netrin–1 in complex with DCC reveals the bifunctionality of netrin–1 as a guidance cue.\u003c/em\u003e \u003cem\u003eNeuron \u003c/em\u003e2014, \u003cem\u003e83:\u003c/em\u003e839–849.\u003c/p\u003e\n\u003cp\u003e43.Webber CA, Christie KJ, Cheng C, Martinez JA, Singh B, Singh V, Thomas D, Zochodne DW: \u003cem\u003eSchwann cells direct peripheral nerve regeneration through the Netrin–1 receptors, DCC and Unc5H2.\u003c/em\u003e \u003cem\u003eGlia \u003c/em\u003e2011, \u003cem\u003e59:\u003c/em\u003e1503–1517.\u003c/p\u003e\n\u003cp\u003e44.Ke X, Li Q, Xu L, Zhang Y, Li D, Ma J, Mao X: \u003cem\u003eNetrin–1 overexpression in bone marrow mesenchymal stem cells promotes functional recovery in a rat model of peripheral nerve injury.\u003c/em\u003e \u003cem\u003eJ Biomed Res \u003c/em\u003e2015, \u003cem\u003e29:\u003c/em\u003e380–389.\u003c/p\u003e\n\u003cp\u003e45.Park JI, Seo IA, Lee HK, Park HT, Shin SW, Park YM, Ahn KJ: \u003cem\u003eNetrin inhibits regenerative axon growth of adult dorsal root ganglion neurons in vitro.\u003c/em\u003e \u003cem\u003eJ Korean Med Sci \u003c/em\u003e2007, \u003cem\u003e22:\u003c/em\u003e641–645.\u003c/p\u003e\n\u003cp\u003e46.Laskin DL, Sunil VR, Gardner CR, Laskin JD: \u003cem\u003eMacrophages and tissue injury: agents of defense or destruction?\u003c/em\u003e \u003cem\u003eAnnu Rev Pharmacol Toxicol \u003c/em\u003e2011, \u003cem\u003e51:\u003c/em\u003e267–288.\u003c/p\u003e\n\u003cp\u003e47.Chen P, Bonaldo P: \u003cem\u003eRole of macrophage polarization in tumor angiogenesis and vessel normalization: implications for new anticancer therapies.\u003c/em\u003e \u003cem\u003eInt Rev Cell Mol Biol \u003c/em\u003e2013, \u003cem\u003e301:\u003c/em\u003e1–35.\u003c/p\u003e\n\u003cp\u003e48.Jensen AL, Collins J, Shipman EP, Wira CR, Guyre PM, Pioli PA: \u003cem\u003eA subset of human uterine endometrial macrophages is alternatively activated.\u003c/em\u003e \u003cem\u003eAm J Reprod Immunol \u003c/em\u003e2012, \u003cem\u003e68:\u003c/em\u003e374–386.\u003c/p\u003e\n\u003cp\u003e49.Wang Y, Fu Y, Xue S, Ai A, Chen H, Lyu Q, Kuang Y: \u003cem\u003eThe M2 polarization of macrophage induced by fractalkine in the endometriotic milieu enhances invasiveness of endometrial stromal cells.\u003c/em\u003e \u003cem\u003eInt J Clin Exp Pathol \u003c/em\u003e2014, \u003cem\u003e7:\u003c/em\u003e194–203.\u003c/p\u003e\n\u003cp\u003e50.Nie MF, Xie Q, Wu YH, He H, Zou LJ, She XL, Wu XQ: \u003cem\u003eSerum and Ectopic Endometrium from Women with Endometriosis Modulate Macrophage M1/M2 Polarization via the Smad2/Smad3 Pathway.\u003c/em\u003e \u003cem\u003eJ Immunol Res \u003c/em\u003e2018, \u003cem\u003e2018:\u003c/em\u003e6285813.\u003c/p\u003e\n\u003cp\u003e51.Campbell L, Emmerson E, Williams H, Saville CR, Krust A, Chambon P, Mace KA, Hardman MJ: \u003cem\u003eEstrogen receptor-alpha promotes alternative macrophage activation during cutaneous repair.\u003c/em\u003e \u003cem\u003eJ Invest Dermatol \u003c/em\u003e2014, \u003cem\u003e134:\u003c/em\u003e2447–2457.\u003c/p\u003e\n\u003cp\u003e52.Wang Y, Chen H, Wang N, Guo H, Fu Y, Xue S, Ai A, Lyu Q, Kuang Y: \u003cem\u003eCombined 17beta-Estradiol with TCDD Promotes M2 Polarization of Macrophages in the Endometriotic Milieu with Aid of the Interaction between Endometrial Stromal Cells and Macrophages.\u003c/em\u003e \u003cem\u003ePLoS One \u003c/em\u003e2015, \u003cem\u003e10:\u003c/em\u003ee0125559.\u003c/p\u003e\n\u003cp\u003e53.Yang W, Lu Y, Xu Y, Xu L, Zheng W, Wu Y, Li L, Shen P: \u003cem\u003eEstrogen represses hepatocellular carcinoma (HCC) growth via inhibiting alternative activation of tumor-associated macrophages (TAMs).\u003c/em\u003e \u003cem\u003eJ Biol Chem \u003c/em\u003e2012, \u003cem\u003e287:\u003c/em\u003e40140–40149.\u003c/p\u003e\n\u003cp\u003e54.Murray PJ: \u003cem\u003eMacrophage Polarization.\u003c/em\u003e \u003cem\u003eAnnu Rev Physiol \u003c/em\u003e2017, \u003cem\u003e79:\u003c/em\u003e541–566.\u003c/p\u003e\n\u003cp\u003e55.Martinez FO, Gordon S: \u003cem\u003eThe M1 and M2 paradigm of macrophage activation: time for reassessment.\u003c/em\u003e \u003cem\u003eF1000Prime Rep \u003c/em\u003e2014, \u003cem\u003e6:\u003c/em\u003e13.\u003c/p\u003e\n\u003cp\u003e56.Ginhoux F, Schultze JL, Murray PJ, Ochando J, Biswas SK: \u003cem\u003eNew insights into the multidimensional concept of macrophage ontogeny, activation and function.\u003c/em\u003e \u003cem\u003eNat Immunol \u003c/em\u003e2016, \u003cem\u003e17:\u003c/em\u003e34–40.\u003c/p\u003e\n\u003cp\u003e57.Goldmann O, von Kockritz-Blickwede M, Holtje C, Chhatwal GS, Geffers R, Medina E: \u003cem\u003eTranscriptome analysis of murine macrophages in response to infection with Streptococcus pyogenes reveals an unusual activation program.\u003c/em\u003e \u003cem\u003eInfect Immun \u003c/em\u003e2007, \u003cem\u003e75:\u003c/em\u003e4148–4157.\u003c/p\u003e\n\u003cp\u003e58.Chan G, Bivins-Smith ER, Smith MS, Smith PM, Yurochko AD: \u003cem\u003eTranscriptome analysis reveals human cytomegalovirus reprograms monocyte differentiation toward an M1 macrophage.\u003c/em\u003e \u003cem\u003eJ Immunol \u003c/em\u003e2008, \u003cem\u003e181:\u003c/em\u003e698–711.\u003c/p\u003e\n\u003cp\u003e59.Paradisi A, Maisse C, Bernet A, Coissieux MM, Maccarrone M, Scoazec JY, Mehlen P: \u003cem\u003eNF-kappaB regulates netrin–1 expression and affects the conditional tumor suppressive activity of the netrin–1 receptors.\u003c/em\u003e \u003cem\u003eGastroenterology \u003c/em\u003e2008, \u003cem\u003e135:\u003c/em\u003e1248–1257.\u003c/p\u003e\n\u003cp\u003e60.Lv J, Sun X, Ma J, Ma X, Zhang Y, Li F, Li Y, Zhao Z: \u003cem\u003eNetrin–1 induces the migration of Schwann cells via p38 MAPK and PI3K-Akt signaling pathway mediated by the UNC5B receptor.\u003c/em\u003e \u003cem\u003eBiochem Biophys Res Commun \u003c/em\u003e2015, \u003cem\u003e464:\u003c/em\u003e263–268.\u003c/p\u003e\n\u003cp\u003e61.Castets M, Mehlen P: \u003cem\u003eNetrin–1 role in angiogenesis: to be or not to be a pro-angiogenic factor?\u003c/em\u003e \u003cem\u003eCell Cycle \u003c/em\u003e2010, \u003cem\u003e9:\u003c/em\u003e1466–1471.\u003c/p\u003e\n\u003cp\u003e62.Ly NP, Komatsuzaki K, Fraser IP, Tseng AA, Prodhan P, Moore KJ, Kinane TB: \u003cem\u003eNetrin–1 inhibits leukocyte migration in vitro and in vivo.\u003c/em\u003e \u003cem\u003eProc Natl Acad Sci U S A \u003c/em\u003e2005, \u003cem\u003e102:\u003c/em\u003e14729–14734.\u003c/p\u003e\n\u003cp\u003e63.Mao X, Xing H, Mao A, Jiang H, Cheng L, Liu Y, Quan X, Li L: \u003cem\u003eNetrin–1 attenuates cardiac ischemia reperfusion injury and generates alternatively activated macrophages.\u003c/em\u003e \u003cem\u003eInflammation \u003c/em\u003e2014, \u003cem\u003e37:\u003c/em\u003e573–580.\u003c/p\u003e\n\u003cp\u003e64.Chen H, Chen Q, Luo Q: \u003cem\u003eExpression of netrin–1 by hypoxia contributes to the invasion and migration of prostate carcinoma cells by regulating YAP activity.\u003c/em\u003e \u003cem\u003eExp Cell Res \u003c/em\u003e2016, \u003cem\u003e349:\u003c/em\u003e302–309.\u003c/p\u003e\n\u003cp\u003e65.Han P, Fu Y, Liu J, Wang Y, He J, Gong J, Li M, Tan Q, Li D, Luo Y, et al: \u003cem\u003eNetrin–1 promotes cell migration and invasion by down-regulation of BVES expression in human hepatocellular carcinoma.\u003c/em\u003e \u003cem\u003eAm J Cancer Res \u003c/em\u003e2015, \u003cem\u003e5:\u003c/em\u003e1396–1409.\u003c/p\u003e\n\u003cp\u003e66.Yin K, Wang L, Zhang X, He Z, Xia Y, Xu J, Wei S, Li B, Li Z, Sun G, et al: \u003cem\u003eNetrin–1 promotes gastric cancer cell proliferation and invasion via the receptor neogenin through PI3K/AKT signaling pathway.\u003c/em\u003e \u003cem\u003eOncotarget \u003c/em\u003e2017, \u003cem\u003e8:\u003c/em\u003e51177–51189.\u003c/p\u003e\n\u003cp\u003e67.Fitamant J, Guenebeaud C, Coissieux MM, Guix C, Treilleux I, Scoazec JY, Bachelot T, Bernet A, Mehlen P: \u003cem\u003eNetrin–1 expression confers a selective advantage for tumor cell survival in metastatic breast cancer.\u003c/em\u003e \u003cem\u003eProc Natl Acad Sci U S A \u003c/em\u003e2008, \u003cem\u003e105:\u003c/em\u003e4850–4855.\u003c/p\u003e\n\u003cp\u003e68.Zhang J, Wang H, Meng Q, Chen J, Wang J, Huang S: \u003cem\u003eExpression of MTA1 in endometriosis and its relationship to the recurrence.\u003c/em\u003e \u003cem\u003eMedicine (Baltimore) \u003c/em\u003e2018, \u003cem\u003e97:\u003c/em\u003ee12115.\u003c/p\u003e\n\u003cp\u003e69.Bedir R, Sehitoglu I, Balik G, Kagitci M, Gucer H, Yurdakul C, Bagci P: \u003cem\u003eThe role of the adhesion molecule Nectin–4 in the pathogenesis of endometriosis.\u003c/em\u003e \u003cem\u003eClin Exp Obstet Gynecol \u003c/em\u003e2016, \u003cem\u003e43:\u003c/em\u003e463–466.\u003c/p\u003e\n\u003cp\u003e70.Timologou A, Zafrakas M, Grimbizis G, Miliaras D, Kotronis K, Stamatopoulos P, Tarlatzis BC: \u003cem\u003eImmunohistochemical expression pattern of metastasis suppressors KAI1 and KISS1 in endometriosis and normal endometrium.\u003c/em\u003e \u003cem\u003eEur J Obstet Gynecol Reprod Biol \u003c/em\u003e2016, \u003cem\u003e199:\u003c/em\u003e110–115.\u003c/p\u003e\n\u003cp\u003e71.Rosa-e-Silva JC, Garcia SB, de Sa Rosa-e-Silva AC, Candido-dos-Reis FJ, Poli-Neto OB, Ferriani RA, Nogueira AA: \u003cem\u003eIncreased cell proliferation in experimentally induced endometriosis in rabbits.\u003c/em\u003e \u003cem\u003eFertil Steril \u003c/em\u003e2010, \u003cem\u003e93:\u003c/em\u003e1637–1642.\u003c/p\u003e\n"},{"header":"Tables","content":"\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003eTable 1. Primer sequences of Netrin-1 receptors. \u003c/span\u003e\u003c/p\u003e\n\u003ctable style=\"margin-left: -15.9pt; border-collapse: collapse; border: none;\" width=\"614\"\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 78.0pt; border-top: solid windowtext 1.0pt; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"104\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003ePrimer\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 205.55pt; border-top: solid windowtext 1.0pt; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"274\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eForward (5\u0026rsquo;-3\u0026rsquo;)\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 177.2pt; border-top: solid windowtext 1.0pt; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"236\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eReverse (5\u0026rsquo;-3\u0026rsquo;)\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 78.0pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"104\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eActin (h*)\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 205.55pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"274\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eAGAAGGATTCCTATGTGGGCG\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 177.2pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"236\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eGGATAGCACAGCCTGGATAGCA\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 78.0pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"104\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eNetrin-1 (h)\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 205.55pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"274\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eCGACCCCAAGAAGGCGCACCCGCCC\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 177.2pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"236\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eCCTCCTGCTCGTTCTGCTTG\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 78.0pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"104\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eDCC (h)\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 205.55pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"274\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eAGCAGGGAGCTCTATGTCCA\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 177.2pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"236\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eACTGACTTCTTCCTGCTCCG\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 78.0pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"104\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eNeogenin (h)\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 205.55pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"274\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eCAGCCTGTGATTAGTGCCCA\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 177.2pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"236\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eTCATAGGTGGGAGGTCCTGG\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 78.0pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"104\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eUNC5A (h)\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 205.55pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"274\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eCAAGGTTTGCTGAGCTGCTG\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 177.2pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"236\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eGTCCAGGTGGAGTTTCTGGG\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 78.0pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"104\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eUNC5B (h)\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 205.55pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"274\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eTGTGCATGCAAATGCTGGAG\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 177.2pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"236\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eTGTCTGTGTCGAAGTCACGG\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 78.0pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"104\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eUNC5C (h)\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 205.55pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"274\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eGCAAATGCTCGTGCTACCTG\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 177.2pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"236\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eTCAATGCTCACTTCCCGGAC\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 78.0pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"104\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eUNC5D (h)\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 205.55pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"274\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eTCAATGGTGGGGCCTTTTGT\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 177.2pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"236\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eATTCGCTCCACACTTCCCAG\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 78.0pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"104\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eDSCAM (h)\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 205.55pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"274\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eCAAGAGGTAGTGTTTGCCAGC\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 177.2pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"236\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eAGACGACAGTGATGTACGCC\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 78.0pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"104\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eCD146 (h)\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 205.55pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"274\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eCCCTCACACCAGACTCCAAC\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 177.2pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"236\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eGTTCGCTCTTACGAGACGGG\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 78.0pt; border: none; border-bottom: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"104\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eA2BAR (h)\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 205.55pt; border: none; border-bottom: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"274\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eCTGCAGACGCCCACCAACTA\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 177.2pt; border: none; border-bottom: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"236\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eATTCGTGGTTCCATCCCAGG\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003e* h=huam.\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003eTable 2. Primer sequences of Netrin-1 and M1 phenotype markers.\u003c/span\u003e\u003c/p\u003e\n\u003ctable style=\"margin-left: -15.9pt; border-collapse: collapse; border: none;\" width=\"605\"\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 70.95pt; border-top: solid windowtext 1.0pt; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"95\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003ePrimer\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 205.5pt; border-top: solid windowtext 1.0pt; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"274\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eForward (5\u0026rsquo;-3\u0026rsquo;)\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 177.2pt; border-top: solid windowtext 1.0pt; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"236\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eReverse (5\u0026rsquo;-3\u0026rsquo;)\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 70.95pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"95\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eGAPDH (h*)\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 205.5pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"274\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eGGAGCGAGATCCCTCCAAAAT\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 177.2pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"236\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eGGCTGTTGTCATACTTCTCATGG\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 70.95pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"95\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eNetrin-1 (h)\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 205.5pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"274\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eCGACCCCAAGAAGGCGCACCCGCCC\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 177.2pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"236\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eCCTCCTGCTCGTTCTGCTTG\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 70.95pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"95\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eTNF-\u0026alpha; (h)\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 205.5pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"274\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eCGAGTGACAAGCCTGTAGCC\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 177.2pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"236\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eTGAAGAGGACCTGGGAGTAGAT\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 70.95pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"95\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eIL-1\u0026beta; (h)\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 205.5pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"274\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eAGCTACGAATCTCCGACCAC\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 177.2pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"236\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eCGTTATCCCATGTGTCGAAGAA\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 70.95pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"95\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eIL-6 (h)\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 205.5pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"274\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eACTCACCTCTTCAGAACGAATTG\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 177.2pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"236\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eCCATCTTTGGAAGGTTCAGGTTG\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 70.95pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"95\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eMCP-1 (h)\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 205.5pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"274\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eAAACTGAAGCTCGCACTCTCGC\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 177.2pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"236\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eAGGTGACTGGGGCATTGATTG\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 70.95pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"95\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eiNOS (h)\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 205.5pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"274\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eTTCAGTATCACAACCTCAGCAAG\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 177.2pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"236\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eTGGACCTGCAAGTTAAAATCCC\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 70.95pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"95\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eGapdh (r\u003csup\u003e#\u003c/sup\u003e)\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 205.5pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"274\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eCTCATGACCACAGTCCATGC\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 177.2pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"236\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eTTCAGCTCTGGGATGACCTT\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 70.95pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"95\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eNetrin-1 (r)\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 205.5pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"274\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eCGTTACGCTCACTCTGTCGC\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 177.2pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"236\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eGCCTCCTGCTCGTTCTGCT\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 70.95pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"95\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eTNF-\u0026alpha; (r)\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 205.5pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"274\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eACCATGAGCACGGAAAGCAT\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 177.2pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"236\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eAACTGATGAGAGGGAGCCCA\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 70.95pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"95\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eIL-1\u0026beta; (r)\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 205.5pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"274\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eAGTGAGGAGAATGACCTGTTC\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 177.2pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"236\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eCGAGATGCTGCTGTGAGATT\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 70.95pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"95\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eIL-6 (r)\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 205.5pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"274\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eGCCAGAGTCATTCAGAGCAATA\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 177.2pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"236\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eGTTGGATGGTCTTGGTCCTTAG\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 70.95pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"95\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eMCP-1 (r)\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 205.5pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"274\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eTCGGCTGGAGAACTACAAGA\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 177.2pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"236\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eGCTGAAGTCCTTAGGGTTGA\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 70.95pt; border: none; border-bottom: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"95\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eiNOS (r)\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 205.5pt; border: none; border-bottom: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"274\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eCTGCTTTGTGCGGAGTGTC\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 177.2pt; border: none; border-bottom: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"236\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-family: 'Arial',sans-serif; color: black;\"\u003eATTTCTTCCTGATAGAGGTGGT\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003e* h=huam; \u003csup\u003e#\u003c/sup\u003e r=rat.\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cstrong\u003e\u003cspan style=\"font-size: 14.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cspan style=\"font-size: 12.0pt; font-family: 'Arial',sans-serif; color: black;\"\u003eTable 3. Characteristics of patients.\u003c/span\u003e\u003c/p\u003e\n\u003ctable style=\"border-collapse: collapse; border: none;\"\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 154.25pt; border-top: solid windowtext 1.0pt; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"206\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003eParameters\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 127.6pt; border-top: solid windowtext 1.0pt; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"170\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003eEndometriosis (n = 37)\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 99.2pt; border-top: solid windowtext 1.0pt; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"132\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003eControls (n = 23)\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 45.05pt; border-top: solid windowtext 1.0pt; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"60\"\u003e\n\u003cp style=\"text-align: center; line-height: 200%;\"\u003e\u003cem\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003eP\u003c/span\u003e\u003c/sup\u003e\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 154.25pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"206\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003eAge (years), mean \u0026plusmn; SEM\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 127.6pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"170\"\u003e\n\u003cp style=\"text-align: center; line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003e33.5 \u0026plusmn; 1.0\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 99.2pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"132\"\u003e\n\u003cp style=\"text-align: center; line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003e30.6 \u0026plusmn; 1.2\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 45.05pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"60\"\u003e\n\u003cp style=\"text-align: center; line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003e0.07\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 154.25pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"206\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003eGravidity, median (rang)\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 127.6pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"170\"\u003e\n\u003cp style=\"text-align: center; line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003e3 (0-5)\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 99.2pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"132\"\u003e\n\u003cp style=\"text-align: center; line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003e2 (0-5)\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 45.05pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"60\"\u003e\n\u003cp style=\"text-align: center; line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003e0.16\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 154.25pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"206\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003eParity, median (rang)\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 127.6pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"170\"\u003e\n\u003cp style=\"text-align: center; line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003e1 (0-2)\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 99.2pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"132\"\u003e\n\u003cp style=\"text-align: center; line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003e1 (0-4)\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 45.05pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"60\"\u003e\n\u003cp style=\"text-align: center; line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003e0.94\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 154.25pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"206\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003eAbortion, median (rang)\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 127.6pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"170\"\u003e\n\u003cp style=\"text-align: center; line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003e2 (0-4)\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 99.2pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"132\"\u003e\n\u003cp style=\"text-align: center; line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003e1 (0-3)\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 45.05pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"60\"\u003e\n\u003cp style=\"text-align: center; line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003e0.06\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 154.25pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"206\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003eMenstrual cycle phase, n (%)\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 127.6pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"170\"\u003e\n\u003cp style=\"text-align: center; line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 99.2pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"132\"\u003e\n\u003cp style=\"text-align: center; line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 45.05pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"60\"\u003e\n\u003cp style=\"text-align: center; line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003e0.40\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 154.25pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"206\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003e\u0026nbsp;\u0026nbsp; Proliferative\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 127.6pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"170\"\u003e\n\u003cp style=\"text-align: center; line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003e29 (78.4)\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 99.2pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"132\"\u003e\n\u003cp style=\"text-align: center; line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003e20 (87.0)\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 45.05pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"60\"\u003e\n\u003cp style=\"text-align: center; line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 154.25pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"206\"\u003e\n\u003cp style=\"text-indent: 24.0pt; line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003eSecretory\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 127.6pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"170\"\u003e\n\u003cp style=\"text-align: center; line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003e8 (21.6)\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 99.2pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"132\"\u003e\n\u003cp style=\"text-align: center; line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif;\"\u003e3 (13.0)\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 45.05pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"60\"\u003e\n\u003cp style=\"text-align: center; line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif;\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 154.25pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"206\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003ePain symptoms, n (%)\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 127.6pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"170\"\u003e\n\u003cp style=\"text-align: center; line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003e18 (48.6)\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 99.2pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"132\"\u003e\n\u003cp style=\"text-align: center; line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif;\"\u003e0 (0)\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 45.05pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"60\"\u003e\n\u003cp style=\"text-align: center; line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif;\"\u003e\u0026lt;.0001\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 154.25pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"206\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003eInfertility, n (%)\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 127.6pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"170\"\u003e\n\u003cp style=\"text-align: center; line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003e9 (24.3)\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 99.2pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"132\"\u003e\n\u003cp style=\"text-align: center; line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003e4 (17.4)\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 45.05pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"60\"\u003e\n\u003cp style=\"text-align: center; line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003e0.53\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 154.25pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"206\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003er-AFS\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 127.6pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"170\"\u003e\n\u003cp style=\"text-align: center; line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 99.2pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"132\"\u003e\n\u003cp style=\"text-align: center; line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 45.05pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"60\"\u003e\n\u003cp style=\"text-align: center; line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 154.25pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"206\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003e\u0026nbsp; \u0026nbsp;\u0026nbsp;I-II, n (%)\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 127.6pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"170\"\u003e\n\u003cp style=\"text-align: center; line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003e17 (45.9)\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 99.2pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"132\"\u003e\n\u003cp style=\"text-align: center; line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003e-\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 45.05pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"60\"\u003e\n\u003cp style=\"text-align: center; line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 154.25pt; border: none; border-bottom: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"206\"\u003e\n\u003cp style=\"text-indent: 8.0pt; line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003e\u0026nbsp;\u0026nbsp;III\u003c/span\u003e\u003c/sup\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003e-IV, n (%)\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 127.6pt; border: none; border-bottom: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"170\"\u003e\n\u003cp style=\"text-align: center; line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003e20 (54.1)\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 99.2pt; border: none; border-bottom: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"132\"\u003e\n\u003cp style=\"text-align: center; line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003e-\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 45.05pt; border: none; border-bottom: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"60\"\u003e\n\u003cp style=\"text-align: center; line-height: 200%;\"\u003e\u003csup\u003e\u003cspan style=\"font-size: 16.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cstrong\u003e\u003cspan style=\"font-size: 14.0pt; line-height: 200%; font-family: 'Arial',sans-serif; color: black;\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Endometriosis, pain, Netrin-1, macrophage, polarization","lastPublishedDoi":"10.21203/rs.2.17387/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.2.17387/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eBackground: Endometriosis is a common disease in reproductive-age women and usually causes pelvic pain. Endometriosis pain is considered as a kind of neuropathic pain and infiltrating nerve fiber in endometriotic lesions may play an important role. Netrin-1 is widely reported as an axon guidance cue that regulates axonal attraction or rejection in neural injury and regeneration. In this study, we aim to determine the role of Netrin-1 in endometriosis-related pain. \u003c/p\u003e\u003cp\u003eMethods: Peripheral blood, peritoneal fluid, and endometrial tissues were sampled from women with (n=37) and without (n=23) endometriosis. Serum Netrin-1 concentrations, endometrial expression levels of Netrin-1 and its receptors including DCC, A2BAR, UNC5B, UNC5C and DSCAM were assessed. The polarization phenotypes of the peritoneal macrophages were identified by detecting the marker expression of M1 (CD86+) /M2 (CD163+) macrophages via flow cytometry. Lipopolysaccharide (LPS) and interferon gamma (IFN-γ) stimulated human monocytic cell line (THP-1) and rat alveolar macrophage-derived cell line (NR8383) cells to induce M1 phenotype macrophages. The expression levels of M1 markers and Netrin-1 in THP-1/NR8383 cells were determined. \u003c/p\u003e\u003cp\u003eResults: The expression levels of Netrin-1 in serum and endometriotic lesions were significantly higher in women with endometriosis when compared with those in women without endometriosis (P\u0026lt;.05), and both were correlated with pain symptoms (P\u0026lt;.05). Netrin-1 was co-expressed with CD 68 (a macrophage marker) in endometriotic lesions, and was synthesized and secreted by THP-1 and NR8383 cells in process of M1 polarization. In women with endometriosis, peritoneal macrophages were polarized towards M1 phenotype. In addition, increased expression of DCC and A2BAR, and decreased expression of UNC5B, UNC5C and DSCAM in endometriotic lesions were found. \u003c/p\u003e\u003cp\u003eConclusions: These results suggest that Netrin-1 production by macrophages in endometriotic lesions may play an important role in endometriosis pain. \u003c/p\u003e","manuscriptTitle":"Macrophage-derived Netrin-1 participates in endometriosis-associated pain","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2019-11-19 01:51:41","doi":"10.21203/rs.2.17387/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"bcf400cb-3195-4eba-9c20-ff5af27348cc","owner":[],"postedDate":"November 19th, 2019","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":36920,"name":"Neurobiology of Disease"}],"tags":[],"updatedAt":"","versionOfRecord":[],"versionCreatedAt":"2019-11-19 01:51:41","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8021","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"identity":"rs-8021","version":["v1"]},"buildId":"B-jG_2CBjPDmsCi4Wdhf-","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Condition tags

endometriosis

Citation neighborhood

Papers in the corpus that this work cites (lower rings, blue) and that cite this one (upper rings, green). Dot size scales with the paper's in-corpus citation count — bigger dot = more influential within the endo/adeno field. Click a dot to open that paper. [ expand to 2 hops ] — adds papers reached through this work's immediate citers/citees. Heavier; up to 60 extra dots.

References (53)

Source provenance

europepmc
last seen: 2026-07-26T06:47:03.852841+00:00
openalex
last seen: 2026-06-10T17:14:06.276822+00:00
License: CC0 · commercial use OK