Di-(2-ethylhexyl) phthalate induces endometriosis by modulating IGF-1 m6A methylation via the intestinal Odoribacter-butyric acid axis in female rats

article OA: gold CC0
AI-generated summary by claude@2026-06, 2026-06-08

DEHP exposure alters the gut microbiota to decrease butyrate, enhancing IGF-1 m6A methylation and promoting endometriosis via an epithelial-mesenchymal transition pathway in rats.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

AI-generated deep summary by claude@2026-06, 2026-06-12 · read from full text

This study used 60 female Wistar rats treated with di-(2-ethylhexyl) phthalate (DEHP) or DEHP plus sodium butyrate to assess whether DEHP induces endometriosis, evaluating ectopic lesions by small-animal ultrasound and profiling gut microbiota (16S rRNA V3–V4 sequencing) and fecal metabolites (HPLC-MS/MS, focused on short-chain fatty acids), alongside endometrial pathology and inflammation markers. Key findings reported include DEHP-associated changes in gut microbial composition/metabolites, increased inflammatory signaling (measured by TNF-α and interleukins), altered expression of epithelial/EMT-related proteins (E-cadherin, N-cadherin, Snail), and mRNA shifts in pathways including TLR4/NOD2, tight junction components, and an IGF-1/PI3K–Akt–mTOR axis with relevance to mRNA m6A methylation. A major caveat stated is that the DEHP dosing regimen (500 mg/kg/day) was chosen to induce lesions within a finite experimental window and explicitly does not represent typical human environmental exposures. The paper therefore links DEHP exposure to endometriosis through microbiota–metabolite changes and modulation of IGF-1 m6A methylation in rats, providing a direct mechanistic model for endometriosis. This paper is centrally about endometriosis — DEHP-induced endometriosis in female rats mediated by microbiota–butyrate pathways and IGF-1 m6A methylation.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Endometriosis, a complex gynecological disorder characterized by aberrant growth of endometrial tissue outside the uterine cavity, poses a significant challenge to women's health. Emerging evidence implicates environmental pollutants, particularly di-(2-ethylhexyl) phthalate (DEHP), as potential contributors to endometriosis development. However, the precise molecular mechanisms underlying this effect remain poorly understood. Herein, we investigated the role of intestinal Odoribacter/butyric acid-mediated m6A methylation in METTL3/IGF-1 signaling in DEHP-induced epithelial-mesenchymal transition (EMT) and endometriosis in a rat model. Our study demonstrated that DEHP exposure alters the gut microbiota composition, leading to modulation of METTL3-mediated m6A modification in the insulin-like growth factor 1 (IGF-1) pathway. This modification enhances EMT in endometrial cells and promotes endometriotic lesion formation. We used a multi-layered approach, including 16S rRNA sequencing, targeted metabolomics, MeRIP-seq, quantitative polymerase chain reaction, western blotting, and immunohistochemistry, to elucidate the mechanistic role of intestinal Odoribacter/butyric acid pathway-mediated METTL3/IGF-1 m6A modification in DEHP-induced endometriosis. The results revealed a significant shift in microbial diversity and a corresponding increase in METTL3/IGF-1 m6A methylation in DEHP-exposed rats, which was directly linked to EMT markers such as E-cadherin and N-cadherin. Our findings reveal a novel gut microbiota-mediated mechanism by which DEHP exposure drives endometriosis via m6A methylation, providing valuable insights into the environmental and molecular basis of the disease. This study not only advances our understanding of the role of DEHP in endometriosis pathogenesis, but also suggests a putative intestinal Odoribacter-butyrate-METTL3/IGF-1 axis that may contribute to disease progression. However, these associations remain correlative, and causality requires further validation through functional experiments.
Full text 50,502 characters · extracted from pmc-nxml · 9 sections · click to expand

Author

Xiuying Li and Te Liu designed the study. Hailing Yang conducted the experiments. Chunmei Zhang and Yanxiu Sha extracted and analyzed the data. Hailing Yang and Te Liu drafted the manuscript. Xiuying Li and Te Liu reviewed and corrected the manuscript. Chunmei Zhang polished the manuscript. Yanxiu Sha performed literature search, and provided valuable comments. All authors contributed to the article and approved the final manuscript.

Ethical

The experiment was conducted at the Jilin University Laboratory Animal Centre (SYXK (JI) 2021–0006), supervised by the Animal Ethics and Welfare Committee of Jilin University (IACUC), with Ethics Approval No KT202302015. The experiment adhered to the ethical guidelines of Jilin University and national regulations regarding the welfare of experimental animals, ensuring that the animals had access to water and food. The study adhered to the principles of the Helsinki Declaration.

Funding

This work was supported by the 10.13039/501100013061 Jilin Scientific and Technological Development Program (Grant No 20240404029ZP ), the 10.13039/501100009991 Department of Finance of Jilin Province (Grant No 2024SCZ20 ), and the construction project of Chun Lei plan of China-Japan Union Hospital of Jilin University (Grant No 2023CL06 ).

Results

As shown in Fig. 1 , 16S rRNA gene sequencing was performed on fecal samples collected from rats with DEHP-induced endometriosis and controls rats. The results revealed a significant decrease in the abundance of the key genus Odoribacter in the DEHP group. Odoribacter maintains intestinal immune homeostasis by producing SCFAs, such as butyrate. Based on this observation, targeted metabolomic analysis was conducted to profile the SCFAs in fecal samples. The results showed a marked reduction in butyrate levels in the DEHP group compared to the control group. These findings suggest that DEHP exposure may lead to gut microbiota dysbiosis, and that butyrate could be a potential intervention target for the prevention and treatment of endometriosis. Fig. 1 16S rRNA Gene Sequencing and Targeted Metabolomic Analysis. (A)Principal Coordinates Analysis (PCoA);(B)Relative Abundance at the Phylum Level;(C)Relative Abundance at the Genus Level;(D)Heatmap of Differential Microbial Communities;(E) LEfSe Differential Analysis;(F)Significantly Different Bacterial Taxa at the Phylum Level;(G) LDA Scores;(H)Heatmap of Short-Chain Fatty Acid Metabolites. Fig. 1 16S rRNA Gene Sequencing and Targeted Metabolomic Analysis. (A)Principal Coordinates Analysis (PCoA);(B)Relative Abundance at the Phylum Level;(C)Relative Abundance at the Genus Level;(D)Heatmap of Differential Microbial Communities;(E) LEfSe Differential Analysis;(F)Significantly Different Bacterial Taxa at the Phylum Level;(G) LDA Scores;(H)Heatmap of Short-Chain Fatty Acid Metabolites. Ultrasound examination of DEHP-exposed rats revealed ectopic lesions within the abdominal cavity ( Fig. 2 A). Laparotomy revealed that these ectopic lesions were located on the abdominal wall and presented as either transparent cystic formations ( Fig. 2 B) or red nodular structures ( Fig. 2 C). H&E staining revealed that the ectopic endometrial glands were few, cystic, and showed inflammatory exudate. In contrast, the control and NaB-pretreated groups exhibited in situ endometrial tissue; the control group displayed abundant glands with regular stromal arrangement and normal vascular distribution, and the NaB group showed partial glandular atrophy without ectopic lesions ( Fig. 2 D). H&E staining of the small intestine tissue in the DEHP group showed disorganized or shed villous epithelial cells with substantial infiltration of inflammatory cells ( Fig. 2 E). These findings indicate that DEHP exposure may induce endometriosis and inflammatory responses in intestinal tissue, whereas NaB pretreatment may exert a partial inhibitory effect. Fig. 2 Morphological Observations of Ectopic Endometrial and Small Intestinal Tissues Induced by DEHP Exposure. (A) Small-animal ultrasound of abdominal ectopic lesions; (Ultrasound imaging was used to confirm induction of ectopic lesions and was not performed as serial longitudinal imaging across multiple timepoints.) (B) White cystic ectopic endometrium; (C) Red nodular ectopic endometrium; (D) Endometrial tissue stained with H&E (× 100); (E) Small intestinal tissue stained with H&E (× 100). Fig. 2 Morphological Observations of Ectopic Endometrial and Small Intestinal Tissues Induced by DEHP Exposure. (A) Small-animal ultrasound of abdominal ectopic lesions; (Ultrasound imaging was used to confirm induction of ectopic lesions and was not performed as serial longitudinal imaging across multiple timepoints.) (B) White cystic ectopic endometrium; (C) Red nodular ectopic endometrium; (D) Endometrial tissue stained with H&E (× 100); (E) Small intestinal tissue stained with H&E (× 100). ELISA results indicated that DEHP significantly upregulated the serum levels of the inflammatory cytokines TNF-α, IL-1β, IL-6, IL-8, and IL-17 in female rats ( Fig. 3 A). Additionally, DEHP exposure increased the serum levels of the endometriosis markers CA125, EMAb, and VEGF ( Fig. 3 B) ( p < 0.05). CA125, EMAb, and VEGF were useful biomarkers for the early diagnosis of endometriosis, suggesting that DEHP contributes to the development of endometriosis by promoting inflammatory responses. qPCR was used to assess the impact of DEHP exposure on the mRNA expression of the intestinal genes toll-like receptor 4 (TLR4), nucleotide-binding oligomerization domain 2 (NOD2), claudins, and occludins in rats ( Fig. 3 C). The mRNA expression levels of intestinal factors in the DEHP exposure group were significantly higher than those in the control and NaB groups ( p < 0.05). These findings indicate that DEHP may alter the intestinal microenvironment by activating immune responses and disrupting gut barrier function. Fig. 3 AB. Expression Levels of Inflammatory Cytokines and Endometriosis Markers in Serum in Female Rats. Including TNF-α, IL-1β, IL-6, IL-8, IL-17(3A), and Endometriosis marker CA125, EMAb, VEGF(3B). All data are expressed as mean ± SEM ( n = 12). a P <0.05, vs Control group; b P <0.05, vs DEHP group; a Significant difference compared with control group ( P < 0.05); b significant difference compared with DEHP group ( P < 0.05). C. Intestinal Gene Expression in Female Rats. Including Intestinal TLR4 mRNA, NOD2 mRNA, Claudin mRNA, and Occludin mRNA expression levels. All data are expressed as mean ± SEM ( n = 6). a P <0.05, vs Control group; b P <0.05, vs DEHP group; a Significant difference compared with control group ( P < 0.05); b significant difference compared with DEHP group ( P < 0.05). Fig. 3 AB. Expression Levels of Inflammatory Cytokines and Endometriosis Markers in Serum in Female Rats. Including TNF-α, IL-1β, IL-6, IL-8, IL-17(3A), and Endometriosis marker CA125, EMAb, VEGF(3B). All data are expressed as mean ± SEM ( n = 12). a P <0.05, vs Control group; b P <0.05, vs DEHP group; a Significant difference compared with control group ( P < 0.05); b significant difference compared with DEHP group ( P < 0.05). C. Intestinal Gene Expression in Female Rats. Including Intestinal TLR4 mRNA, NOD2 mRNA, Claudin mRNA, and Occludin mRNA expression levels. All data are expressed as mean ± SEM ( n = 6). a P <0.05, vs Control group; b P <0.05, vs DEHP group; a Significant difference compared with control group ( P < 0.05); b significant difference compared with DEHP group ( P < 0.05). Immunohistochemistry was used to examine the expression of E-cadherin, N-cadherin, and Vimentin in rats ( Fig. 4 A). Compared to the control and NaB groups, the DEHP-exposed group exhibited reduced E-cadherin immunostaining intensity with a significantly decreased IOD value, whereas N-cadherin and Snail staining intensities increased with a significant increase in IOD values. qPCR was conducted to assess the effect of DEHP exposure on the mRNA expression of endometrial genes, including Slug, Snail, Twist, adhesion molecules (VCAM-1 and ICAM-1), invasion factors (MMP and TIMP), and angiogenic factors (VEGF) ( Fig. 4 B). The mRNA expression levels of endometrial-related factors in the DEHP exposure group were significantly higher than those in the control and NaB groups ( p < 0.05). Fig. 4 A. Expression Levels of EMT-Related Markers in Rat Endometrial Tissue. Immunohistochemistry (× 100) was used to examine the expression of E-cadherin, N-cadherin, and Snail in rats. All data are expressed as mean ± SEM ( n = 6). a P <0.05, vs Control group; b P <0.05, vs DEHP group; a Significant difference compared with control group ( P < 0.05); b significant difference compared with DEHP group ( P < 0.05). B. qPCR was conducted to assess the impact of DEHP exposure on the mRNA expression of endometrial genes, including Slug, Snail, Twist, adhesion molecules (VCAM-1 and ICAM-1), invasion factors (MMP and TIMP), and angiogenic factor (VEGF) in rats. All data are expressed as mean ± SEM ( n = 6). a P <0.05, vs Control group; b P <0.05, vs DEHP group; a Significant difference compared with control group ( P < 0.05); b significant difference compared with DEHP group ( P < 0.05). Fig. 4 A. Expression Levels of EMT-Related Markers in Rat Endometrial Tissue. Immunohistochemistry (× 100) was used to examine the expression of E-cadherin, N-cadherin, and Snail in rats. All data are expressed as mean ± SEM ( n = 6). a P <0.05, vs Control group; b P <0.05, vs DEHP group; a Significant difference compared with control group ( P < 0.05); b significant difference compared with DEHP group ( P < 0.05). B. qPCR was conducted to assess the impact of DEHP exposure on the mRNA expression of endometrial genes, including Slug, Snail, Twist, adhesion molecules (VCAM-1 and ICAM-1), invasion factors (MMP and TIMP), and angiogenic factor (VEGF) in rats. All data are expressed as mean ± SEM ( n = 6). a P <0.05, vs Control group; b P <0.05, vs DEHP group; a Significant difference compared with control group ( P < 0.05); b significant difference compared with DEHP group ( P < 0.05). Quantitative m6A qPCR analysis of endometrial tissue revealed that DEHP exposure led to elevated m6A methylation levels with significant upregulation of METTL3 and YTHDF1 ( Fig. 5 ). Fig. 5 m6A Methylation Levels in Endometrial Tissues of Different Rat Groups. (A) m6A % contentin in total RNA; (B) METTL3; (C) METTL14; (D) ALKBH; (E) YTHDF1; (F) YTHDF2; (G) YTHDF3; (H) FTO; (I) WTAP. All data are expressed as mean ± SEM ( n = 6). a P <0.05, vs Control group; b P <0.05, vs DEHP group; a Significant difference compared with control group ( P < 0.05); b significant difference compared with DEHP group ( P < 0.05). Fig. 5 m6A Methylation Levels in Endometrial Tissues of Different Rat Groups. (A) m6A % contentin in total RNA; (B) METTL3; (C) METTL14; (D) ALKBH; (E) YTHDF1; (F) YTHDF2; (G) YTHDF3; (H) FTO; (I) WTAP. All data are expressed as mean ± SEM ( n = 6). a P <0.05, vs Control group; b P <0.05, vs DEHP group; a Significant difference compared with control group ( P < 0.05); b significant difference compared with DEHP group ( P < 0.05). RNA-seq analysis was performed on ectopic endometrial tissue from the DEHP-exposed and control groups, revealing a significant upregulation in m6A-related factors METTL3 and YTHDF1 in the DEHP group, along with increased IGF-1 expression ( Fig. 6 A and 6 C). GO enrichment analysis indicated a strong association between DEHP-induced endometriosis and the EMT pathway ( Fig. 6 B), whereas KEGG enrichment analysis identified the IGF-1 signaling pathway as a critical component in this process ( Fig. 6 D). These findings suggest that m6A modifications mediated by METTL3 and YTHDF1 may induce endometriosis by influencing EMT, with the IGF-1 signaling pathway playing a pivotal role in this mechanism. MeRIP-seq analysis was conducted to identify target mRNAs modified by m6A, revealing a significant increase in m6A abundance within the 3′ UTR region of IGF-1 mRNA in the DEHP group ( Fig. 7 A-F) (these MeRIP-seq data indicate enrichment consistent with m6A modification at the IGF-1 3′UTR under DEHP exposure; however, they remain associative and do not establish causality for IGF-1 regulation by METTL3). These findings suggest that IGF-1 is a potential m6A target, and that the IGF-1 signaling pathway is an enriched associated pathway. Fig. 6 Analysis of RNA-seq Results in Endometrial Tissue. (A) Heatmap of Differentially Expressed Genes (DEGs); (B) Gene Ontology (GO) Enrichment Analysis; (C) Volcano Plot of DEGs; (E) Kyoto Encyclopedia of Genes and Genomes (KEGG) Enrichment Analysis. Fig. 6 Fig. 7 Identification of m6A Targets via MeRIP-seq Analysis. (A)Motif enrichment analysis; (B)Venn diagram;(C) Two-dimensional volcano plot; (D) m6A Peak Distribution; (E) KEGG Enrichment Analysis;(F) Circos plot. A Circos plot representing the relationship between m6A-modified genes and their associated pathways. This visualization shows how different m6A-modified genes are interconnected with various biological processes, offering a comprehensive view of the pathways influenced by m6A modifications. Fig. 7 Analysis of RNA-seq Results in Endometrial Tissue. (A) Heatmap of Differentially Expressed Genes (DEGs); (B) Gene Ontology (GO) Enrichment Analysis; (C) Volcano Plot of DEGs; (E) Kyoto Encyclopedia of Genes and Genomes (KEGG) Enrichment Analysis. Identification of m6A Targets via MeRIP-seq Analysis. (A)Motif enrichment analysis; (B)Venn diagram;(C) Two-dimensional volcano plot; (D) m6A Peak Distribution; (E) KEGG Enrichment Analysis;(F) Circos plot. A Circos plot representing the relationship between m6A-modified genes and their associated pathways. This visualization shows how different m6A-modified genes are interconnected with various biological processes, offering a comprehensive view of the pathways influenced by m6A modifications. qPCR was performed to assess the m6A methylation levels of IGF-1 pathway-related genes in endometrial tissue. The results showed that DEHP exposure significantly increased m6A levels in the IGF-1 signaling pathway, accompanied by a marked upregulation of Snail expression ( Fig. 8 A). Western blot analysis further confirmed that DEHP significantly elevated the protein expression levels of IGF-1 pathway components compared to those in the control and NaB groups ( Fig. 8 B and C). Although the IGF-1 pathway and EMT readouts indicate involvement, these findings should be interpreted as confirmatory associations rather than definitive mechanistic evidence. These findings suggest that DEHP activates IGF-1 mRNA methylation via METTL3, thereby enhancing the regulatory effect of this pathway on Snail. Notably, NaB treatment effectively downregulated the expression of both the IGF-1 pathway and Snail. Fig. 8 Analysis of m6A Methylation and Protein Expression Levels of IGF-1 Pathway-Related Genes.(A)Analysis of m6A Methylation Levels of IGF-1 Pathway-Related Genes;(B) Protein Expression Levels of the IGF-1 Pathway;(C) Representative Western Blot Bands. All data are expressed as mean ± SEM ( n = 6). a P <0.05, vs Control group; b P <0.05, vs DEHP group; a Significant difference compared with control group ( P < 0.05); b significant difference compared with DEHP group ( P < 0.05). Fig. 8 Analysis of m6A Methylation and Protein Expression Levels of IGF-1 Pathway-Related Genes.(A)Analysis of m6A Methylation Levels of IGF-1 Pathway-Related Genes;(B) Protein Expression Levels of the IGF-1 Pathway;(C) Representative Western Blot Bands. All data are expressed as mean ± SEM ( n = 6). a P <0.05, vs Control group; b P <0.05, vs DEHP group; a Significant difference compared with control group ( P < 0.05); b significant difference compared with DEHP group ( P < 0.05).

Materials

Sixty healthy female Wistar rats aged 2–3 months were randomly assigned to three groups (20 rats per group): the negative control (corn oil), DEHP (500 mg/kg/d DEHP, representing 1/60 of the LD 50 , administered continuously until endometriosis was detected via ultrasound; this regimen facilitates lesion induction and pathway readouts within a finite window and is not intended to represent typical human environmental exposures), and DEHP + NaB (sodium butyrate, 1 g/kg/d). Daily vaginal smears were collected, and the general behavior, activity levels, coat condition, secretions, and mortality of the animals were observed. After the exposure period, the rats were euthanized during the first estrous phase following a stable estrous cycle. Blood, intestines, feces, ectopic endometrial tissue, and uterine samples were collected and preserved. To optimize the observation of toxic effects and mechanisms, a DEHP dose of 500 mg/kg/d was selected based on previous research and human-to-mouse equivalent dose ratios calculated using body surface area. To minimize unnecessary animal mortality, high-resolution small-animal ultrasound was used to confirm successful induction of endometriotic lesions following DEHP treatment. Rat fecal samples were collected to analyze their gut microbiota and metabolites. Genomic DNA was extracted using a Qiagen kit, and V3–V4 regions of the 16S rRNA gene were amplified and sequenced using Illumina MiSeq. Sequencing data were processed using QIIME2 and DADA2 for denoising and OTU clustering, and taxonomic assignment was based on the SILVA 138 database. The differential taxa were identified using LEfSe. Additionally, fecal microbial metabolites were analyzed using HPLC-MS/MS after extraction using the methanol–chloroform method. Data were processed using Thermo Xcalibur software, with a focus on quantifying short-chain fatty acids (SCFAs) and comparing the DEHP-exposed and control groups. Samples of ectopic uterine tissue, in situ endometrium, and small intestine from the rats were fixed in 4 % paraformaldehyde, followed by gradient dehydration in ethanol, clearing in xylene, and embedding in paraffin. Sections of 5 μm thickness were prepared, stained with H&E, and mounted with a neutral resin cover slip. The stained sections were observed under a light microscope to assess pathological changes within the tissues. Serum levels of tumor necrosis factor-alpha (TNF-α), interleukin (IL)-1β, IL-6, IL-8, IL-17, cancer antigen 125 (CA125), anti-endometrial antibody (EMAb), and vascular endothelial growth factor (VEGF) were measured using enzyme-linked immunosorbent assay (ELISA) kits(Thermo Fisher, USA) in accordance with the manufacturer’s protocols. Serum samples and standards were added to wells precoated with specific antibodies, followed by incubation, washing, and detection using a substrate solution. The optical density was measured at 450 nm, and the concentrations were calculated using a standard curve. Immunohistochemistry was used to examine the expression of E-cadherin, N-cadherin, and Snail in the ectopic and eutopic endometrial tissues of rats. Paraffin-embedded sections were deparaffinized, rehydrated, subjected to antigen retrieval, and blocked. Primary antibodies against E-cadherin, N-cadherin, and Snail were applied, followed by incubation with horseradish peroxidase-conjugated secondary antibodies. 3,3′-Diaminobenzidine was used for color development, and the sections were counterstained with hematoxylin. The expression levels were evaluated under a light microscope. mRNA expression levels were assessed using real time quantitative polymerase chain reaction (qPCR). Total RNA was extracted using TRIzol reagent, and reverse transcription was performed. qPCR was conducted using SYBR Green PCR Master Mix with GAPDH as an internal control. GAPDH was selected based on its consistent expression across experimental conditions and its extensive validation in reproductive and endocrine-related gene expression studies. Relative gene expression was calculated using the 2^-ΔΔCt method and expressed as fold changes relative to the control group. The primer sequences are listed in Table 1 . Table 1 Gene-specific forward and reverse primer sequence. Table 1 Gene Forward (F) Reverse (R) TLR4 5′- AAGTTATTGTGGTGGTGTCCCA −3′ 5′- GCTGAAGGGACTTCCTGCTG −3′ NOD2 5′- CAGTTCCACCGATGGAGGAG −3′ 5′- TCTCAGGTTGATGAGTGGCG −3′ Claudin 5′- GATGGCCAGGTGGTCTACTG −3′ 5′- AGACACGCTTCTGGTAGGGG −3′ Occludin 5′- CCGGGAATGTGAGGATCAGA −3′ 5′- CCACTTGTGGAACAGCAGGAG −3′ Slug 5′- ATACCCAGACTCAGATCCCA −3′ 5′- TGTTGAGCACAGTGAATGGG −3′ Snail 5′- GGAGCATCCACGCCGGTG −3′ 5′- TGATCGGTGGGTTGCTTGT −3′ Twist 5′- GTCGACTTCACGCCTTCTCA −3′ 5′- CCTTGGAGTTATCCAGCCGA −3′ VCAM-1 5′- TGGAAATCCTGTGACGGAAG −3′ 5′- CCGTCAAGGTTCAACACGAT −3′ ICAM-1 5′- ACTGTGCTGAACGGGAGTGG −3′ 5′- GCAGCGTAGGGTAAGGTTCC −3′ MMP-9 5′- GGATCCAGGACACCCTTACG −3′ 5′- TGCGGTACAGGTTTTGCAGG −3′ TIMP-1 5′- GATGGCCTCTGGCATCCTG −3′ 5′- CCTCCACGAGTGGAAGCCAA −3′ VEGF 5′- GGAGTGTGTGCCAGATGCTG −3′ 5′- GTGAGGTTTGATCCGCATGC −3′ IGF-1 5′- GCACTCTGCTTGCTCACCTT −3′ 5′- CTTGGTCCACACACGAACTG −3′ PI3K 5′- ATCAGCAAGACACCGGAAAC −3′ 5′- CGGACCTAATCGGTGGTAGA −3′ Akt 5′- CCTCAAGAATGATGGCACCT −3′ 5′- TGCCACTGAGAAGTTGTTGAGT −3′ mTOR 5′- GCCAACTACCTTCGGAACCT −3′ 5′- TCGCTTCACTTCAAACTCCA −3′ Snail 5′- GGAGCATCCACGCCGGTG −3′ 5′- TGATCGGTGGGTTGCTTGT −3′ Gene-specific forward and reverse primer sequence. Endometrial RNA was extracted and used for library preparation to identify differentially expressed genes between groups ( p 2). Total RNA was extracted from endometrial tissues using an RNeasy Mini Kit (Qiagen, Hilden, Germany). RNA integrity and concentration were assessed using an Agilent 2100 Bioanalyzer and NanoDrop 2000. Libraries were prepared using the NEBNext Ultra RNA Library Prep Kit and sequenced using an Illumina NovaSeq 6000. The data were processed using Trimmomatic, HISAT2, and StringTie software. Differentially expressed genes (DEGs) were identified using DESeq2 ( p 2). Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses were performed to elucidate biological processes and pathways. The isolated ectopic endometrial mRNA was chemically fragmented into 200-nucleotide segments and subjected to immunoprecipitation using m6A antibodies. Deep sequencing was performed on the eluted RNA and m6A-enriched RNA using the Illumina NovaSeq 6000 platform to identify m6A-modified target genes. Total RNA was fragmented and immunoprecipitated using anti-m6A antibodies. Input and m6A-bound RNAs were purified, and cDNA libraries were constructed. Sequencing was performed using an Illumina NovaSeq 6000 system. Data analysis included peak calling using exomePeak2, and KEGG pathway enrichment analysis was conducted to identify pathways regulated by m6A-modified genes. qPCR was used to measure the m6A RNA modification levels of METTL3, YTHDF1, IGF-1, PI3K, Akt, mTOR, and Snail mRNAs across the groups. Total RNA was extracted and treated with DNase I. Reverse transcription was performed using a PrimeScript RT Reagent Kit. qPCR was performed using the SYBR Premix Ex Taq Kit, with GAPDH as an internal control. Relative expression was calculated using the 2^(-ΔΔCt) method, with statistical significance set at p < 0.05. The expression levels of insulin-like growth factor 1 (IGF-1), phosphoinositide 3-kinase (p-PI3K), phosphorylated Akt (p-Akt), phosphorylated mammalian target of rapamycin (p-mTOR), and Snail from rat endometrial tissue were detected using western blotting. The primary antibodies used included mouse anti-IGF-1 (1:500, Proteintech, USA), rabbit anti-p-PI3K (1:1000, Abcam, USA), rabbit anti-Akt (1:500, Abcam, USA), rabbit anti-p-Akt (1:1000, Abcam, USA), rabbit anti-p-mTOR (1:1000, Abcam, USA), and rabbit anti-Snail (1:1000, Abcam, USA). β-actin (1:2000, Proteintech, USA) was used as an internal control for normalization. Following incubation with fluorescently labeled secondary antibodies, the relative band intensities were quantified using ImageJ software. All data are presented as mean ± standard error of the mean (SEM). Statistical differences between the groups were examined using one-way analysis of variance (ANOVA) with GraphPad Prism software 9.0. To ascertain the location of significant pairwise differences in cases where the overall F-tests yielded significant results ( p < 0.05), post-hoc comparisons using Tukey's method of adjustment were performed.

Conclusion

In a short-term model, DEHP induces alterations in systemic inflammation by suppressing the intestinal Odoribacter /butyrate pathway, thereby promoting METTL3-mediated m6A methylation of IGF-1. This enhances the recognition and activation of methylated IGF-1 by YTHDF1, leading to the upregulation of Snail, which subsequently influences the initiation and progression of endometrial EMT, ultimately contributing to the development of endometriosis. This study investigated the molecular mechanisms by which DEHP induces endometriosis, offering novel insights and potential therapeutic targets for the prevention and treatment of endometriosis. Overall, our findings provide a comprehensive scientific evaluation of the toxicological effects of DEHP and its potential risks to the female reproductive system. Longitudinal, environmentally relevant studies are required to determine whether lesions are progressive, stable, or recurrent over time.

Discussion

Endometriosis, characterized primarily by infertility and pain, poses a significant threat to female reproductive health( Taylor, Kotlyar, and Flores, 2021 ). Its etiology and pathogenesis are complex and multifactorial, predominantly driven by endocrine dysfunction, making the identification of new therapeutic targets an urgent medical challenge( Horne and Missmer, 2022 ). Although endometriosis is benign, it shares characteristics with malignant tumors, including adhesion, invasion, and angiogenesis, all of which contribute to its formation( Salliss, Farland, Mahnert, and Herbst-Kralovetz, 2021 ). Studies have shown that EMT plays a crucial role in the development and progression of endometriosis(C. Zhang et al., 2021 ). Ectopic endometrial angiogenesis supplies oxygen and nutrients, whereas alterations in local hormone metabolism contribute to lesion formation( Bourdon et al., 2021 ). Given the alignment between EMT and the biological characteristics of ectopic endometrial implantation, invasion, and metastasis, understanding the regulatory mechanisms of EMT is crucial for advancing endometrial research. Animal experiments have demonstrated that DEHP enhances the proliferative activity of human uterine leiomyoma cells, increases the expression of antiapoptotic proteins and cyclooxygenase-2, and promotes endometrial vascular dilation and stromal cell proliferation, leading to the induction of endometriosis. Additionally, DEHP significantly increases ectopic endometrial size in mice(S. H. Kim et al., 2015 )and increases the activity of MMP-2 and MMP-9 in endometrial cells( Arablou et al., 2021 ). Herein, we observed that DEHP induces endometriosis in female rats. Ultrasonography revealed ectopic lesions within the abdominal cavity. Laparotomy confirmed that these lesions were located on the abdominal wall and presented as either transparent cysts or red nodular structures. In the DEHP-exposed group, the serum inflammatory cytokines TNF-α, IL-1β, IL-6, IL-8, and IL-17 were significantly elevated. Additionally, the levels of CA125, EMAb, and VEGF were markedly higher than those in the control group. Because CA125, EMAb, and VEGF contribute to the early diagnosis of endometriosis, these findings suggest that DEHP exposure can induce endometrial EMT. However, the underlying mechanisms have not yet been fully elucidated. Therefore, an in-depth investigation into the molecular mechanisms underlying DEHP-induced endometriosis was pursued to pave the way for future preventative and treatment strategies of the disease. Notably, several gut taxa can produce butyrate, and butyrate is one among multiple SCFAs influencing endometrial biology. Thus, while this study investigates the association among Odoribacter , butyrate, and METTL3/IGF-1–m6A signaling under DEHP exposure, these links should be considered hypothesis-generating rather than conclusive. In the DEHP-exposed group, EMT markers showed significant alterations. E-cadherin expression was markedly decreased, whereas N-cadherin and Snail expression were elevated. DEHP exposure significantly increased the mRNA expression levels of key endometrial EMT markers, including Slug, Snail, and Twist, as well as adhesion molecules (VCAM-1 and ICAM-1), invasion factors (MMP and TIMP), and the angiogenic factor VEGF compared to the control group, consistent with previous findings( Arablou et al., 2021 ). These findings suggest that DEHP exposure may contribute to the development of endometriosis by activating EMT in endometrial tissue. DEHP is primarily ingested orally and exerts toxic effects after absorption in the gastrointestinal tract. It has been shown to cause neurofunctional impairments via the microbiota–gut–brain axis( Balaguer-Trias et al., 2022 ). DEHP may alter the composition of gut microbiota in neonates, potentially affecting immune responses later in adulthood( Singh et al., 2022 ). Animal studies have demonstrated that DEHP exposure alters the composition and metabolites of fecal microbiota in mice, disrupts intestinal tight junctions, and increases LPS-induced systemic inflammation, ultimately leading to female reproductive toxicity( Fu et al., 2021 ). These findings suggest that DEHP exposure may result in the dysbiosis of the gut microbiota and may alter microbial metabolite profiles. Based on these observations, we used 16S rRNA gene sequencing and targeted metabolomic analysis to reveal that DEHP exposure alters the composition and metabolic function of the gut microbiota in rats. Fecal samples collected from rats with DEHP-induced endometriosis and control rats were subjected to 16S rRNA sequencing, revealing a significant reduction in the abundance of Odoribacter in the DEHP group. Previous studies indicated that Odoribacter maintains intestinal immune homeostasis by producing SCFAs, such as butyrate( Jiang et al., 2021 ). Accordingly, we performed targeted metabolomic profiling of SCFAs and found significantly decreased butyrate levels in the DEHP group. As a key SCFA, butyrate plays a protective role by reducing the translocation of bacterial metabolites (e.g., LPS) into the bloodstream, thereby limiting excessive immune activation and maintaining gut barrier integrity. It is also involved in suppressing EMT and alleviating inflammation( Marlicz and Rydzewska, 2024 ; Zeng et al., 2025 ). In this study, NaB supplementation effectively alleviated the DEHP-induced increases in intestinal permeability and endometrial EMT. While direct experimental evidence of Odoribacter -specific butyrate production was not obtained in this study, previous research has identified Odoribacter as a key butyrate-producing bacterium in the gut microbiota. Our findings of reduced Odoribacter abundance in DEHP-exposed rats, along with decreased butyrate levels in fecal samples, suggest that DEHP-induced dysbiosis may lead to a reduction in butyrate production, potentially exacerbating the inflammatory environment and contributing to the pathogenesis of endometriosis. These findings suggest that DEHP may alter the pelvic microenvironment and promote the development of endometriosis by modulating systemic inflammation or hormone levels via the Odoribacter /butyrate pathway. Gut microbiota significantly affect the function and health of the small intestine by regulating the expression of various genes involved in inflammatory responses, immune modulation, barrier function, and nutrient absorption(J. Yang and Liu, 2022 ). This study found that the expression levels of TLR4, NOD2, claudin, and occludin were significantly higher in the DEHP-treated group than those in the control and NaB groups, suggesting that DEHP may alter the intestinal environment by activating immune responses and affecting gut barrier function. TLR4 specifically recognizes LPS from Gram-negative bacteria and is activated during gut inflammation to promote the release of proinflammatory cytokines( Ouyang et al., 2022 ; Pérez-Ortega et al., 2023 ). During inflammation, NOD gene expression is typically upregulated, which induces proinflammatory cytokine production and enhances host defense responses( Mukherjee et al., 2019 ). DEHP exposure may disrupt gut microbiota balance by upregulating NOD2 expression. Claudins and occludins are critical tight junction proteins that play major roles in maintaining epithelial barrier function and cell polarity(Q. Wang et al., 2021 ). During intestinal inflammation, the expression of these proteins decreases, leading to impaired barrier function and increased permeability, thereby allowing more pathogens and toxins to enter the body, in turn exacerbating the inflammatory response. In summary, DEHP exposure may adversely affect host health by disrupting gut immune responses and barrier function through the altered expression of TLR4, NOD2, claudins, and occludins, with butyric acid intervention alleviating the associated intestinal inflammatory response. Butyrate, a histone deacetylase inhibitor, alters the RNA methylation status by modulating the expression of m6A regulatory enzymes( Baldwin, Li, Jia, and Li, 2018 ). Studies have shown that the transcription factor Snail, which regulates EMT, is modulated by m6A methylation levels. METTL3 deficiency leads to decreased m6A modification of Snail, thereby suppressing EMT in tumor cells, confirming the involvement of m6A in this process( Liu et al., 2022 ). Butyrate has been reported to reduce METTL3 expression, resulting in decreased m6A levels and the inhibition of EMT(K. Zhang et al., 2023 ). Additionally, DEHP has been shown to affect telomere function in male germ cells by upregulating METTL3-mediated m6A modification of Hmbox1( Zhu et al., 2022 ). However, the role of m6A modifications in DEHP-induced female reproductive toxicity remains largely unexplored. Therefore, investigating the m6A-dependent regulatory mechanisms of DEHP-induced EMT may provide critical insights into its underlying pathogenesis. Herein, DEHP significantly increased the overall m6A levels, accompanied by a marked upregulation of METTL3 and YTHDF1 expression. These findings suggest that m6A modifications contribute to the development of endometriosis by influencing EMT, with METTL3 and YTHDF1 playing crucial roles in this mechanism. MeRIP-seq analysis was performed to further identify METTL3-mediated m6A-modified target mRNAs. The results indicated that DEHP exposure significantly increased m6A abundance in the 3′ UTR region of IGF-1 mRNA, accompanied by elevated IGF-1 expression levels. These findings suggest that IGF-1 is a potential m6A target. Previous studies have demonstrated that IGF-1 is associated with endometriosis and is highly expressed in ectopic endometrial tissue. IGF-1 contributes to endometriosis by promoting proliferation, invasion, and apoptosis inhibition through its downstream PI3K/Akt/mTOR pathway( Heidari, Kolahdouz-Mohammadi, Khodaverdi, Mohammadi, and Delbandi, 2022 ). Activation of mTOR stabilizes the key EMT regulatory protein Snail, preventing its proteasomal degradation(S. Zhang et al., 2019 ). We further investigated the effects of DEHP exposure on m6A methylation levels and protein expression of IGF-1 pathway-related genes in rat endometrial tissue. The results demonstrated that DEHP exposure significantly altered m6A methylation levels of IGF-1 pathway genes and markedly upregulated Snail expression. qPCR analysis revealed increased m6A methylation levels in IGF-1, PI3K, Akt, mTOR, and Snail, confirming the potential role of m6A modification in the regulation of these key genes. Western blot analysis further validated the qPCR results, showing that DEHP significantly increased the protein expression levels of IGF-1 pathway components (IGF-1, PI3K, Akt, mTOR, and Snail) compared to those in the control and NaB-treated groups. These results indicate that DEHP may promote the onset and progression of endometriosis by inducing inflammatory responses through the intestinal Odoribacter /butyrate pathway, which in turn activates METTL3-mediated m6A modification; however, causality has not been established. Previous studies have established a link between the IGF-1 signaling pathway and endometriosis, particularly in relation to cell proliferation, angiogenesis, and inflammatory microenvironment modulation( Chen et al., 2023 ; Forster et al., 2019 ; Heidari, Kolahdouz-Mohammadi, Khodaverdi, Tajik, and Delbandi, 2021 ; Smolarz et al., 2024 ). IGF-1 is highly expressed in ectopic endometrial tissue of patients with endometriosis and plays a critical role in promoting cell proliferation, invasion, and inhibiting apoptosis. IGF-1 enhances cell survival and proliferation primarily through the activation of the PI3K/Akt/mTOR signaling pathway. In this study, DEHP exposure enhanced IGF-1 pathway activation and increased Snail protein levels, further underscoring the potential involvement of these molecular pathways in the development of endometriosis. Specifically, mTOR activation stabilized Snail protein levels by preventing proteasomal degradation, thereby promoting EMT. The biochemical results presented in this study highlight the significant modulation of EMT markers, inflammatory cytokines, and m6A modifications in DEHP-induced endometriosis. Notably, the upregulation of METTL3, IGF-1, and Snail, key regulators of EMT, is associated with the progression of endometrial lesion formation. The significant changes in these molecular pathways provide a clearer biochemical basis for understanding how DEHP exposure contributes to endometriosis progression. In line with previous studies, these findings support the involvement of these biomarkers in the disease model and suggest their potential as therapeutic targets for preventing or mitigating disease progression. While our findings suggest that DEHP exposure significantly modulates several signaling pathways, such as the METTL3/IGF-1 axis and EMT markers, it is important to note that further experimental validation is required to establish a direct causal relationship between these signals and the pathological outcomes of endometriosis. Future studies utilizing specific pathway inhibitors or gene knockdown models would be crucial to confirm the involvement of these signaling pathways in the progression of endometriosis. Specifically, future studies should employ METTL3 genetic perturbation (siRNA/CRISPR) or writer inhibition, IGF-1R blockade (with ± exogenous IGF-1 rescue), and pathway rescue in primary endometrial cells or organoids. These perturbations are essential to differentiate association from causation for the METTL3/IGF-1/m6A axis. The epigenetic evidence, specifically the upregulation of m6A methylation in genes such as METTL3, IGF-1, and Snail, is strongly supported by additional biochemical findings. These include increased protein expression levels, as shown by Western blotting and immunohistochemistry, as well as changes in gene expression profiles, confirmed by real-time PCR. Furthermore, the alteration in the expression of inflammatory cytokines and EMT markers provides complementary biochemical evidence that correlates with the observed epigenetic modifications. These findings together highlight the robustness of the epigenetic changes in DEHP-induced endometriosis and support the role of m6A modification in regulating key cellular processes such as proliferation, migration, and invasion. Moreover, NaB, a histone deacetylase inhibitor, significantly downregulated the expression of the IGF-1 signaling pathway and Snail. This suggests that NaB may mitigate the effects of DEHP exposure by modulating epigenetic modifications such as histone acetylation and m6A methylation. These findings highlight the potential therapeutic role of NaB in regulating DEHP-induced alterations in gene expression and suggest that targeting the IGF-1/PI3K/Akt/mTOR/Snail pathway may be a promising strategy for preventing the development of endometriosis. In summary, our study provides evidence that DEHP exposure induces significant alterations in both m6A methylation and the protein expression of IGF-1 pathway-related genes, particularly Snail. These changes may promote endometriosis development by activating the IGF-1/PI3K/Akt/mTOR pathway and stabilizing Snail expression. NaB intervention appears to effectively mitigate these alterations, offering a potential therapeutic strategy for managing DEHP-induced endocrine disruption and related diseases such as endometriosis. While this study elucidates a novel DEHP-induced pathway involving gut microbiota and m6A methylation, it is important to recognize the translational challenges. Rodents differ from humans in their endocrine physiology, estrous cycle patterns, and xenobiotic metabolism. Furthermore, species-specific differences in gut microbiota composition and immune response profiles may affect the generalizability of the findings. These limitations highlight the need for complementary validation using human endometrial tissues, organoid models, or clinical samples to confirm the mechanistic relevance and therapeutic applicability of the identified pathways. While DEHP exposure coincided with reduced Odoribacter abundance and lower fecal butyrate, these observations remain associative. NaB supplementation suggests sufficiency to ameliorate certain phenotypes but does not establish necessity, nor does it exclude roles for other SCFAs or microbial taxa. Alternative pathways, such as barrier disruption and immune modulation, may also interact with METTL3/IGF-1–m6A signaling. Limitations include the lack of Odoribacter -specific functional assays (e.g., buk/but gene quantification, targeted depletion/reconstitution, gnotobiotic transfer) and pathway-level perturbations (e.g., METTL3 inhibition, IGF-1R blockade with rescue). Future studies implementing these approaches will be critical to establish causality. Regarding dose relevance and extrapolation. The 500 mg/kg/day DEHP regimen was selected to secure robust phenotypic and pathway signals for mechanistic inference. Although body-surface-area considerations were referenced at the design stage, such scaling is approximate and the current dose remains above typical environmental exposures. This high-dose design was intended to ensure robust lesion induction and measurable pathway readouts within a finite timeframe for mechanistic hazard identification. It was not intended to mirror typical environmental exposures in humans. Accordingly, our findings should be interpreted as hazard-oriented and mechanistic, rather than quantitative risk estimates. Future work will prioritize environmentally relevant, lower and chronic/longitudinal dosing to improve alignment with real-world exposure scenarios. The limitations of this study include the use of a high-dose, finite-duration design that facilitates lesion induction but constrains generalizability to typical human exposures. This study used a finite exposure window with a terminal endpoint; therefore, it did not include serial longitudinal imaging or post-exposure follow-up to determine whether induced lesions were progressive, stable, or recurrent over longer timeframes. Future studies will employ graded lower-dose cohorts, multi-month exposure windows, and longitudinal outcome tracking (e.g., persistence/progression/recurrence) to strengthen translational inference. Human endometriosis is a chronic, relapsing condition. To this end, our short-term design with a terminal endpoint precludes inference on long-term lesion trajectories (progression, stability, recurrence). Future work will prioritize graded lower-dose, multi-month exposure, serial small-animal ultrasound to quantify lesion number/volume, and post-exposure follow-up, thereby aligning preclinical outcomes with the chronic, relapsing natural history observed clinically.

Introduction

Endometriosis is an estrogen-dependent disorder( Yilmaz and Bulun, 2019 ), and its incidence is strongly linked to factors, such as endocrine disruption, environmental conditions, and genetics. Epidemiological studies estimate that endometriosis affects approximately 10 % of reproductive-aged women globally, with prevalence reaching up to 50 % in women experiencing infertility and pelvic pain( Moradi et al., 2021 ; Ribeiro et al., 2024 ). Exposure to environmental endocrine-disrupting chemicals, often a consequence of pollution, has been identified as a significant contributor to the development of the disease( Akgul et al., 2019 ). Di-(2-ethylhexyl) phthalate (DEHP) is a widely encountered environmental endocrine disruptor with estrogen-mimicking and anti-androgenic properties( Chang, Herianto, Lee, Hung, and Chen, 2021 ). It is commonly found in food packaging, medical supplies, and cosmetic products. DEHP and its metabolite mono-2-ethylhexyl phthalate are primarily ingested orally, leading to endocrine disruption and impairment of female reproductive system function(H. G. Kim et al., 2022 ). Epidemiological studies have indicated that DEHP exposure is associated with reduced pregnancy rates and increased miscarriage rates in women. Furthermore, serum DEHP levels are positively correlated with endometriosis severity ( Song, Won, Lee, Han, and Lee, 2022 ), suggesting that DEHP may be a significant etiological factor in this condition. Emerging evidence has identified DEHP as a potent endocrine disruptor associated with reproductive system toxicity. Recent reviews have reported that DEHP interferes with steroid hormone biosynthesis, alters immune and inflammatory responses, and induces oxidative stress in the endometrium—all of which contribute to the onset and progression of endometriosis( Fuzak and Pollack, 2024 ; Land, Ghuneim, Williams, and Hannon, 2025 ; Martínez-Ibarra et al., 2024 ; Ribeiro et al., 2024 ). These findings underscore the relevance of environmental exposure to phthalates in the etiopathology of endometriosis and support the need for mechanistic investigations. Therefore, an in-depth investigation into the molecular mechanisms by which DEHP induces endometriosis is essential to advance prevention and treatment strategies. N6-methyladenosine (m6A), a prevalent mRNA modification, plays a key role in the reproductive toxicity of DEHP( Zhao et al., 2020 ; Zhu, Fu, Sun, Di, and Xu, 2022 ). m6A modifications primarily involve the regulation of methyltransferases (writers) such as METTL3, demethylases (erasers) such as ALKBH, and methylation readers (readers) exemplified by YTHDF1. Studies have demonstrated that m6A is associated with diseases of the female reproductive system, including endometriosis, reproductive system tumors, premature ovarian failure, polycystic ovary syndrome, and adenomyosis( Sun, Gan, and Sun, 2022 ). m6A regulatory factors, such as METTL3, FTO, and IGF2BP2, play a role in the pathogenesis of endometriosis. They act as key diagnostic biomarkers, regulating the proliferation, invasion, and migration of ectopic endometrial tissue and endometrial stromal cells(X. Wang et al., 2023 ; Q. C. Zhang, 2022 ). However, current research has primarily focused on identifying the regulatory factors of m6A in endometriosis, often overlooking the critical genes that interact with these factors. Therefore, identifying the target genes of m6A modification is essential to elucidate the pathogenic mechanisms of endometriosis. DEHP absorption in the gut can lead to toxic effects, potentially inducing neurofunctional impairment through the microbiota-gut-brain axis( Balaguer-Trias, Deepika, Schuhmacher, and Kumar, 2022 ). DEHP may alter the gut microbiota of neonates and potentially affect their immune responses later in life(Y. N. Yang et al., 2019 ). Animal studies have indicated that DEHP alters the composition and metabolic products of fecal microbiota in mice, weakening intestinal tight junctions and promoting a systemic inflammatory response via increased lipopolysaccharide (LPS) production, thereby contributing to female reproductive toxicity( Fu et al., 2021 ). These findings suggest that DEHP exposure may lead to dysbiosis of the gut microbiota and alterations in metabolic products( Goyal, Agarwal, Mishra, Kumar, and Saravanan, 2024 ; Goyal and Saravanan, 2023 ). Inflammatory responses resulting from gut microbiota dysbiosis may be a critical factor in damage to the female reproductive system. Endometriosis, an estrogen-dependent disease associated with inflammation, may involve alterations in the extra-pelvic environment, which may underlie its intrinsic mechanisms(B. Zhang et al., 2018 ). Epidemiological studies indicate that both α and β diversity of gut microbiota in patients with endometriosis are lower than those in healthy individuals, with significant differences in the abundance of 12 bacterial taxa, including Bacteroides( Kovács, Glover, Reidy, MacSharry, and Saldova, 2021 ). Animal studies have shown that rhesus monkeys with endometriosis exhibit a reduction in Bifidobacteria and an increase in Gram-negative bacteria compared to controls, with a significantly higher incidence of gut inflammation in the diseased group( Bailey and Coe, 2002 ). Sequencing of fecal bacteria from mice in the endometriosis and control groups revealed reduced Bacteroidetes levels in the former( Yuan et al., 2018 ). These findings collectively confirm the association between endometriosis and gut microbiota composition. We therefore investigated the effects of DEHP on gut microbiota and its metabolites in female rats, focusing on alterations in endometrial m6A methylation levels that contribute to the development and progression of endometriosis. This study aimed to elucidate the molecular mechanisms underlying DEHP-induced endometriosis and to provide novel insights and potential therapeutic targets for its prevention and treatment. In addition, our findings contribute to a more comprehensive evaluation of the toxicological effects of DEHP and its potential risks to the female human reproductive system.

Coi Statement

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: pmc-nxml

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Condition tags

endometriosis

Citation neighborhood

Papers in the corpus that this work cites (lower rings, blue) and that cite this one (upper rings, green). Dot size scales with the paper's in-corpus citation count — bigger dot = more influential within the endo/adeno field. Click a dot to open that paper. [ expand to 2 hops ] — adds papers reached through this work's immediate citers/citees. Heavier; up to 60 extra dots.

References (49)

Source provenance

europepmc
last seen: 2026-08-05T06:13:34.187606+00:00
openalex
last seen: 2026-06-10T17:14:06.276822+00:00
pmc
last seen: 2026-05-13T20:22:03.195721+00:00
pubmed
last seen: 2026-08-05T06:09:45.969525+00:00
License: CC0 · commercial use OK