Preliminary study on the effects of carbon dioxide and nitrogen pneumoperitoneums on endometriotic lesions

article OA: gold CC0 ⤵ 2 in-corpus citations
AI-generated summary by gemini-2.5-flash-lite, 2026-06-08

This study found that while carbon dioxide pneumoperitoneum initially increased endometriotic lesion size, it led to smaller lesions and altered serum/tissue markers compared to nitrogen or air over four weeks.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

AI-generated deep summary by claude@2026-06, 2026-06-13 · read from full text

This preliminary rat study modeled endometriosis by implanting uterine endometrium on the pelvic wall, then exposed animals to pneumoperitoneum with CO2, N2, or air (15 mmHg for 1 h) and followed lesion size at weeks 1, 2, and 4 while measuring serum and lesion biomarkers tied to adhesion/invasion/angiogenesis (ICAM-1, CD44 variants, MMP-2, TIMP-2, VEGF/ENS, and TNF-α). Across timepoints, CO2 pneumoperitoneum produced the largest lesion volume at week 1, but lesions were smaller by week 4, and both CO2 and N2 reduced adhesion/invasion/angiogenesis relative to air, with CO2 generally not significantly different from N2 for some serum markers (e.g., ICAM-1, TIMP-2 at week 2) while showing time-dependent differences in gene/protein expression in tissues. The authors’ explicit caveat is that this is a preliminary animal experiment assessing early biological effects without reporting human recurrence outcomes. Relevance to endometriosis: the paper is directly about how CO2 versus N2 pneumoperitoneum affects experimental endometriotic lesion growth and molecular factors linked to implantation and progression.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

OBJECTIVE: To determine the effects of carbon dioxide (CO(2)) and nitrogen (N(2)) pneumoperitoneums on endometriosis (EMs) lesions. METHODS: Female Wistar rats were randomized into the following 3 groups: CO(2) (N = 20), N(2) (N = 22) and air pneumoperitoneums (N = 9). After 5 weeks of establishment models, do the pneumoperitoneums. Then measure the size of EMs lesions and the related factors of serum and tissue after 1, 2, and 4 weeks of pneumoperitoneums. RESULTS: (1) One week after the pneumoperitoneum was established, the EMs lesions in the CO(2) group were largest in volume, whereas at 4 weeks the EMs lesions in the CO(2) group were smaller than the N(2) group. (2) The level of ICAM-1 and TIMP-2 of serum in CO(2) and N(2) group after 2 weeks of pneumoperitoneum were higher than air group. (3) The expression of CD44v6, ICAM-1, MMP-2 and VEGF of tissue in CO(2) and N(2) group after 1, 2 and 4 weeks of pneumoperitoneum were lower than air group, TIMP-2 and ENS were higher than air group. CONCLUSION: After a CO(2) pneumoperitoneum, EMs lesions were reduced in volume, suggesting an inhibitory effect on EMs lesions.
Full text 14,968 characters · extracted from pmc-nxml · 4 sections · click to expand

Results

The CO 2 group ( N  = 20) had a success rate of 100% (20/20), the N 2 group ( N  = 22) had a success rate of 72.7% (16/22), and the air group ( N  = 9) had a success rate of 88.9% (8/9). The pathologic examinations confirmed the existence of endometrial tissues and glands. One week after pneumoperitoneum, the CO 2 group demonstrated the largest EMs lesion based on volume (87.763 ± 10.138 mm 3 ) compared to the N 2 and air groups ( p  < 0.05). Four weeks after the pneumoperitoneum, the lesions in the CO 2 group were smaller than those in the N 2 group. In the CO 2 group, the lesions obtained after 1 week were larger than it being in the second and fourth week. The serum ICAM-1 and TIMP-2 increase to show that capability of adhesion, invasion and angiogenesis after different pneumoperitoneum, we tested whether the level of CD44, ICAM-1, MMP-2, TIMP-2, VEGF and TNF-α change in serum. The ICAM-1 is adhesion-related factor, 6.22 ± 0.24 ng/L in CO 2 group, 5.49 ± 0.19 ng/L in N 2 group and 3.93 ± 0.31 ng/L in air group of the second week. The TIMP-2 is anti-invasion factor, 679.00 ± 69.74 ng/L in CO 2 group, 716.91 ± 19.71 ng/L in N 2 group and 442.49 ± 39.42 ng/L in air group of the second week. The CO 2 and N 2 groups had higher levels of ICAM-1 and TIMP-2 in serum than the air group (ICAM-1: P  = 0.014, P  = 0.024; TIMP-2: P  = 0.049, P  = 0.012; Fig.  1 ). The other markers revealed no statistically significant between group. The results indicated that the capability of adhesion and anti-invasion was improved after 2 weeks of CO 2 and N 2 pneumoperitoneum, there was no difference between CO 2 and N 2 pneumoperitoneum. Thereby, we suggest pneumoperitoneum will affect the capability of adhesion and invasion, but the different media have no difference. However, with the change of time, six genes of CO 2 and N 2 pneumoperitoneum vary significantly. Fig. 1 The level of adhesion-related factors (CD44, ICAM-1), invasion-related factor (MMP-2, TIMP-2) and angiogenesis-related factors (VEGF and TNF-α) in serum is changed after different pneumoperitoneum. Data are presented as mean ± SD The level of adhesion-related factors (CD44, ICAM-1), invasion-related factor (MMP-2, TIMP-2) and angiogenesis-related factors (VEGF and TNF-α) in serum is changed after different pneumoperitoneum. Data are presented as mean ± SD At weeks 1, 2, and 4, EMs tissues from the CO 2 and N 2 groups demonstrated significantly lower expressions of the adhesion-related factors (CD44v6 and ICAM-1), the invasion-related factor (MMP-2), and the vascular factor (VEGF), and significantly higher expressions of the anti-invasion factor (TIMP-2) and anti-angiogenesis factor (ENS), compared to the air group. In addition, the difference of ICAM-1, MMP-2, and ENS between CO 2 and air group, N 2 and air group were significant at 1 week (Fig.  2 a); except ENS, the change of other six markers had significant difference at 2 weeks after pneumoperitoneum (Fig.  2 b); the level of CD44v6, MMP-2, TIMP-2, and VEGF appeared obvious difference (Fig.  2 c). Furthermore, the level of ICAM-1 was lower in CO 2 group than N 2 group at the first week, TIMP-2 was higher in N 2 group than CO 2 group. Therefore, we consider that pneumoperitoneum can reduced the capability of adhesion, invasion and angiogenesis in EMs lesion, and in some degree, the CO 2 pneumoperitoneum was better than N 2 pneumoperitoneum. In addition, the expression level of TIMP-2 decreased in N 2 group and VEGF decreased in CO 2 group at the fourth week after pneumoperitoneum. So, from the result, N 2 decreased the capability of anti-invasion and CO 2 decreased the capability of angiogenesis. Fig. 2 The adhesion-related factors (CD44v6, ICAM-1), invasion-related factor (MMP-2, TIMP-2) and angiogenesis-related factors (VEGF and ENS) in EMs lesion were changed after different pneumoperitoneum. Data are presented as mean ± SD The adhesion-related factors (CD44v6, ICAM-1), invasion-related factor (MMP-2, TIMP-2) and angiogenesis-related factors (VEGF and ENS) in EMs lesion were changed after different pneumoperitoneum. Data are presented as mean ± SD

Discussion

Adhesion is the first step in which the endometrialis implanted in extra-uterine locations via menstrual blood. Cellular adhesion-related factors are molecules on the cellular surface that mediate cell–cell and cell-extracellular matrix adhesion. In the current study, we examined the level of ICAM-1 and CD44v6/CD44. Previous studies have shown that a high-pressure CO 2 pneumoperitoneum can affect the synthesis of the hyaluronic acid complex, hence reducing adhesiveness [ 8 ]. CD44v6 is an isomer of CD44 and its relationship with epithelial tumors has become a research focus in recent years. A study on eutopic and ectopic endometrium suggested that both tissues express CD44 [ 9 ]. Compared to healthy control subjects, eutopic endometrium in EMs patients showed elevated expressions of CD44v6, CD44v7, CD44v8, and CD44v9 [ 10 ]. The presence of CD44 suggests that ectopic endometrium has the potential of peritoneal implantation. In the current study, there was no significant difference between-group in serum CD44, while the EMs tissues in the CO 2 and N 2 groups had higher serum ICAM-1 and lower CD44v6 and ICAM-1 expression compared to the air group. Our findings revealed that CO 2 and N 2 pneumoperitoneums inhibit EMs adhesion. The mechanism for this phenomenon may be related to lymphocyte homing, lymphocyte activation, and intracellular signal transduction. In addition, the expression of ICAM-1 in CO 2 group was lower than in the N 2 group after 1 week of pneumoperitoneums, which have significant statistic sense, and shows that CO 2 as the medium of pneumoperitoneum is more effective to control the development and recurrence of endometriosis at early stage of post-operation. Based on Sampson’s theory [ 11 ], invasion is the second step in EMs development. Overexpression of MMP-2 is related to invasion and metastasis of several tumors [ 12 ], while EMs also have invasive behavior. Based on the extant literature, patients with EMs have higher MMP-2 levels in the serum and peritoneal fluid compared to patients without EMs; the stroma and epithelium of ectopic endometrium also demonstrate increased MMP-2 expression [ 13 ]. In addition, genotype can affect risks for EMs. Specifically, women with the CC genotype of MMP-2-735 are at relatively increased risk for EMs [ 14 ]. Interestingly, women with the C/C homozygote genotype of TIMP-2-418 have significantly reduced MMP-2 expression [ 15 ]; TIMP-2 regulates MMP-2. Several studies had confirmed the correlation between MMP-2, TIMP-2, and several diseases [ 16 ]. In our study, after 1, 2, and 4 weeks of the pneumoperitoneum, EMs tissues in the CO 2 and N 2 groups had a lower expression of MMP-2 than the air group. Furthermore, the increase in TIMP-2 after a pneumoperitoneum provided another piece of evidence that CO 2 and N 2 pneumoperitoneums may limit invasiveness of ectopic endometrial tissues. The finding suggested that CO 2 and N 2 pneumoperitoneums can reduce invasiveness of EMs, thus inhibiting the post-operative recurrence and controlling further development of EMs. Second, at the fourth week after pneumoperitoneum, the TIMP-2 expression in CO 2 group was significantly higher than N 2 group, so we can speculate that CO 2 as the medium may benefit to capability of anti-invasion in the long period of post-operation. Angiogenesis plays a critical role in the metastasis VEGF is one of the most important agents affecting angiogenesis and can induce endothelial proliferation, capillary loop formation, and consequently new blood vessel formation can also increase capillary permeability. A previous study showed no difference in serum VEGF between patients with stage III-IV EMs and the control group [ 17 ]. TNF can facilitate EMs development by stimulating ectopic endometrial proliferation and local papillary growth. In the current study, EMs tissues in the CO 2 and N 2 groups had higher VEGF expression at the second and fourth week, significantly higher ENS expression at the first week. In the long run of the effect, the CO 2 is better than N 2 , because the capability of angiogenesis by the expression of VEGF increased in the N 2 group at the fourth week after pneumoperitoneum. There was no difference in serum markers, except ICAM-1 and TIMP-2. Considering the fact that EMs lesions secrete these adhesion-, invasion-, and angiogenesis-related factors, which cannot be detected in the blood until having reached an accumulated threshold amount, RT-PCR is a more sensitive method by which to measure variations in such factors in EMs tissues. From the results, we think that compared to air pneumoperitoneum, CO 2 and N 2 pneumoperitoneums inhibit EMs lesions not only with respect to lesion size but also with respect to other biomarkers, and the CO 2 as medium of pneumoperitoneums is better than N 2 . Therefore, in addition to laparoscopic treatment for EMs, the choice of insufflating gas also has an impact on therapeutic outcome. In light of the effects on pain reduction and increased pregnancy rate [ 18 ], laparoscopic treatment for EMs is the preferred approach for non-parous women with desired fertility. During surgery, an intra-abdominal pressure of 14 mmHg should be maintained, while some increase in pressure may be required based on the status of the patient. Previous literature has shown that different intra-abdominal pressures exert varying degrees of influence on immune functions in experimental animals. Because a higher pneumoperitoneum pressure generates stronger inhibition on the immune response and further studies are needed to elucidate whether or not the same high intra-abdominal pressure may cause additional implantation and invasion of EMs cells.

Introduction

Endometriosis (EMs) is a common gynecologic condition, namely the presence of stromal and/or endometrial glandular epithelium implants in extra-uterine locations, possibly compromising several sites. It affects about 10% of childbearing age women and 3–5% of post-menopausal women. The most common site is ovary, the clinical symptoms are chronic pelvic pain, dysmenorrhea, menorrhagia, vibration pain, dyspareunia and dysuria, it may causes infertility. It is a benign disease, but the biological behavior mimics that of malignant tumor. Although there are drugs to treat in the future, the recurrence rate is still high (6.1–40%), with a rising trend [ 1 , 2 ]. In recent years, the widespread application of laparoscopy in clinical practice not only provides accurate staging and diagnosis of EMs but also improves the chronic pelvic pain. CO 2 is the insufflating medium of choice in contemporary laparoscopy due to the low expense, high solubility, flame retardant properties, and low possibility of air embolism. However, the previous studies on human colon and hepatic cancer cell lines treated with CO 2 revealed that the gas can promote cell growth, leading to the spread and implantation of cancer cells [ 3 – 5 ]. A study in China revealed a decreased trend in the EMs recurrence following laparoscopy [ 6 ], another study involving HO8910 and SKOV3 ovarian cancer cell lines showed that cell growth is slowed with the increase in pressure and duration of the CO 2 pneumoperitoneum [ 7 ]. Therefore, the effect of CO 2 on the spread of tumor is still under debate. There are no reports regarding the biological effects of pneumoperitoneums on the EMs lesions and recurrence following laparoscopic treatment. This study aimed to explore the impact of different insufflating gases on EMs lesions.

Materials|Methods

Fifty-six female Wistar rats weighing 190–210 g were purchased from the Laboratory Animal Center of the Academy of Military Medical Sciences. The following reagents and equipment pieces were used: MK3 microplate reader (Labsystems, Finland); ELISA kit (R&D Systems, USA); and XW-80A vortex shaker, F6/10 homogenizer, 1-15 K and 3K15 refrigerated microcentrifuge, ABI 7500 real-time PCR instrument, and SYBR Green PCR kit. One day prior to the surgery, all animals were administered estradiol benzoate (0.1 ml/kg intramuscular) to synchronize the estrous cycle. After anesthesia, one side of the uterus was removed. The removed portion of the uterus was irrigated with normal saline at 37°C and cut sagittally to expose the uterine cavity. After the removal of the uterine serosa and myometrium, the endometrium was isolated, separated into two 5 mm × 10 mm parts, and fixed onto the superior-medial abdominal sides of the bilateral pelvic wall. Metronidazole and penicillin were given as anti-infection treatments. The rats were randomized into three groups according to the type of intervention (CO 2 , N 2 , and air). Five weeks after establishment of the animal model, pneumoperitoneums with CO 2 , N 2 , or air were administered (air pressure: 15 mmHg; time: 1 h). At weeks 1, 2, and 4 after the pneumoperitoneums were established, the sizes of the EMs lesions were measured, and serum and tissue molecular biomarkers (matrix metalloproteinase-2 MMP-2, tissue inhibitor of metalloproteinase-1 TIMP-1, CD44, ICAM-1, endostatin/vascular endothelial growth factor ENS/VEGF, and tumor necrosis factor-alpha TNF-α) were tested. Six-to-eight ml of intraventricular blood was aspired via intracardiac puncture. After centrifugation at 3,500 rpm/min, the upper layer of serum was collected, refrigerated at −80°C, and analyzed using ELISA. The EMs lesions were removed and irrigated with normal saline. One part of the lesion was frozen in liquid nitrogen for RT-PCR analysis, and the other part was fixed in formalin solution for pathologic examination to confirm the existence of EMs tissue. The following primers were used: ENS: sense: ATCGTCAACCTGAAGGATG, antisense: GTCTGAGCCATGCCATAC. CD44v6: sense: CCTAATAGCACAACAGAAGAAG, antisense: GATCCATGAGTCACAGTGTC ICAM-1: sense: TGTCGGTGCTCAGGTATC, antisense: AGTGGTCTGCTGTCTTCC MMP-2: sense: GATATAGCCTATTCCTTGTG, antisense: TGTCAGTATCAGCATCAG TIMP-2: sense: TTACCCTCTGTGACTTTATTG, antisense: CCATTGATGCTCTTCTCTG VEGF: sense: TGGACCCTGGCTTTACTG, antisense: GGACGGCTTGAAGATATACTC β-Actin: sense: TATCGGCAATGAGCGGTTC, antisense: AGCACTGTGTTGGCATAGAG ENS: sense: ATCGTCAACCTGAAGGATG, antisense: GTCTGAGCCATGCCATAC. CD44v6: sense: CCTAATAGCACAACAGAAGAAG, antisense: GATCCATGAGTCACAGTGTC ICAM-1: sense: TGTCGGTGCTCAGGTATC, antisense: AGTGGTCTGCTGTCTTCC MMP-2: sense: GATATAGCCTATTCCTTGTG, antisense: TGTCAGTATCAGCATCAG TIMP-2: sense: TTACCCTCTGTGACTTTATTG, antisense: CCATTGATGCTCTTCTCTG VEGF: sense: TGGACCCTGGCTTTACTG, antisense: GGACGGCTTGAAGATATACTC β-Actin: sense: TATCGGCAATGAGCGGTTC, antisense: AGCACTGTGTTGGCATAGAG Software (Excel’97) was used to collect data, the data expressed as mean ± SD, and the analysis of variance for comparison of categorical variables. Significance was assumed when P was less than 0.05.

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: pmc-nxml

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Condition tags

endometriosis

MeSH descriptors

Carbon Dioxide Endometriosis Nitrogen Pneumoperitoneum, Artificial Animals Carbon Dioxide Endometriosis Endostatins Endostatins Female Hyaluronan Receptors Hyaluronan Receptors Intercellular Adhesion Molecule-1 Intercellular Adhesion Molecule-1 Matrix Metalloproteinase 2 Matrix Metalloproteinase 2 Nitrogen Pneumoperitoneum, Artificial Rats Rats, Wistar

Citation neighborhood

Papers in the corpus that this work cites (lower rings, blue) and that cite this one (upper rings, green). Dot size scales with the paper's in-corpus citation count — bigger dot = more influential within the endo/adeno field. Click a dot to open that paper. [ expand to 2 hops ] — adds papers reached through this work's immediate citers/citees. Heavier; up to 60 extra dots.

References (15)

Cited by (2)

Source provenance

europepmc
last seen: 2026-08-17T06:11:01.428247+00:00
openalex
last seen: 2026-06-10T17:14:06.276822+00:00
pubmed
last seen: 2026-05-13T22:16:17.081435+00:00
License: CC0 · commercial use OK