The therapeutic potential of pirfenidone in alleviating fibrosis and restoring ovarian function in a novel ovarian endometriosis mouse model

article OA: gold CC0
⚙ AI-generated summary by gemini-2.5-flash-lite, 2026-06-07 ⓘ

Pirfenidone treatment in a novel mouse model significantly reduced ovarian endometriosis lesion size, fibrosis, and restored ovarian function by modulating iron homeostasis and ferroptosis alongside antifibrotic actions.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

⚙ AI-generated deep summary by claude@2026-06, 2026-06-07 · read from full text ⓘ

The study investigated whether pirfenidone, an FDA-approved antifibrotic drug, could treat surgically induced ovarian endometriosis in a novel mouse model by reducing fibrosis and restoring ovarian function. BALB/c mice with ovarian endometriosis were randomized to receive pirfenidone or vehicle for 24 days, with outcomes including lesion size/weight, collagen and α-SMA–based fibrosis measures, ovarian reserve/folliculogenesis assessed by Fshr and related mRNA/protein readouts, and granulosa cell proliferation/apoptosis, alongside label-free quantitative proteomics to identify mechanisms. Pirfenidone significantly decreased lesion burden and fibrosis and restored Fshr expression and granulosa cell markers while reducing collagen I and ferric iron deposition; proteomics implicated modulation of extracellular matrix organization and inflammation and upregulation of iron-transport and ferroptosis-related proteins, with pathway validation by additional staining and Western blotting. A major caveat is that the paper does not appear to specify whether the surgical model fully recapitulates human ovarian endometriosis biology beyond key pathological and functional endpoints, and statistical testing is described only as Student’s t test for comparisons. This paper is centrally about endometriosis — it specifically studies pirfenidone’s antifibrotic and iron/ferroptosis–mediated effects in a mouse model of ovarian endometriosis, addressing infertility-linked fibrosis and ovarian dysfunction.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

BACKGROUND: Ovarian endometriosis (OEMs) is a primary cause of female infertility and is driven primarily by fibrosis, which disrupts the ovarian follicular microenvironment. Pirfenidone (PFD), an FDA-approved antifibrotic drug, holds promise for treating OEMs, but its efficacy and underlying mechanisms in a relevant in vivo model remain unexplored. METHODS: A novel mouse model of OEMs was surgically induced. Model mice were randomized to receive either PFD (200 mg/kg every 2 days, n = 20) or vehicle (n = 20) for 24 days. We assessed lesion size and weight, fibrosis via Masson’s trichrome staining and α-SMA immunohistochemistry (IHC), ovarian function through follicle-stimulating hormone receptor (Fshr) IHC and quantitative PCR, and granulosa cell status via Ki67 IHC and TUNEL assays. An unbiased label-free quantitative proteomic analysis was performed to elucidate the mechanism, with key pathways validated by Prussian blue staining and Western blotting. Statistical significance was determined via Student’s t test. RESULTS: The OEMs exhibited characteristic cysts, extensive fibrosis (increased α-SMA and collagen deposition, p < 0.05), impaired fertility, and disrupted ovarian function (downregulated Fshr, reduced granulosa cell proliferation, and increased apoptosis, p < 0.05). PFD treatment significantly reduced lesion size, weight, and fibrosis (p < 0.05) and restored the expression of markers of ovarian reserve and folliculogenesis (p < 0.05). Proteomics revealed 554 differentially expressed proteins. PFD downregulated pathways involved in extracellular matrix (ECM) organization and inflammation and upregulated proteins related to iron ion transport and ferroptosis. These findings were confirmed by a significant reduction in ferric iron deposition (p < 0.05) and collagen I protein expression (p < 0.05) in the PFD group. CONCLUSIONS: Pirfenidone has strong therapeutic potential for treating ovarian endometriosis by simultaneously alleviating fibrosis and restoring ovarian function. Its efficacy is mediated through a novel mechanism of modulating iron homeostasis and the ferroptosis pathway, alongside its known antifibrotic actions. Our findings provide a compelling rationale for repurposing pirfenidone as a disease-modifying treatment for OEMs.
Full text 45,828 characters · extracted from pmc-nxml · 7 sections · click to expand

Sample

The samples were retrieved from the −80 °C freezer and ground into powder using liquid nitrogen. Next, an appropriate amount of powder was transferred to a 1.5 ml centrifuge tube, lysis buffer (containing 8 M urea, 1 mM PMSF, and 2 mM EDTA) was added, ultrasonic lysis was performed for 5 minutes on ice, and the mixture was centrifuged at 15,000 × g at 4 °C for 10 minutes to collect the supernatant. Finally, the protein concentration was determined via a BCA assay kit. The protein mixture (100 µg) was adjusted to 200 μl with 8 M urea, followed by reduction with DTT (final concentration of 5 mM) at 37 °C for 45 minutes and alkylation with iodoacetamide (final concentration of 11 mM) in a dark room at room temperature for 15 minutes. Then, 800 μl of 25 mM ammonium bicarbonate solution and 2 μl of trypsin (Promega, V5280) were added, and the mixture was digested overnight at 37 °C. The pH of the digested peptides was adjusted to 2–3 with 20% TFA, followed by desalting with C18 (Millipore, Billerica, MA) resin. Finally, the peptide concentration was determined via a Pierce™ Quantitative Peptide Assay Kit with standards (Thermo Fisher). The samples were separated via the Vanquish Neo UHPLC liquid chromatography system. Mobile phase A consisted of 0.1% formic acid aqueous solution, while mobile phase B consisted of 100% acetonitrile containing 0.1% formic acid. The injection mode employed a trap-and-elute dual-column method, with a PepMap Neo Trap Cartridge (300 μm * 5 mm, 5 μm) as the trapping column and an Easy-Spray™ PepMap™ Neo UHPLC column (150 μm × 15 cm, 2 µm) as the analytical column. The column temperature was controlled at 55 °C, with an injection volume of 200 ng, a flow rate of 2.5 μl/min, an effective gradient of 22 minutes, and a total runtime of 24 minutes. DIA analysis utilized the Vanquish Neo system (Thermo Fisher Scientific) for chromatographic separation. The samples separated by nanoflow high-performance liquid chromatography were subjected to DIA (Data-Independent Acquisition) mass spectrometry analysis via an Orbitrap Astral high-resolution mass spectrometer (Thermo Scientific). The detection mode was positive ion mode, with a precursor ion scan range of 380–980 m/z, a primary mass resolution of 240,000 at 200 m/z, a normalized AGC target of 500%, and a maximum IT of 5 ms. MS2 was performed in DIA data acquisition mode, with 299 scan windows, an isolation window of 2 Th, an HCD collision energy of 25%, a normalized AGC target of 500%, and a maximum IT of 3 ms. The raw MS data were analyzed via DIA-NN (v1.8.1) with a library-free method. The uniprotkb_proteome_UP000000589_mouse_ 54,910_20240528.fasta database (a total of 54910 sequences) was used to create a spectral library with deep learning algorithms of neural networks. The match between runs (MBR) option was employed to create a spectral library from DIA data, which was then reanalyzed via this library. The false discovery rate (FDR) of the search results was adjusted to < 1% at both the protein and precursor ion levels, and the remaining identifications were used for further quantification analysis. Functional annotations were performed through Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses via the “ClusterProfiler” R package, with thresholds of |FC| > 1.5 and p  < 0.05 for defining differentially expressed proteins (DEPs) between the PFD and OEMs groups. TUNEL staining was used to detect apoptosis via the TUNEL Bright Green Apoptosis Detection Kit from Vazyme according to the manufacturer’s instructions. Each sample was supplemented with 100 µl of 20 µg/ml diluted Proteinase K solution, which covered the whole sample area, and incubated at room temperature for 20 min. Then, 100 µl of equilibration buffer was added to fully cover the sample area, and the mixture was allowed to equilibrate at room temperature for 10‒30 min. 50 µl of TdT incubation buffer was discarded, the mixture was incubated at 37 °C for 60 min, the mixture was washed with PBS, and the mixture was incubated with DAPI solution at a concentration of 2 µg/ml at room temperature for 5 min. The samples were analyzed under a fluorescence microscope. Prussian blue iron staining was measured via the Prussian Blue Iron Stain Kit (Ferric Iron, enriched with DAB) from Solarbio according to the manufacturer’s instructions. OEMs model mice were allocated randomly into two cohorts ( n  = 20): a pirfenidone group (200 mg/kg, q2d; Targetmol; 53,179–13–8) and a PBS group. The mice were sacrificed after 24 days, and ovarian-type endometriosis lesions were harvested for protein sequencing analysis and pathological staining. Protein lysates were resolved by SDS‒PAGE and transferred onto nitrocellulose membranes (Millipore). The membranes were blocked with 5% skim milk powder and probed with primary antibodies against COL1A1 (1:1000; Proteintech; 661–1-Ig) and GAPDH (1:10000; Proteintech; 60,004–1-Ig), followed by incubation with HRP-conjugated secondary antibodies (1:10,000; Proteintech; 15,015). Band intensity was quantified with ImageJ. Statistical analyses were performed via GraphPad Prism 9 (San Diego, CA, USA) or R (version 4.0). Unpaired two-group comparisons were conducted via Student’s t test. A p value of less than 0.05 was considered statistically significant, with specific levels denoted as follows: * p  < 0.05, ** p  < 0.01, *** p  < 0.001, and **** p  < 0.0001.

Methods

All animal procedures in this study were approved by the Institutional Animal Care and Use Committee of Xiamen University School of Medicine, China (XMULAC20210178). BALB/c mice purchased from Viton Lever were housed at the Xiamen University Animal Center in a specific pathogen-free (SPF) and standardized environment (22–24 °C, 60–70% relative humidity, 12 h light/12 h dark cycle) and fed ad libitum. A total of 72 (female: n  = 66; male: n  = 6, 8 weeks old) BALB/c mice were used in this experiment. After one week of acclimatization, 12 of the female mice were used as donors to provide uterine tissues for transplantation, and the remaining 54 8-week-old mice were randomly divided into three groups, namely, the control group (control, n  = 18), the sham-operated group (sham, n  = 12), the modeling group (OEMs, n  = 24), and the other 6 male mice were used to mate with the females for evaluation of fertility. Mice in each group were randomly selected to evaluate the formation of OEM cysts in the ovaries at 4 weeks (Control = 3, Sham = 3, OEMs = 6) and 6 weeks (Control = 6, Sham = 6, OEMs = 8) after modeling and were subjected to a series of histological experiments as well as assays at the RNA level. For evaluation of fertility experiments, at 6 weeks after modeling, three groups of mice totaling 22 (control = 9, sham = 3, OEMs = 10) were further randomly divided into two groups: one group was used for the detection of the number of live-born zygotes (control = 6, OEMs = 6), and one group of mice was euthanized and executed 5 days prior to the birth of the mice for the detection of embryo numbers (control = 3, sham = 3, OEMs = 4). The fertility of the mice was evaluated comprehensively. The experimental design is summarized in Fig. 1 A. Fig. 1 Establishment and validation of the mouse ovarian endometriosis (OEM) model. ( A ) schematic diagram of the experimental timeline and experimental protocol for model establishment. ( B ) Representative macroscopic images of ovaries from the control, sham, and OEMs groups at 6 weeks post-surgery. Note the presence of characteristic cystic lesions (indicated by arrows) attached to the ovaries in the OEMs group. ( C ) Representative hematoxylin and eosin (H&E)-stained sections of ovarian tissues. The OEMs group showed cystic lesions lined with a single layer of columnar epithelium (arrowheads), in contrast with the normal ovarian morphology in the control and sham groups. Scale bars, 500 μm (low magnification) and 100 μm (high magnification) Establishment and validation of the mouse ovarian endometriosis (OEM) model. ( A ) schematic diagram of the experimental timeline and experimental protocol for model establishment. ( B ) Representative macroscopic images of ovaries from the control, sham, and OEMs groups at 6 weeks post-surgery. Note the presence of characteristic cystic lesions (indicated by arrows) attached to the ovaries in the OEMs group. ( C ) Representative hematoxylin and eosin (H&E)-stained sections of ovarian tissues. The OEMs group showed cystic lesions lined with a single layer of columnar epithelium (arrowheads), in contrast with the normal ovarian morphology in the control and sham groups. Scale bars, 500 μm (low magnification) and 100 μm (high magnification) We euthanized 9-week-old female BALB/c donor mice ( n  = 12 in total) and dissected them to obtain mouse uteri, which were cleared of fibrofatty tissues such as adherent tunica in phosphate-buffered saline (PBS) and washed clean by immersion. The uterine tissue was transferred to clean PBS, divided into small pieces of approximately 0.2 cm × 0.5 cm, and cut longitudinally to expose the endometrial tissue. The uterine pellets were then placed in 1 ± 0.2 mg/ml collagenase solution and incubated at 37 ± 2 °C for 30 min. The uterine tissues were then centrifuged for the first time (8000×g, 5 min), and the supernatant was removed, resuspended in PBS, and washed a second time (8000×g, 5 min) by centrifugation to remove the supernatant to wash out the collagenase, which was then used for transplantation immediately thereafter. The volume ratio of uterine tissue to added collagenase solution was approximately 1:3. After one week of acclimatization, a total of twenty-four 9-week-old female BALB/c mice in the modeling group received uterine transplantation (Fig. 1 A). General anesthesia was first induced and maintained with isoflurane (3% for induction; 2.5% for maintenance). A 5–7 mm incision was made in the skin and muscle layers of the dorsum bilaterally to search for ovaries. After finding the ovary, the fat pad attached to the ovary was held with forceps to pull out the ovary and facilitate fixation of its position for the next step, whereas the bursal membrane on the surface of the ovary was slightly lifted and scratched with the use of ophthalmic forceps, causing a notch to expose a portion of the surface that was sufficient without complete stripping, and the processed donor uterine tissues were clamped to attach to the notch (donor‒recipient ratio of approximately 1:2) to ensure that the endometrial tissue faced the exposed gap on the ovarian surface. Subsequently, it was pushed back into the abdominal cavity as quickly as possible. Staple the skin and muscle. After disinfection, the plants were returned to the cage, fed regularly, and allowed to drink freely. The mice in the sham-operated group underwent the same surgical operations as those in the staged group did, except for the attachment of uterine tissue (Fig. 1 A). Six weeks after modeling, the mice used for evaluation of fertility (Control = 9, Sham = 3, OEMs = 10) were grouped into cages at a ratio of male to female (female:male = 3:1 or 4:1) at 18:00 p.m., Beijing time. At 9:00 a.m. on the following day of each mating day, the mice were tested for pessimism and were placed in separate cages. Some mice (Control = 6, OEMs = 6) were allowed to give birth to count the number of live-born offspring; the remaining mice (Control = 3, Sham = 3, OEMs = 4) were euthanized 5 days prior to delivery to count the number of embryos in utero to minimize the error caused by accidental maternal ingestion of pups. The effects of ovarian endometriosis on fertility in mice were comprehensively assessed. The mice were euthanized at 4 or 6 weeks after modeling to collect the ovaries and other lesions. Immediately after dissection, tissues were fixed in 4% neutral formalin and embedded in paraffin for pathologic analysis. Hematoxylin & eosin staining and Masson’s trichrome staining were performed to detect collagen fibers. The stained areas within the ovaries after each round of staining were quantified with ImageJ software ( https://imagej.nih.gov/ij/ ). The mean value was calculated on the basis of the stained area (%) of at least 5 randomly selected magnified images. RNA was extracted via an RNA extraction kit (Magen). cDNA was synthesized by reverse transcribing up to 1 μg of total RNA in a 20 μl reaction volume via the Evo M-MLV Reverse Transcription Premix Kit (which includes gDNA removal reagent for qPCR) (AG11728). cDNA was then synthesized via the use of 2X Universal SYBR Green Fast qPCR Mix (ABclonal) for quantitative real-time PCR to detect amplification signals. For normalization purposes, the Gapdh gene was used as an internal reference. (Gapdh, forward primer: AGGTCGGTGTGAACGGATTTG, reverse primer: TGTAGACCATGTAGTTGAGGTCA; Fshr, forward primer: CCTTGCTCCTGGTCTCCTTG, reverse primer: CTCGGTCACCTTGCTATCTTG) Paraffin sections were obtained as described above, and the sections were dewaxed, rehydrated, and antigenically repaired via a high-pressure method. To quench endogenous peroxidase activity, the sections were treated with 3% H2O2 for 10 min. Nonspecific binding was blocked by incubation with 0.5% BSA/PBS for 1 h at room temperature. The sections were then incubated with primary antibodies against α-SMA (Abcam, 1:200), Ki67 (Abcam, 1:200), and Fshr (Cohesionbio, 1:200) overnight at 4 °C, followed by incubation with HRP-conjugated secondary antibodies for 1 h at room temperature, followed by staining with DAB and restaining with hematoxylin. Digital images of the sections were obtained via a microscope.

Results

The mice in all the groups were euthanized 4 and 6 weeks after surgery and dissected to evaluate endometriosis lesions. Single or multiple cystic lesions associated with bilateral ovaries were identified in all of the OEMs groups, whereas the ovaries of the other groups did not show alterations (Fig. 1 B) in demonstrating more typical endometriotic lesions taken six weeks after modeling. The cystic lesions contained clear yellowish fluid, as observed in previous studies on peritoneal endometriosis models [ 24 ]. Immunohistochemistry confirmed that the ovarian cystic lesions were ovarian endometriosis. The cystic lesions in the OEMs group consisted of a single layer of columnar epithelium without cilia, accompanied by underlying mesenchymal tissues. The ovaries in the control and sham groups were morphologically normal (Fig. 1 C), indicating that the mouse ovarian endometriosis model was successfully constructed. For fertility experiments, we examined differences in the number of embryos obtained for implantation in each group. Representative images are shown in Fig. 2 A. In the control ( n  = 3), sham ( n  = 3), and OEMs ( n  = 4) groups, we obtained a total of 31, 25, and 10 embryos from the uteri of the female rats, respectively. The means (and ranges) of the embryos in the control, sham and OEMs groups were 10.3 (9–12), 8.3 (8–9) and 2.5 (1–5), respectively. The mean number of fertilized embryos was significantly lower in the OEMs group than in the control group (Fig. 2 B). In addition, we also statistically significantly affected the number of live-born offspring, and a total of 52 and 22 pups were obtained from females in the control group ( n  = 6) and the OEMs group ( n  = 6), respectively. The means (and ranges) of live-born offspring in the control group and the OEMs modeling group were 8.7 (7–10) and 3.7 (1–5), respectively. The mean number of live-born offspring was significantly lower in the OEMs modeling group than in the control group (Fig. 2 B). Taken together, these findings suggest that mice in the OEMs modeling group have low fertility. Fig. 2 Ovarian endometriosis impairs fertility and ovarian function. ( A ) Representative images of embryos collected from the uteri of mice in different groups. ( B ) quantitative analysis of the number of fertilized embryos and live-born offspring per mouse in the control and OEMs groups. The data are presented as the means ± SEMs ( n  = 3–6). * p  < 0.05 (Student’s t test). ( C ) relative mRNA expression levels of follicle-stimulating hormone receptor (Fshr) in ovarian tissues from the control and OEMs groups, as determined by qRT‒PCR. The data were normalized to those of the control group and are presented as the means ± SEMs ( n  = biological replicates). * p  < 0.05 (Student’s t test) Ovarian endometriosis impairs fertility and ovarian function. ( A ) Representative images of embryos collected from the uteri of mice in different groups. ( B ) quantitative analysis of the number of fertilized embryos and live-born offspring per mouse in the control and OEMs groups. The data are presented as the means ± SEMs ( n  = 3–6). * p  < 0.05 (Student’s t test). ( C ) relative mRNA expression levels of follicle-stimulating hormone receptor (Fshr) in ovarian tissues from the control and OEMs groups, as determined by qRT‒PCR. The data were normalized to those of the control group and are presented as the means ± SEMs ( n  = biological replicates). * p  < 0.05 (Student’s t test) In addition, we also conducted tests on other indicators related to ovarian function: Follicle development is mainly controlled by pituitary follicle stimulating hormone (FSH), which is necessary for follicle growth and oocyte maturation before ovulation [ 25 , 26 ]; thus, FSHR, as its receptor, is also very important for follicular development [ 26 , 27 ]. We extracted RNA from mouse ovaries and examined the expression of FSHR via QPCR and found that the expression level of FSHR in the ovaries of the OEMs group was significantly lower than that in the control group. (Fig. 2 C) The Ki67 protein is a cellular marker of proliferation and an important marker for immunohistochemistry, which is closely related to cell proliferation [ 28 ]. Ki67 expression was significantly lower in follicles in the granulosa cells of primary, secondary, and preantral follicles in the OEMs group than in those in the control group. (Fig. 3 A) Fig. 3 OEMs disrupt follicular dynamics and promote ovarian fibrosis. ( A ) Representative immunohistochemistry (IHC) images and quantification of Ki67, a proliferation marker, in granulosa cells of primary, secondary, and preantral follicles. Scale bars, 50 μm. ( B ) Representative images and quantification of TUNEL staining (green) for apoptosis detection in ovarian sections. DAPI (blue) was used as a nuclear counterstain. Scale bars, 50 μm. ( C ) Representative Masson’s trichrome staining (blue indicates collagen deposition) and quantification of the fibrotic area in ovarian tissues. Representative IHC images and quantification of α-smooth muscle actin (α-SMA), a myofibroblast and fibrosis marker. Scale bars, 500 μm. For all the quantifications, the data are presented as the means ± SEMs. * p  < 0.05, ** p  < 0.01, *** p  < 0.001 vs. The control group (Student’s t test) OEMs disrupt follicular dynamics and promote ovarian fibrosis. ( A ) Representative immunohistochemistry (IHC) images and quantification of Ki67, a proliferation marker, in granulosa cells of primary, secondary, and preantral follicles. Scale bars, 50 μm. ( B ) Representative images and quantification of TUNEL staining (green) for apoptosis detection in ovarian sections. DAPI (blue) was used as a nuclear counterstain. Scale bars, 50 μm. ( C ) Representative Masson’s trichrome staining (blue indicates collagen deposition) and quantification of the fibrotic area in ovarian tissues. Representative IHC images and quantification of α-smooth muscle actin (α-SMA), a myofibroblast and fibrosis marker. Scale bars, 500 μm. For all the quantifications, the data are presented as the means ± SEMs. * p  < 0.05, ** p  < 0.01, *** p  < 0.001 vs. The control group (Student’s t test) The TUNEL (terminal deoxynucleotidyl transferase dUTP nick end labeling) staining assay allows quantitative assessment of the extent of apoptosis by measuring the intensity of the fluorescent signal at the ends of labeled DNA breaks. In contrast, normal or necrotic cells rarely have DNA breaks and cannot be stained. The results revealed that the level of apoptosis was greater in the OEMs group than in the control group (Fig. 3 B). Ovarian endometriosis causes clinical manifestations such as pain and infertility in patients, mainly due to adhesions and scar formation. Fibrosis accompanied by follicular loss is observed in the ovaries of patients with OEMs, suggesting that the disease leads to alterations in ovarian function [ 29 ]. We evaluated fibrosis in mouse ovaries via the Masson trichrome staining method, and one of the marker molecules of fibrosis, α-SMA, was selected for immunohistochemistry. α-SMA is an indicator of the transformation of the cellular epithelium to the mesenchymal stroma, and as a marker protein for myofibroblasts, α-SMA is widely expressed in the ovaries. Fibroblast signature proteins are more widely expressed in the ovary, not only in the follicular membrane cells of presinus follicles and sinus follicles but also in the periphery of atretic follicles, etc. [ 30 ]. The expression of α-SMA, a marker of fibrosis, was significantly greater in the OEMs group than in the control group (Fig. 3 C). Consistent with the α-SMA findings, Masson’s trichrome staining revealed a significantly larger area of blue-stained fibrotic stroma in the OEMs group than in the control group (Fig. 3 C). To evaluate the therapeutic efficacy of pirfenidone (PFD) against endometriosis, we conducted an intervention study utilizing a novel mouse model of ovarian endometriosis (OEMs) (Fig. 4 A). Following successful modeling, the mice were randomly allocated to either the model (OEMs) group or the PFD-treated (PFD) group. Macroscopic examination revealed a substantial reduction in the size of the ectopic lesions in the PFD group compared with those in the OEMs group (Fig. 4 B). Consistent with this observation, the wet weights of the left, right, and total lesions were significantly lower in the PFD group (Fig. 4 C). To assess pathological changes in the lesion tissue, Masson’s trichrome staining and immunohistochemistry for α-smooth muscle actin (α-SMA) were performed. PFD treatment significantly reduced both collagen deposition (Fig. 4 D) and the area of α-SMA-positive staining within the lesions (Fig. 4 E). Collectively, these findings indicate that pirfenidone effectively inhibits the growth of ectopic lesions and reverses the fibrotic process. Fig. 4 Pirfenidone suppresses lesion growth and alleviates fibrosis. ( A ) schematic diagram of the therapeutic intervention protocol with pirfenidone (pfd) or vehicle (OEMs) in the novel OEMs model. ( B ) Representative macroscopic images of lesions from the OEM- and PFD-treated groups showing a reduced lesion size after pfd treatment. ( C ) quantitative analysis of the wet weights of the left, right, and total lesions from the OEMs and pfd groups. The data are presented as the means ± SEMs ( n  = group size). * p  < 0.05, ** p  < 0.01 (Student’s t test). ( D ) Representative Masson’s trichrome staining and quantification of collagen deposition in lesions from both groups. Scale bars, 200 μm. ( E ) Representative IHC staining and quantification of the α-SMA-positive area in lesions. Scale bars, 200 μm. The data are presented as the means ± SEMs. * p  < 0.05, ** p  < 0.01 vs. The OEMs group (Student’s t test) Pirfenidone suppresses lesion growth and alleviates fibrosis. ( A ) schematic diagram of the therapeutic intervention protocol with pirfenidone (pfd) or vehicle (OEMs) in the novel OEMs model. ( B ) Representative macroscopic images of lesions from the OEM- and PFD-treated groups showing a reduced lesion size after pfd treatment. ( C ) quantitative analysis of the wet weights of the left, right, and total lesions from the OEMs and pfd groups. The data are presented as the means ± SEMs ( n  = group size). * p  < 0.05, ** p  < 0.01 (Student’s t test). ( D ) Representative Masson’s trichrome staining and quantification of collagen deposition in lesions from both groups. Scale bars, 200 μm. ( E ) Representative IHC staining and quantification of the α-SMA-positive area in lesions. Scale bars, 200 μm. The data are presented as the means ± SEMs. * p  < 0.05, ** p  < 0.01 vs. The OEMs group (Student’s t test) We next investigated the impact of PFD on ovarian function. Immunohistochemical analysis revealed that follicle-stimulating hormone receptor (Fshr) expression was significantly greater in the granulosa cells of primary, secondary, and preantral follicles in the PFD group than in those of the OEMs group (Fig. 5 A). Concurrently, the positive signal for the cell proliferation marker Ki67 was also markedly enhanced in the granulosa cells of various follicle stages following PFD treatment (Fig. 5 B). These results suggest that pirfenidone helps restore the function and proliferative activity of ovarian granulosa cells in the endometriotic milieu, thereby improving ovarian reserve function and folliculogenesis. Fig. 5 Pirfenidone improves ovarian reserve function and follicular development. ( A ) Representative IHC images and quantification of Fshr expression intensity in granulosa cells of primary, secondary, and preantral follicles from the OEMs and pfd groups. Scale bars, 50 μm (primary, secondary), 100 µm (preantral). ( B ) Representative IHC images and quantification of Ki67-positive signals in the granulosa cells of follicles at different stages. Scale bars, 50 μm (primary, secondary), 100 µm (preantral). All the quantitative data are presented as the means ± SEMs. * p  < 0.05, ** p  < 0.01 vs. The OEMs group (Student’s t test) Pirfenidone improves ovarian reserve function and follicular development. ( A ) Representative IHC images and quantification of Fshr expression intensity in granulosa cells of primary, secondary, and preantral follicles from the OEMs and pfd groups. Scale bars, 50 μm (primary, secondary), 100 µm (preantral). ( B ) Representative IHC images and quantification of Ki67-positive signals in the granulosa cells of follicles at different stages. Scale bars, 50 μm (primary, secondary), 100 µm (preantral). All the quantitative data are presented as the means ± SEMs. * p  < 0.05, ** p  < 0.01 vs. The OEMs group (Student’s t test) To elucidate the mechanism of action of pirfenidone, we performed a label-free quantitative proteomic analysis on lesions from the OEMs and PFD groups. A total of 175,747 peptides were identified, corresponding to 14,322 quantified proteins (Fig. S1 A). Most peptides ranged from 7 to 20 amino acids in length, indicating satisfactory data quality (Fig. S1 B). Box and violin plots revealed good intragroup reproducibility (Fig. S1 C). Principal component analysis revealed distinct global protein profiles between the two groups with low intragroup variability (Fig. 6 A), and quality control confirmed the reliability of the data. With thresholds of |fold change| > 1.5 and p  < 0.05, 231 proteins were upregulated and 323 were downregulated in the PFD group compared with the OEMs (Fig. 6 B). The heatmaps displayed the top 20 differentially expressed proteins (Fig. 6 C) and all significant changes (Fig. S1 D). GO enrichment analysis revealed that the downregulated proteins were associated with the extracellular region, collagen-containing extracellular matrix, extracellular matrix organization, fibrinogen complex, inflammatory response, cell adhesion, innate immune response, growth factor activity, and positive regulation of neutrophil degranulation (Fig. 6 D). The upregulated proteins were involved mainly in iron ion transport and the intracellular ferritin complex (Fig. 6 D). KEGG analysis revealed that the downregulated proteins were enriched in complement and coagulation cascades, neutrophil extracellular trap formation, cytokine–cytokine receptor interactions, neuroactive ligand–receptor interactions, the IL-17 signaling pathway, and metabolic pathways (Fig. S1E). The upregulated proteins were linked to ferroptosis, graft-versus-host disease, allograft rejection, natural killer cell-mediated cytotoxicity, and drug metabolism (Fig. S1 E). These findings suggest that PFD may inhibit extracellular matrix remodeling, inflammation, adhesion, and growth processes in the lesion microenvironment. Fig. 6 Proteomic profiling implicates ferroptosis and ECM remodeling in the action of pfd. ( A ) workflow of the label-free quantitative proteomic analysis performed on lesion tissues from the OEMs and pfd groups. ( B ) volcano plot displaying differentially expressed proteins (DEPs). Significantly upregulated and downregulated proteins in the pfd group (compared with the OEMs) are shown in red and blue, respectively (threshold: |log2(fold change)| > x and p value < 0.05). Key proteins are labeled. ( C ) gene ontology (go) enrichment analysis bubble plot of biological processes associated with the DEPs. The size of the circle represents the number of proteins, and the color represents the -log10(adjusted p value). ( D ) Kyoto encyclopedia of genes and genomes pathway enrichment analysis. The ferroptosis and ECM-receptor interaction pathways are highlighted Proteomic profiling implicates ferroptosis and ECM remodeling in the action of pfd. ( A ) workflow of the label-free quantitative proteomic analysis performed on lesion tissues from the OEMs and pfd groups. ( B ) volcano plot displaying differentially expressed proteins (DEPs). Significantly upregulated and downregulated proteins in the pfd group (compared with the OEMs) are shown in red and blue, respectively (threshold: |log2(fold change)| > x and p value < 0.05). Key proteins are labeled. ( C ) gene ontology (go) enrichment analysis bubble plot of biological processes associated with the DEPs. The size of the circle represents the number of proteins, and the color represents the -log10(adjusted p value). ( D ) Kyoto encyclopedia of genes and genomes pathway enrichment analysis. The ferroptosis and ECM-receptor interaction pathways are highlighted Guided by these proteomic findings, we performed targeted experimental validations. First, to validate the regulation of iron metabolism, Prussian blue staining was conducted. The results revealed a significant reduction in ferric iron deposition in the lesions of the PFD group compared with those of the OEMs group (Fig. 7 A), indicating that PFD alleviates local iron overload. Second, to confirm the inhibition of ECM remodeling, Western blot analysis revealed a substantial decrease in Collagen I protein expression in PFD-treated lesions (Fig. 7 B). Together, these data strongly confirm that pirfenidone exerts its therapeutic efficacy by modulating the ferroptosis pathway and suppressing excessive ECM deposition. Fig. 7 Experimental validation of proteomic findings. ( A ) Representative Prussian blue-stained images and quantification of ferric iron deposition in lesions from the OEMs and pfd groups. The reduction in blue staining indicates alleviated iron overload upon pfd treatment. Scale bars, 500 μm. ( B ) Representative Western blots and quantitative analysis of collagen I protein expression in lesion tissues from the OEMs and pfd groups. GAPDH was used as a loading control. The data are presented as the means ± SEMs ( n  = biological replicates). * p  < 0.05, ** p  < 0.01 vs. The OEMs group (Student’s t test) Experimental validation of proteomic findings. ( A ) Representative Prussian blue-stained images and quantification of ferric iron deposition in lesions from the OEMs and pfd groups. The reduction in blue staining indicates alleviated iron overload upon pfd treatment. Scale bars, 500 μm. ( B ) Representative Western blots and quantitative analysis of collagen I protein expression in lesion tissues from the OEMs and pfd groups. GAPDH was used as a loading control. The data are presented as the means ± SEMs ( n  = biological replicates). * p  < 0.05, ** p  < 0.01 vs. The OEMs group (Student’s t test)

Background

OEMs, which most frequently present as endometriomas, constitute a severe phenotype of endometriosis that profoundly impairs the ovarian reserve and female fertility [ 1 – 3 ]. This condition directly damages the ovarian parenchyma, leading to compromised oocyte quality, reduced fertilization rates and altered folliculogenesis, as evidenced by prolonged follicular phases and slower follicular development than in patients with tubal factor infertility [ 4 , 5 ]. This functional decline is widely attributed to a disrupted follicular microenvironment resulting from chronic inflammation and the persistent presence of ectopic lesions [ 6 , 7 ]. A central challenge in the management of OEMs is therefore the effective eradication of lesions while concurrently preserving and restoring ovarian function. A key pathological driver of OEMs progression and therapeutic resistance is fibrosis [ 8 – 10 ]. Ectopic lesions are characterized by dense, collagen-rich connective tissue, a feature intrinsically linked to both pelvic pain and infertility [ 11 ]. This fibrotic stroma, populated by activated myofibroblasts, represents an active pathological process rather than a passive scar [ 12 , 13 ]. Current first-line interventions, including surgical excision and hormonal suppression, frequently fail to target this underlying fibrotic pathology, contributing to high recurrence rates and suboptimal reproductive outcomes [ 14 ]. Pirfenidone (5-methyl-1-phenyl-2-(1 H)-pyridone), an FDA-approved drug for idiopathic pulmonary fibrosis, has emerged as a compelling candidate for antifibrotic therapy [ 15 – 17 ]. Its efficacy derives from a multifaceted pharmacologic profile encompassing potent antifibrotic, anti-inflammatory and antioxidant properties [ 15 , 18 ]. Importantly, its antifibrotic action has been demonstrated in models of renal, hepatic and cardiac fibrosis [ 19 – 22 ]. Preliminary in vitro evidence suggests that pirfenidone can inhibit the fibroblast-to-myofibroblast transition in endometrial stromal cells, highlighting its potential applicability for endometriosis-associated fibrosis [ 23 ]. However, its efficacy in an in vivo model of OEMs, particularly regarding its capacity to resolve fibrosis and concomitantly restore ovarian function, remains unexplored. We therefore hypothesized that pirfenidone alleviates OEMs through dual inhibition of fibrosis and restoration of ovarian function. Our study had two key aspects of novelty: first, the establishment and characterization of a new mouse model replicating OEM-associated infertility; second, the evaluation of the previously unexplored therapeutic potential of pirfenidone in this context. Through an integrated approach combining this model with unbiased proteomics, we aimed to systematically assess its efficacy and elucidate its underlying mechanisms, extending beyond its known antifibrotic properties.

Conclusion

In conclusion, our findings illuminate the multifaceted action of PFD against OEMs via a novel mechanism involving the correction of iron homeostasis and the induction of ferroptosis, alongside its established antifibrotic and anti-inflammatory effects. Future research should focus on dose-ranging studies, validation of these mechanisms in human tissues, and the functional dissection of other promising targets revealed by our proteomic data to fully understand the therapeutic potential of PFD for patients with OEMs.

Discussion

The findings of this study establish pirfenidone (PFD) as a highly promising therapeutic strategy for ovarian endometriosis (OEMs). In the present study, we combined existing modeling methods [ 31 , 32 ] to improve and simplify the procedure, resulting in a novel, simpler, and more successful modeling method that focuses on ovarian endometriosis in a mouse model. By successfully developing a novel murine model of OEMs, we not only recapitulated classic ectopic lesions and fibrosis but also, more critically, systematically demonstrated for the first time in a model system the direct detrimental impact of OEMs on ovarian function. This was evidenced by granulosa cell dysfunction (downregulated Fshr), compromised proliferation (decreased Ki67), increased apoptosis, and significantly impaired fertility, providing a direct intraovarian micropathological basis for endometriosis-associated infertility beyond pelvic anatomical distortions. PFD intervention significantly ameliorated the disease phenotype. Compared with those in the model group, both the size and weight of the ectopic lesions in the PFD-treated group were markedly lower. Furthermore, fibrosis in both the lesions and the ovarian tissues, as assessed by collagen deposition and α-SMA expression, was substantially reversed. The frequently poor correlation between protein and transcript levels underscores the critical importance of proteomics in identifying novel biomarkers and therapeutic targets. For example, proteomic analysis of endometriosis has revealed aberrant expression of TRIM33, implicating it in fibrosis pathogenesis [ 33 ], and revealed that DHX9 is a significantly downregulated protein in ectopic lesions. Crucially, the functional relevance of these discoveries was confirmed by demonstrating that DHX9 knockdown in a mouse model suppresses ectopic lesion growth and collagen deposition, thereby validating proteomics-derived targets and highlighting their therapeutic potential [ 34 ]. To elucidate the underlying molecular mechanisms, we employed an unbiased label-free quantitative proteomic approach, which provided a system-level view of the protein alterations induced by PFD treatment in ectopic lesions. Our proteomic analysis revealed a distinct separation between the OEMs and PFD groups, with 554 proteins whose expression was significantly altered. The functional enrichment patterns of these differentially expressed proteins offer compelling insights into the multifaceted action of PFD. A central finding is the significant downregulation of proteins constituting and organizing the extracellular matrix (ECM), including collagen, and those involved in key inflammatory and immune pathways, such as the IL-17 signaling pathway, neutrophil degranulation, and complement activation. This proteomic signature aligns perfectly with the well-documented antifibrotic and anti-inflammatory properties of PFD and is strongly corroborated by our histological and biochemical validation, which revealed reduced collagen I deposition and α-SMA expression. These findings suggest that PFD disrupts the profibrotic and proinflammatory microenvironment that is critical for the maintenance and progression of endometriotic lesions. Conversely, the proteomic data revealed a novel and potentially crucial mechanism of action: the marked upregulation of proteins involved in iron ion transport and the formation of the intracellular ferritin complex. This, coupled with the significant enrichment of the ferroptosis pathway, points toward a fundamental shift in iron metabolism within the lesions. Ferroptosis, an iron-dependent form of regulated cell death, is characterized by iron accumulation and lipid peroxidation [ 35 , 36 ]. Iron overload in the endometriotic milieu is traditionally thought to exacerbate oxidative stress and inflammation via the Fenton reaction [ 37 , 38 ]. Ferroptosis induced by iron overload promotes fibrosis in ovarian endometriosis and is related to subpopulations of endometrial stromal cells [ 39 ]. The observed reduction in ferric iron deposition via Prussian blue staining in the PFD group provides direct experimental support for this proteomic prediction. We hypothesize that PFD may counteract a state of local iron overload within lesions, potentially by promoting safe iron storage in ferritin complexes. By mitigating iron-mediated oxidative stress and potentially sensitizing cells to ferroptosis, PFD could directly target the survival of endometriotic cells, which are known to exhibit altered iron homeostasis. These findings strongly suggest that the antifibrotic effect of PFD partly stems from its ability to correct aberrant iron homeostasis. We postulate that PFD might “redirect” excessive iron toward specific metabolic pathways rather than merely counteracting it, thereby disrupting the microenvironment of ectopic endometrial cells that rely on iron, ultimately leading to the functional impairment or death of ECM-secreting myofibroblasts. This discovery offers a fresh perspective on the broad antifibrotic profile of PFD. Therefore, we propose a dual mechanistic model for PFD efficacy in endometriosis. First, it directly targets the stromal compartment by inhibiting the excessive ECM deposition and inflammation that drive fibrosis and lesion establishment. Second, it concurrently targets the cellular compartment by rectifying dysregulated iron metabolism, potentially inducing ferroptosis and disrupting the survival of endometriotic cells. The interplay between a degraded inflammatory/fibrotic microenvironment and enhanced iron-mediated cell death could create a synergistic therapeutic effect. This novel link between PFD, iron transport, and ferroptosis in endometriosis opens a new avenue for therapeutic exploration. Future studies should focus on the precise molecular triggers of this pathway and its specific impact on endometriotic cell viability, which could further optimize anti-ferroptosis strategies for treating this debilitating condition. Furthermore, our proteomic data consistently indicated that the complement and coagulation cascades represent another core target of PFD. The inhibition of this system correlated well with the downregulation of collagen I (COL1A1) and α-SMA in the lesions. Complement activation serves as an amplifier of chronic inflammation and can directly stimulate fibroblast activation and ECM production. PFD-mediated suppression of the complement system may fundamentally dampen the persistent inflammatory signals that drive fibrosis. This finding aligns with the known anti-inflammatory effects of PFD in idiopathic pulmonary fibrosis and other fibrotic diseases and is the first time that its upstream action node has been pinpointed in OEMs. Therefore, PFD likely acts through a dual mechanism—suppressing complement-driven inflammation and modulating iron-dependent fibrogenesis—synergistically dismantling the two pillars that sustain lesion growth and fibrosis. The clinical relevance of our findings is substantial. PFD has the ability to concurrently clear fibrotic lesions and restore ovarian function, as evidenced by the recovery of granulosa cell markers and rescued fertility, indicating that it is a potential disease-modifying treatment. This offers a novel strategic option for patients with infertility that overcomes the limitations of conventional surgery and hormonal therapies, which often fail to address the underlying fibrotic pathology and can impair the ovarian reserve. This study, however, has several limitations. First, only a single dose of PFD was administered, which precludes assessment of dose‒response relationships and prevents the identification of the optimal therapeutic window or potential toxicity thresholds—a key consideration for subsequent translational studies. Second, although our proteomic analysis revealed alterations in multiple pathways, including complement and ferroptosis pathways, only selected findings were experimentally validated. The biological relevance of other significantly altered proteins and pathways—such as additional ECM components or immunomodulatory axes—and their specific roles in PFD efficacy remain to be fully elucidated. Future investigations should incorporate dose-ranging designs and employ mechanistic tools such as gene knockout models or pharmacological inhibitors to functionally validate other proteomics-derived targets. Moreover, the precise molecular mediators through which PFD regulates iron deposition, as well as the exact contribution of ferroptosis induction to its antifibrotic effect, require further confirmation via ferroptosis inhibitors and related gain- or loss-of-function experiments. Research should also seek to verify these mechanisms in human endometrial tissues and evaluate the potential of iron-related biomarkers for predicting patient response to PFD.

Supplementary Material

Below is the link to the electronic supplementary material. Supplementary Material 1: Figure S1. Quality control and additional proteomic profiles of OEMs and PFD lesions(A) Bar plot showing the total number of identified peptides and quantified proteins.(B) Distribution of peptide lengths; most peptides fall within 7–20 amino acids, indicating high-quality spectral identification.(C) Box and violin plots illustrating intragroup reproducibility across biological replicates.(D) Heatmap of all differentially expressed proteins between the OEMs and PFD groups (|FC| > 1.5, P < 0.05).(E) KEGG pathway enrichment analysis for up- and downregulated proteins in the PFD group compared with the OEMs group. Supplementary Material 1: Figure S1. Quality control and additional proteomic profiles of OEMs and PFD lesions(A) Bar plot showing the total number of identified peptides and quantified proteins.(B) Distribution of peptide lengths; most peptides fall within 7–20 amino acids, indicating high-quality spectral identification.(C) Box and violin plots illustrating intragroup reproducibility across biological replicates.(D) Heatmap of all differentially expressed proteins between the OEMs and PFD groups (|FC| > 1.5, P < 0.05).(E) KEGG pathway enrichment analysis for up- and downregulated proteins in the PFD group compared with the OEMs group. Supplementary Material 2 Supplementary Material 2

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

⚙ Ask this paper AI returns verbatim quotes from the full text · source: pmc-nxml ⓘ

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Condition tags

endometriosisinfertility

MeSH descriptors

Endometriosis Endometriosis Endometriosis Endometriosis Endometriosis Endometriosis Endometriosis Endometriosis Endometriosis Endometriosis Endometriosis Endometriosis Endometriosis Endometriosis Endometriosis Endometriosis Endometriosis Endometriosis Endometriosis Endometriosis

Citation neighborhood

Papers in the corpus that this work cites (lower rings, blue) and that cite this one (upper rings, green). Dot size scales with the paper's in-corpus citation count — bigger dot = more influential within the endo/adeno field. Click a dot to open that paper. [ expand to 2 hops ] — adds papers reached through this work's immediate citers/citees. Heavier; up to 60 extra dots.

References (38)

SciLite annotations

organisms 45
mus sp. transgenic mice rodents rodents rodents enterobacteriaceae bacterium c/sb65 rodents enterobacteriaceae bacterium c/sb65 mus sp. mus sp. mus sp. mus sp. mus sp. mus sp. mus sp. enterobacteriaceae bacterium c/sb60 mus sp. transgenic mice mus sp. enterobacteriaceae bacterium c/sb65 plants mus sp. mus sp. mus sp. mus sp. mus sp. transgenic mice rattus sp. mus sp. transgenic mice mus sp. transgenic mice transgenic mice mus sp. transgenic mice transgenic mice human human mus sp. rodents rodents rodents transgenic mice transgenic mice mus sp.
chemicals 69
pirfenidone methyl phenyl n-(methylsulfonyl)imidoformate pyridone pirfenidone pirfenidone pirfenidone isoflurane haematoxylin haematoxylin nitrogen urea urea ammonium sodium carbonate peptide peptide peptide formic acid acetonitrile formic acid iron iron pirfenidone pirfenidone nitrocellulose peptide peptide peptide palmitoyl amino acid pirfenidone pirfenidone pirfenidone pirfenidone pirfenidone pirfenidone peptide peptide palmitoyl amino acid iron iron brilliant blue iron iron pirfenidone pirfenidone iron iron iron lipid iron iron iron iron iron iron iron iron iron iron +9 more

Source provenance

europepmc
last seen: 2026-10-06T06:14:42.462031+00:00
openalex
last seen: 2026-06-10T17:14:06.276822+00:00
pmc
last seen: 2026-05-13T20:22:03.195721+00:00
pubmed
last seen: 2026-10-06T06:10:38.983767+00:00
scilite
last seen: 2026-06-28T09:31:30.222730+00:00
License: CC0 · commercial use OK