MiR-19b-3p inhibits cell viability and proliferation and promotes apoptosis by targeting IGF1 in KGN cells

In: Research Square · 2023 · doi:10.21203/rs.3.rs-2892549/v1 · W4375852641
preprint OA: green CC0
AI-generated summary by gemini-2.5-flash-lite, 2026-06-07

MiR-19b-3p targets IGF1, inhibiting KGN cell viability and proliferation while promoting apoptosis, and is elevated in cumulus cells of endometriosis-associated infertility patients.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

AI-generated deep summary by claude@2026-06, 2026-06-07 · read from full text

This study examined miR-19b-3p abundance in cumulus cells and IGF1 concentration in follicular fluid from infertile patients with ovarian endometriosis (n=18) versus tubal infertility controls (n=18), and then tested the mechanism in the human granulosa-like tumor KGN cell line. The authors reported that miR-19b-3p was increased in cumulus cells from endometriosis-associated infertility patients, while follicular fluid IGF1 was decreased, and that IGF1 is a direct target of miR-19b-3p that is negatively regulated in KGN cells. Overexpressing miR-19b-3p reduced KGN cell viability and proliferation, promoted apoptosis, and induced G0/G1 cell-cycle arrest; these miR-19b-3p effects were reversed by co-transfecting IGF1. A stated caveat is that the cell-line experiments used KGN as a surrogate for primary cumulus cells. This paper is centrally about endometriosis — it investigates miR-19b-3p and IGF1 alterations in endometriosis-associated infertility and links miR-19b-3p–IGF1 signaling to apoptosis and cell-cycle effects in granulosa/cumulus-related cells.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Abstract Background: Endometriosis(EM) is a major cause of infertility, but the pathogenesis and mechanisms have not been fully elucidated. MiR-19b-3p is involved in many diseases, but its functional role in EM-associated infertility has not been investigated. In this study, we aimed to examine miR-19b-3p abundance and IGF1 concentration in cumulus cells (CCs) and follicular fluid in EM-associated infertility patients and to reveal the potential role of miR-19b-3p in KGN cells by identifying its target and elucidating the underlying mechanisms. Results: The results showed that compared to the control group (patients with tubal infertility), EM-associated infertility patients had a lower percentage of mature oocytes. Abundance of miR-19b-3p was increased in CCs in EM-associated infertility patients. IGF1 was a direct target of miR-19b-3p and was negatively regulated by miR-19b-3p in KGN cells. Overexpression of miR-19b-3p significantly inhibited viability and proliferation, promoted apoptosis, and arrested cell cycle at G0/G1 phase in KGN cells. The effects of miR-19b-3p could be reversed by co-transfection of IGF1 and the biological effects of miR-19b-3p in KGN cells were mediated by IGF1. In addition, miR-19b-3p targeted IGF1 to downregulate AKT phosphorylation and to participate in apoptotic pathway in KGN cells. Conclusions: This study demonstrates that miR-19b-3p abundance is increased in CCs and IGF1 concentration is decreased in follicular fluid in EM-associated infertility patients, and miR-19b-3p participates in the regulation of biological effects of KGN cells by targeting IGF1.
Full text 117,832 characters · extracted from preprint-html · click to expand
MiR-19b-3p inhibits cell viability and proliferation and promotes apoptosis by targeting IGF1 in KGN cells | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article MiR-19b-3p inhibits cell viability and proliferation and promotes apoptosis by targeting IGF1 in KGN cells Youzhu Li, Yuanyuan Ye, Hengyuan Zhang, Ye Yang, Ningqing Zhang, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-2892549/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background: Endometriosis(EM) is a major cause of infertility, but the pathogenesis and mechanisms have not been fully elucidated. MiR-19b-3p is involved in many diseases, but its functional role in EM-associated infertility has not been investigated. In this study, we aimed to examine miR-19b-3p abundance and IGF1 concentration in cumulus cells (CCs) and follicular fluid in EM-associated infertility patients and to reveal the potential role of miR-19b-3p in KGN cells by identifying its target and elucidating the underlying mechanisms. Results: The results showed that compared to the control group (patients with tubal infertility), EM-associated infertility patients had a lower percentage of mature oocytes. Abundance of miR-19b-3p was increased in CCs in EM-associated infertility patients. IGF1 was a direct target of miR-19b-3p and was negatively regulated by miR-19b-3p in KGN cells. Overexpression of miR-19b-3p significantly inhibited viability and proliferation, promoted apoptosis, and arrested cell cycle at G0/G1 phase in KGN cells. The effects of miR-19b-3p could be reversed by co-transfection of IGF1 and the biological effects of miR-19b-3p in KGN cells were mediated by IGF1. In addition, miR-19b-3p targeted IGF1 to downregulate AKT phosphorylation and to participate in apoptotic pathway in KGN cells. Conclusions: This study demonstrates that miR-19b-3p abundance is increased in CCs and IGF1 concentration is decreased in follicular fluid in EM-associated infertility patients, and miR-19b-3p participates in the regulation of biological effects of KGN cells by targeting IGF1. Endometriosis infertility miR-19b-3p Insulin-like growth factor 1 Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Background Endometriosis (EM) is a common gynecological, often chronic and inflammatory condition characterized by the presence of endometrial-like tissue in aberrant locations outside the uterus, mainly in the pelvic area including the ovaries, ligaments and peritoneal surfaces. The disease arises during the reproductive years of women and affects 5–10% of reproductive-age women( 1 ). The prevalence of EM increases dramatically to as high as 25–50% in women with infertility and 30–50% of women with EM are infertility( 2 , 3 ). The association between EM and infertility is well supported by the literatures, but the pathogenesis and mechanisms of EM-associated infertility have not been fully elucidated. Techniques of assisted reproduction to stimulate the follicular development and ovulation represent effective treatment alternatives for EM-associated infertility patients( 4 ). Granulosa cells(GCs) in the follicular microenvironment play an important role in the competency of oocyte via direct gap junctions( 5 ). It has been shown that the follicular microenvironment altered in EM-associated infertility patients, involvement of the imbalance between reactive oxygen species and antioxidants in the follicular fluid( 6 , 7 ) and changes in the concentrations of various cytokines caused by differences in endocrine, paracrine and autocrine environments( 8 , 9 ). These changes have been speculated to have detrimental effects in normal physiology of the GCs including changes in cell cycle, increased apoptosis, increased oxidative stress( 10 ) and dysregulation of molecular pathways involved in development and growth of GCs( 11 ), and thus have a negative effect on folliculogenesis and oocyte maturation, ultimately affect the fertility of EM patients. Cumulus cells (CCs) are originating from granulosa cells (GCs) differentiation during antrum formation in the follicle. In this study, we aimed to investigate the functional changes of CCs in EM-associated infertility patients, however, it is difficult to obtain primary human CCs in a sizable amount and culture many generations in vitro. Human granulosa-like tumor cell line KGN maintains the physiological characteristics of normal GCs and well grows many times of passages in culture( 12 ), and KGN cells have been extensively used to study the function and regulatory mechanism of biological factors of GCs ( 13 – 15 ). Therefore, KGN cells were used for further functional and mechanistic studies. MicroRNAs (miRNAs) are endogenously produced, small non-coding single-stranded RNAs, which function primarily by binding to the 3′-untranslated region (3′UTR) of target message RNA (mRNAs), to block translation or impact mRNA stability( 16 ). It has been shown that aberrant expression of miRNAs are associated with various diseases, including EM and infertility( 17 , 18 ). Furthermore, several miRNAs are revealed to be involved in the regulation of proliferation, apoptosis and autophagy in GCs, such as miR-181b, miR-199a-5p and miR-21-3p( 19 – 21 ). MiR-19b-3p has been shown to induce cell proliferation in goat male germline stem cells( 22 ) and inhibition of miR-19b promoted ovarian GCs proliferation in polycystic ovary syndrome (PCOS)( 23 ). However, the functional role of miR-19b-3p in CCs in EM-associated infertility patients has not been investigated. Insulin-like growth factor 1 (IGF1) is a peptide hormone, which serves significant roles in cell proliferation, survival and differentiation of numerous cell types. IGF1 has been reported to act through a paracrine/autocrine mode on GCs and on the oocyte, regulating cell proliferation, differentiation, survival, and steroidogenesis as well as oocyte maturation( 24 ). The IGF system has been implicated in the pathogenesis of EM. However, the association between IGF1 level and EM-associated infertility is under debate. Early case-control studies showed a positive association( 25 , 26 ), but some other studies found no association( 27 , 28 ). In addition, little is known about the relation between follicular fluid IGF1 concentration and EM-associated infertility. Therefore, the aim of the study was to examine miR-19b-3p abundance and IGF1 concentration in CCs and follicular fluid in EM-associated infertility patients and investigate the role of miR-19b-3p in KGN cells and elucidate the underlying mechanisms. Materials and methods Patient information The study was approved by the ethics committee of the First Affiliated Hospital of Xiamen University and written informed consents for participation were obtained from patients. A total of 36 infertile patients (18 patients with ovarian EM and 18 patients with tubal infertility) who underwent ovarian stimulation for in vitro fertilization(IVF) at the Reproductive Medicine Center (the First Affiliated Hospital of Xiamen University, Xiamen) were enrolled in our study. The common inclusion criteria for the two groups were as follows: age between 20 and 37 years, normal sexual life for at least 12 months without contraception and lack of pregnancy, regular menstrual cycle (23–35 days), normal ovulation, normal male semen quality, BMI < 30, serum basal follicle follicle-stimulating hormone < 10 IU/L; and normal liver and kidney function and lack of additional gynecological diseases. Patients in EM-associated infertility group were diagnosed with ovarian EM diagnosed by laparoscopy and histology. Factors of fallopian tubes such as tubal obstruction are an isolated cause of infertility comprised the control group. The exclusion criteria of the two groups included patients with PCOS, poor ovarian function or hyperprolactinemia; diabetes or other endocrine diseases, cardiovascular diseases, dyslipidemia, systemiclupus erythematosus and other rheumatic diseases; a history of smoking, alcoholism and drug addiction; and patients with uterine fibroids, endometritis and ovarian malignant tumors. Ovarian stimulation protocols Patients in control group were treated with the long protocol. Gonadotrophin releasing hormone agonist (GnRH-a) (Ipson Pharma Biotech, Paris, France) was subcutaneous injected from the 2 nd to the 4 th day of the menstrual cycle or in the luteal stage (5–6 days after ovulation). Patients in EM-associated infertility group were treated with the improved super-long protocol. 3.75mg of GnRH-a was injected from the 2 nd to the 4 th day of the menstrual cycle. Half dose of GnRH-a was injected 28 days later. Ultrasound examination and serum hormone detection were conducted on the 20 th day following the second GnRH-a injection. For the both group, ovarian stimulation was carried out when pituitary desensitization was achieved. In the process of controlled ovarian stimulation, the starting dose of recombinant human FSH (rhFSH) (Merck Serono, Rome, Italy) was determined according to the ovarian responsiveness. When there were two follicles diameter > 18 mm or three follicles diameter > 17 mm, recombinant human villous gonadotropin (hCG) (Ovitrelle®; Merck-Serono) was used for triggering final oocyte maturation. The collection of follicular fluid and CCs On the oocyte retrieval day, clear follicular fluid without blood or flushing solution was collected in a 15 ml disposable sterile tube and centrifuged at 3000×g for 10 min at 4 °C. CCs were collected from oocyte-corona-cumulus complex (OCCC) transvaginally 38 h following hCG administration. Following the completion of follicular puncture, OCCC were collected in MOPS culture medium (Vitrolife, Goteborg, Sweden). The oocytes were rapidly stripped by a mechanical method under stereomicroscopy. CCs were washed in culture medium three-times and subsequently stored at −80◦C for RNA extraction. ELISA The follicular fluid was collected after centrifugation at 3000×g for 10 min at 4 °C. IGF1 ELISA kit with a detection range of 1.56-100ng/mL and coefficient of variation <10% (CAT# E-EL-H0086c, Elabscience, Wuhan, Hubei, China) was used to measure IGF1 concentration in follicular fluid according to manufacturer instructions. Cell culture, plasmid construction and cell transfection The human granulosa-like tumor cell line KGN was purchased from IMMOCELL (Xiamen, Fujian, China) and cultured in Dulbecco's modified Eagle's medium and Ham's F-12 medium (DMEM/F12, GIBCO, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (FBS, Hyclone, South Logan, UT, USA) at 37 °C in a humidified atmosphere of 5% CO2. MiR-19b-3p mimic and its negative control (mimic NC), as well as miR-19b-3p inhibitor and its negative control (inhibitor NC), were designed and cloned by GeneCopoeia (Guangzhou, Guangdong, People’s Republic of China). The sequences are as follows: miR-19b-3p mimic, 5’-UGUGCAAAUCCAUGCAAAACUGA-3’; mimic NC, 5’-UUUGUACUACACAAAAGUACUG-3’; miR-19b-3p inhibitor, 5’-UCAGUUUUGCAUGGAUUUGCACA-3’; inhibitor NC, 5’-CAGUACUUUUGUGUAGUACAAA-3’. The transfection was performed using Lipofectamine RNAiMAX transfection reagent (Thermo Fisher Scientific) according to the manufacturer’s protocol. PcDNA3.3 (+) plasmid backbone (Life Technologies) was used to construct the pcDNA3.3-IGF1 (with 3’ UTR and without 3’ UTR) expression vectors and the empty vector was used as a blank control. They were bought from GeneCopoeia (Guangzhou, Guangdong, People’s Republic of China) and were transfected into KGN cell using the Lipofectamine 3000 transfection reagent (Thermo Fisher Scientific). For transfection, oligonucleotides were allowed to form transfection complexes with Lipofectamine 2000 (Life Technologies), subsequently added to KGN cells at a final concentration of 100 nmol/L, and left to incubate for 8 h before medium change. For co-transfections, cells seeded in six-well plates were transfected with 1.6 μg of oligonucleotides and 1.6 μg of control or overexpression vectors with the addition of 8 μl of Lipofectamine 2000. Functional experiments were performed 2 days after the transfection and each detection was conducted in triplicate. Quantitative real-time RT–PCR (qRT-PCR) Total RNA was isolated from cell cultures using the RNAiso Plus kit (Takara, Dalian, China) according to the manufacturer’s instructions, and was reverse transcribed to cDNA with the PrimeScript™ RT Reagent Kit (Takara, Dalian, China). QRT-PCR was conducted to detect the abundance of miR-19b-3p and IGF1 with the SYBR Premix Ex Taq kit (Takara, Dalian, China) on the Light Cycler 480 system (Roche, USA). The thermocycling conditions were: 95°C for 30 sec, followed by 40 cycles of 95°C for 5 sec, 58°C for 20 sec, and 72°C for 20 sec. Relative gene expression values were obtained using 2 (-ΔΔCt) method and normalized using controls U6. All samples were examined in triplicate. The primers used for PCR were as follows: IGF1, 5’- CTCTTCAGTTCGTGTGTGGAGAC-3’ (forward) and 5’-CAGCCTCCTTAGATCACAGCTC-3’ (reverse); miR-19b-3p, 5’-CGTGTGCAAATCCATGCAA-3’ (forward) and 5’- AGTGCAGGGTCCGAGGTATT’ (reverse); GAPDH 5'-GAAGGTGAAGGTCGGAGTC-3' (forward)and reverse 5'-GAAGATGGTGATGGGATTTC-3'(reverse); U6, 5’-GCTTCGGCAGCACATATACTAAAAT-3’ (forward) and 5’-CGCTTCACGAATTTGCGTGTCAT-3’ (reverse). Luciferase reporter constructs and luciferase activity assay The IGF1 3′UTR was amplified using PCR from the genomic DNA of KGN cells using the following primers: forward primer, 5′-CTCGCTAGCCTCGAGGCCACCGCAGGATCCTTTGC-3′; reverse primer, 5′-CATGCCTGCAGGTCGACCTCAAAGTTGCAACTATTTGC-3′. The IGF1 3′UTR fragment was cloned downstream firefly luciferase reporter gene in the pmirGLO vector (Antihela, Xiamen, Fujian, China). The mutant version of pmirGLO-IGF1 3′UTR, pmirGLO-IGF1 3′UTR Mut, was constructed using the QuikChange XL SiteDirected Mutagenesis Kit (Agilent Technologies, Santa Clara, CA, USA). The following primers were used: Mut1 forward primer, 5-′TTAGGAGTGATCGACGCCTTGCAAAAATGG -3′; Mut1 reverse primer, 5′- AAGGCGTCGATCACTCCTAAAGACAATGTTG -3′; Mut2 forward primer, 5-′TTTCCTTATCGACGCTTCTTTCTACACAAC -3′; Mut2 reverse primer, 5-′AAGAAGCGTCGATAAGGAAACAATTCATAAAC -3′. KGN cells were seeded into 6-well plates at a density of 2 × 10 6 per well and were co-transfected with 200 pmol/well miR-19b-3p mimic or mimic NC and 4 μg/well pmirGLO-IGF1 3′UTR or pmirGLO-IGF1 3′UTR Mut using Lipofectamine RNAiMAX transfection reagent. Cells were collected 24 h after transfection and the luciferase activity was detected using a luciferase reporter gene assay kit (Promega, Madison, WI, USA) according to the manufacture’s instruction. 3-(4,5-Dimethylthiazol-2-yl)-2,5-di-Phenyltetrazolium Bromide (MTT) Assay KGN cells (3 × 10 3 /well) were seeded into 96-well plates and then transfected with 15 pmol/well miR-19b-3p mimic or 15 pmol/well miR-19b-3p inhibitor. At different time points (0 h, 24 h, 48 h, 72 h), 20 μL MTT solution (Yeason) was added into each well and then incubated at 37°C for 4 h. The medium was removed and 150 μL dimethyl sulfoxide (DMSO, Sigma-Aldrich, St. Louis, MO, USA) was added into each well. After 20 min incubation, the optical density at 490 nm (OD 490 ) was measured using a SpectraMax Absorbance Reader (Molecular Devices, San Francisco, CA, USA). EdU assay KGN cells were seeded into 96-well plates at a density of 1 × 10 4 cells per well and transfected with 15 pmol/well miR-19b-3p mimic or 15 pmol/well miR-19b-3p inhibitor. After a 48 h transfection, the EdU assay was performed using an Edu kFluor647-EdU Cell Proliferation Assay kit (KGA335, KeyGen Biotech) in accordance with the manufacturer's instructions. EdU-positive cells (green nuclei) and EdU-negative cells (only blue nuclei) were observed and photographed under a microscope (200×, BX53, Olympus, TKY, Japan). The number of EdU-positive cells were counted using Image J 1.8.0v (NIH, Bethesda, MD, USA) and the percentage of EdU-positive cells was calculated. Flow cytometry analysis KGN cells were seeded into 6-well plates at a density of 1 × 10 6 cells per well and transfected with 200 pmol/well miR-19b-3p mimic or 200 pmol/well miR-19b-3p inhibitor. After a 48 h transfection, the cells were harvested for apoptosis and cell cycle assays. For cell apoptosis assay, the cells were stained with 200 µg/mL Annexin V-fluorescein isothiocyanate (Annexin V-FITC, Life Technologies) and 20 µg/mL propidium iodide (PI, CAT# C1052, Beyotime, Shanghai, China) in the dark for 10 min. For cell cycle analysis, cells were resuspended in PBS and then fixed in 70% ethanol for 4 h at 4 °C. The fixed cells were incubated with 0.5 mL PBS containing 10μg/mL RNase and 0.2% Triton X-100 for 30 min at 37°C, then stained with 20 μg/mL PI for 10 min in the dark. Finally, the stained cells were subjected to a flow cytometer NovoCyte 1300 (ACEA, San Diego, CA, USA). Western Blot The total protein was extracted from the cell lysates using RIPA buffer (Tian Gen, Beijing, China). The concentration of protein in the samples was determined using the BCA quantification method (CAT# 20201ES76, Yeason, Shanghai, China). Samples (20 μg protein per lane) were loaded on 10% sodium dodecyl sulfate–polyacrylamide (SDS-PAGE) gels for electrophoresis and then transferred onto PVDF membranes (Millipore, MA, USA). The membranes were blocked with 5% bovine serum albumin (BSA, Sangon Biotech. Shanghai, China) at 28 ℃ for 1 h and probed with primary antibodies against IGF1 (1:1000, CAT# ab263907, Abcam, Shanghai, China), p-AKT (1:1000, CAT# 66444-1-Ig, Proteintech, Wuhan, Hubei, China), AKT(1:2000, CAT# 60203-2-Ig, Proteintech), BAX(1:1000, CAT# ab182733, Abcam), BCL-2(1:4000, CAT# 60178-1-Ig, Proteintech), or GAPDH (1:3000, CAT# 10494-1-AP, Proteintech) at 4 °C overnight. After wash with TBST buffer for five times, the membranes were incubated with horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG (H + L) (1:5000, CAT# SA00001‑2, Proteintech) or HRP- conjugated goat anti-mouse IgG (H + L) (1:2000, CAT# ab6728, Abcam) at 28 ℃ for 1 h and washed again with TBST. Band densities were measured using image analysis system (WD-9413B, Liuyi, Beijing, China) and analyzed using ImageJ software (National Institutes of Health, Bethesda, Maryland) . Statistical analysis Statistical analyses were performed using SPSS 18.0 (SPSS, Inc., Chicago, IL, USA). Differences between two groups were analyzed using Student's t test (unpaired, two-tailed) or chi-square c 2 test. A p < 0.05 was considered to be a statistically significant difference. Results The percentage of mature oocytes in IVF is decreased in EM-associated infertility group and miR-19b-3p in CCs is increased in EM-associated infertility patients The age of patients, the number of oocytes retrieved and the number of mature oocytes in the EM-associated infertility group and the control group showed no statistical differences, but EM-associated infertility group had a significant lower percentage of mature oocytes (Table 1 ). In order to determine the possible function of miR-19b-3p in the EM-associated infertility patients, we first examined the abundance of miR-19b-3p in CCs in the EM-associated infertility group and the control group by qRT-PCR, the result showed that miR-19b-3p abundance is increased in the EM group (Fig. 1 ). Table 1 General characteristics of patients in two groups Characteristics EM-associated infertility group (n = 18) Control group (n = 18) t / χ 2 P Age(years) 29.89±4.78 28.94±2.78 0.725 0.473 The number of oocytes retrieved 12.11±6.37 11.67±4.55 0.241 0.811 The number of mature oocytes 9.33±6.23 11.33±4.59 1.097 0.281 Percentage of mature oocytes 77.06% (168/218) 97.14% (204/210) 37.919 ༜0.01 MiR-19b-3p overexpression inhibits cell viability and proliferation, promotes apoptosis and arrests cell cycle at G0/G1 phase in KGN cells In order to investigate the impact of miR-19b-3p in CCs, we transfected miR-19b-3p mimic and inhibitor into human granulosa-like tumor cell line KGN, then MTT assay, EdU assay and apoptosis assay were performed. As indicated in Fig. 2 A, overexpression of miR-19b-3p impaired the cell viability compared to cells transfected with a control miRNA(mimic NC), and miR-19b-3p inhibitor led to markedly increased cell viability. Figure 2 B and 2 C displayed that the number of EdU-positive cells was clearly decreased in cells transfected with miR-19b-3p mimic but increased in cells transfected with miR-19b-3p-inhibitor. Figure 2 D and 2 E showed that overexpression of miR-19b-3p increased the rate of apoptosis in KGN cells, and underexpression of miR-19b-3p exhibited an opposite result. In addition, the effects of abnormal expression of miR-19b-3p on the cell cycle distribution were investigated using flow cytometry. As shown in Fig. 2 F and 2 G, the cells transfected with miR-19b-3p mimic exhibited a significantly increased percentage of G0/G1 phase cells. In contrast with that, the cells transfected with miR-19b-3p inhibitor exhibited a significantly decreased proportion of G0/G1 phase cells. Taken together, these results indicated that miR-19b-3p overexpression inhibited viability and proliferation, promoted apoptosis and arrested cell cycle at G0/G1 phase in KGN cells. MiR-19b-3p decreased IGF1 concentration by targeting its 3 ′ UTR in KGN cells To explore the underlying mechanism of miR-19b-3p in KGN cells, TargetScan bioinformatics tool was used to analyze potential direct targets of miR-19b-3p. Of all of the hypothetical targets which have multiple binding sites with miR-19b-3p, IGF1, an important growth-promoting polypeptide that plays an important role in cell proliferation was selected (Fig. 3 A). To directly test the target relationship, we constructed the luciferase reporter vector by cloning the wild type (Wt) or mutant (Mut) of IGF1-3’UTR into pmirGLO vector, and then co-transfected with miR-19b-3p mimic or miR control (miR-NC). The results showed that the luciferase activity was significantly attenuated by co-transfection of miR-19b-3p with IGF1 3’UTR Wt in KGN cells, however, no significant difference was observed by co-transfection of miR-19b-3p with IGF1 3’UTR Mut (Fig. 3 B). By qRT-PCR and western blot analysis, we found that both mRNA abundance (Fig. 3 C) and protein concentration (Fig. 3 D) of IGF1 were significantly reduced in KGN cells transfected with miR-19b-3p mimic, compared to those transfected with mimic NC. These results indicated that IGF1 was a direct target of miR-19b-3p and was negatively regulated by miR-19b-3p in KGN cells. We also examined the concentrations of IGF1 protein in the follicular fluid by using Elisa analysis and the mRNA abundance of IGF1 in CCs in EM-associated infertility patients. As shown in Fig. 3 E and Fig. 3 F, IGF1 protein concentration was decreased in the follicular fluid in EM group, however, the mRNA abundance of IGF1 was increased in the CCs in EM group. IGF1 is required for the biological effects of miR-19b-3p in KGN cells To further verify the functional connection between miR-19b-3p and its target IGF1, KGN cells were transfected with miR-NC, miR-19b-3p, miR-19b-3p + pcDNA3.3-IGF1 (without 3′UTR) and miR-19b-3p + pcDNA3.3-IGF1 (with 3′UTR). When IGF1 was ectopically overexpressed, the inhibition of cell viability and proliferation (Fig. 4 A ~ C) and the promotion of cell apoptosis (Fig. 4 D&E) were partially reversed, which indicated that co-transfection of IGF1 partially rescued the impact resulted by miR-19b-3p. Besides, compared with cells transfected with miR-19b-3p + pcDNA3.3-IGF1 (without 3′UTR), cells transfected with miR-19b-3p + pcDNA3.3-IGF1 (with 3′UTR) exhibited decreased cell viability and proliferation (Fig. 4 A ~ C), increased cell apoptosis (Fig. 4 D&E) and increased G0/G1 phase cells (Fig. 4 F&G), which further confirmed that miR-19b-3p functions via interacting with IGF1-3′UTR. These results indicated that the effects of miR-19b-3p on KGN cells, including inhibits cell viability and proliferation, promotes apoptosis and arrests cell cycle at G0/G1, were mediated by IGF1. Effects of miR-19b-3p on the AKT phosphorylation and apoptotic regulatory genes BCL2 and BAX in KGN cells We next investigated whether miR-19b-3p activated AKT by suppressing IGF1 expression and the effect of miR-19b-3p on apoptotic regulatory genes BCL2 and BAX. Western blot analysis was performed to measure the concentration of related proteins. As Fig. 5 showed, the concentration of p-AKT/t-AKT decreased following transfection of the miR-19b-3p. And co-transfection of IGF1 significantly increased the concentration of p-AKT/t-AKT, besides, compared with KGN cells transfected with miR-19b-3p + pcDNA3.3-IGF1(without 3’UTR), p-AKT/t-AKT concentration was significantly lower in cells treated with miR-19b-3p + pcDNA3.3-IGF1(with 3’UTR). These findings suggested that IGF1 promotes AKT phosphorylation and miR-19b-3p targeted IGF1 to downregulate AKT phosphorylation in KGN cells. Similarly, the concentration of BAX increased and BCL2 decreased in cells transfected with miR-19b-3p. Co-transfection of IGF1 significantly downregulated BAX and upregulated BCL2 expression, and compared with KGN cells transfected with miR-19b-3p + pcDNA3.3-IGF1 (without 3’UTR), BAX concentration was significantly higher and BCL2 concentration was significantly lower in cells treated with miR-19b-3p + pcDNA3.3-IGF1 (with 3’UTR). These findings suggested that miR-19b-3p might participate in apoptotic pathway by targeting IGF1 in KGN cells. Discussion In this study, we first demonstrated a possible relationship between miR-19b-3p and CCs in EM-associated infertility, and focused on the functional role of miR-19b-3p in KGN cells and its underlying mechanism. Our results showed that the expression level of miR-19b-3p was significantly increased in CCs in EM-associated infertility patients. Overexpression of miR-19b-3p significantly inhibited cell viability and proliferation, promoted apoptosis, and arrested cell cycle at G0/G1 phase in KGN cells. Conversely, inhibition of miR-19b-3p expression exhibited the opposite results. Additionally, it was identified that IGF1 was a direct target of miR-19b-3p in KGN cells and was negatively regulated by miR-19b-3p. Co-transfection of IGF1 rescued the impact resulted by miR-19b-3p, and the biological effects of miR-19b-3p in KGN cells were mediated by IGF1. MiR-19b belongs to the miR17 family, which plays a critical role during early mammalian development and regulates stem cell differentiation( 29 ). It has been demonstrated that miR-19b is involved in the regulation of various biological process, including cellular proliferation, differentiation, migration, invasion and apoptosis. It was reported that higher expression of miR-19b-3p were associated with oligoasthenozoospermia and male infertility( 30 ). MiR-19b-3p was differentially expressed in the spent culture media after embryo transfer and showed an AUC value for predicting positive pregnancy outcomes, both, from spent culture media and sperm collected from infertile couples attending infertility treatment( 31 ). In was also shown that miR-19b-3p was differentially expressed in ovarian hyperresponders and normal responders( 32 ). Heat shock during in vitro maturation of bovine oocytes disturbs bta-miR-19b abundance after in vitro fertilization( 33 ). These findings lead us to hypothesize that the miR-19b could play an essential role in reproduction, however, there was limited information about the role in EM-associated infertility. This was the first time to confirm that miR-19b-3p was involved in EM-associated infertility. In the current study, we demonstrated that the abundance level of miR-19b-3p was increased in the CCs of EM-associated infertility patients, suggesting a potential role for miR-19b-3p in the pathogenesis of EM-associated infertility. Subsequently, overexpression and underexpression of miR-19b-3p was conducted in KGN cells, and the viability, proliferation and apoptosis ability were evaluated. These results demonstrated that miR-19b-3p inhibited viability and proliferation and promoted apoptosis in KGN cells and the mechanism for proliferation inhibition was probably due to that miR-19b-3p overexpression arrested cell cycle at G0/G1 phase. Interestingly, ZHONG ZH et al( 23 ) determined that miR-19b is decreased in PCOS GCs and miR-19b could be a GCs proliferation inhibitor, however, the mechanism regarding cell proliferation was that miR-19b overexpression arrested cell cycle at G2/M phase. The reason for the differences is unknown, and further research is needed to reveal it. It has been reported that IGF1 was a direct target of miR-19b in PCOS GCs( 23 ). In consistent with that, our research further demonstrated that IGF1 was a direct target of miR-19b-3p in KGN cells. IGF1 is a critical growth-promoting polypeptide, which has been shown to serve as an intra-ovarian regulator of follicle function and exerts direct effects on human GCs function( 34 ). IGF1 acts on GCs in an autocrine fashion and in conjunction with gonadotropins, appears to have role in promoting follicle growth, steroid secretion and as an anti-atretic hormone( 35 ). There was an indication that the bioavailability of IGF1 was reduced during the oocyte maturation process in the sense that the concentration of free IGF1 in the follicular fluid was lower in the oocyte-mature group than in the oocyte-immature group. A study of mares follicles showed that lower free IGF1 concentrations were associated with maturation of oocyte but not with maturation of the follicle, which suggested a possible function of IGF1 on oocyte maturation( 36 ). Kucera R et al. ( 28 ), who investigated follicular fluid level of IGF1 in women with fertility disorders, demonstrated that IGF1 was significantly lower in the entire group with fertility disorders, but no significant difference was found in fertility disorders caused by EM. However, in our study, we found that IGF1 protein concentration in the follicular fluid and the percentage of mature oocytes were both significantly decreased in EM-associated infertility patients. Whether there is a relation between IGF1 concentration in the follicular fluid and oocyte maturation remains to be seen. In addition, the mRNA abundance of IGF1 was increased in the CCs in EM-associated infertility patients. There is no forceful evidence to explain the discrepancy between IGF1 protein concentration in follicular fluid and IGF1 mRNA abundance in CCs and further research is needed to reveal it. We speculated it might be due to the complicated regulation in vivo. There is no trivial relationship between the concentration of a transcript and the concentration of the protein derived from a particular locus. Systematic studies quantifying transcripts and proteins at genomic scales revealed that multiple processes beyond transcript concentration that contribute to establishing the expression level of a protein, including translation rates, translation rate modulation, modulation of a protein’s half-life, protein synthesis delay and protein transport( 37 ). Furthermore, our study found that co-transfection of IGF1 and miR-19b-3p in KGN cells rescued the proliferation inhibition and apoptosis promotion effects resulted by miR-19b-3p, whereas co-transfection of IGF1-3’UTR and miR-19b-3p in KGN cells decreased the rescue effects. These results further confirmed that IGF1 could promote proliferation and inhibit apoptosis in KGN cells and the functions of it were mediated by IGF1. Increasing evidence suggests that phosphatidylinositol-3-kinase/protein kinase B (PI3K-AKT) signaling regulates ovarian function, including the recruitment of primordial follicles, GCs proliferation, survival of the corpus luteum and oocyte maturation( 38 ). Our study further showed that miR-19b-3p overexpression regulated IGF1 to decrease p-AKT level in KGN cells. The investigation of the mechanisms of apoptosis may help elucidate the pathologies of uncontrolled cell grow or death. BCL-2 family of proteins participates in controlling and regulating the intrinsic apoptosis pathway. Our study demonstrated that miR-19b-3p overexpression significantly decreased BCL-2 concentration and increased BAX concentration, which suggested that miR-19b-3p might participate in regulating cell apoptosis in KGN cells. There are some limitations and weaknesses in this study. Firstly, the stimulation methods and the hormonal treatment used in IVF are different in the two groups. Secondly, due to the difficulty in obtaining primary human CCs or GCs in sizable amounts and surviving many generations in culture, KGN cells rather than primary human GCs were used for functional and mechanistic studies. In conclusion, we found that the abundance of miR-19b-3p in CCs was significantly increased and IGF1 concentration in the follicular fluid was significantly decreased in EM-associated infertility patients. Overexpression of miR-19b-3p inhibited viability and proliferation, promoted apoptosis and arrested cell cycle at G0/G1 phase by directly targeting IGF1 in KGN cells. In addition, overexpression of miR-19b-3p activated PI3K-AKT pathway and regulated the expression of apoptotic related genes BCL2 and BAX. These results provide new evidence for elucidating the mechanism of EM-associated infertility. Abbreviations EM Endometriosis GCs Granulosa cells CCs Cumulus cells miR-19b-3p MicroRNA-19b-3p 3′UTR 3′-untranslated region mRNA Message RNA IGF1 Insulin-like growth factor 1 IVF In vitro fertilization PCOS Polycystic ovary syndrome GnRH-a Gonadotrophin releasing hormone agonist OCCC Oocyte-corona-cumulus complex NC Negative control qRT-PCR Quantitative real-time RT–PCR MTT Assay 3-(4,5-Dimethylthiazol-2-yl)-2,5-di-Phenyltetrazolium Bromide Assay Mut Mutant Wt Wide type Declarations Authors’ contributions Youzhu Li conceived the study and analyzed data. Yuanyuan Ye drafted the manuscript. Hengyuan Zhang, Ye Yang and Ningqing Zhang performed experiments. Hong Gao made suggestions for data collection and revised the drafts. Rongfeng Wu supervised the study and had substantial inputs into the analysis. Funding This work was supported by the Natural Science Foundation of Fujian Province of China (Grant No. 2019J01565), the National Natural Science Foundation of China (No. 82171638) and Xiamen City Medical and Health Guidance Project (No. 3502Z20214ZD1008). Availability of data and materials All data generated or analyzed using this study was included in this published article. The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported. Acknowledgments The authors thank all the participants for their support and cooperation. References Zondervan KT, Becker CM, Koga K, Missmer SA, Taylor RN, Vigano P. Endometriosis. Nat Rev Dis Primers. 2018;4(1):9. Macer ML, Taylor HS. Endometriosis and infertility: a review of the pathogenesis and treatment of endometriosis-associated infertility. Obstet Gynecol Clin North Am. 2012;39(4):535-49. Eisenberg VH, Weil C, Chodick G, Shalev V. Epidemiology of endometriosis: a large population-based database study from a healthcare provider with 2 million members. Bjog. 2018;125(1):55-62. Filip L, Duică F, Prădatu A, Crețoiu D, Suciu N, Crețoiu SM, et al. Endometriosis Associated Infertility: A Critical Review and Analysis on Etiopathogenesis and Therapeutic Approaches. Medicina (Kaunas). 2020;56(9). Albertini DF, Combelles CM, Benecchi E, Carabatsos MJ. Cellular basis for paracrine regulation of ovarian follicle development. Reproduction. 2001;121(5):647-53. Da Broi MG, de Albuquerque FO, de Andrade AZ, Cardoso RL, Jordão Junior AA, Navarro PA. Increased concentration of 8-hydroxy-2'-deoxyguanosine in follicular fluid of infertile women with endometriosis. Cell Tissue Res. 2016;366(1):231-42. Da Broi MG, Jordão AA, Jr., Ferriani RA, Navarro PA. Oocyte oxidative DNA damage may be involved in minimal/mild endometriosis-related infertility. Mol Reprod Dev. 2018;85(2):128-36. Garrido N, Navarro J, Remohí J, Simón C, Pellicer A. Follicular hormonal environment and embryo quality in women with endometriosis. Hum Reprod Update. 2000;6(1):67-74. Cunha-Filho JS, Lemos NA, Freitas FM, Kiefer K, Faller M, Passos EP. Insulin-like growth factor (IGF)-1 and IGF binding protein-1 and -3 in the follicular fluid of infertile patients with endometriosis. Hum Reprod. 2003;18(2):423-8. Saito H, Seino T, Kaneko T, Nakahara K, Toya M, Kurachi H. Endometriosis and oocyte quality. Gynecol Obstet Invest. 2002;53 Suppl 1:46-51. Li Y, Li R, Ouyang N, Dai K, Yuan P, Zheng L, et al. Investigating the impact of local inflammation on granulosa cells and follicular development in women with ovarian endometriosis. Fertil Steril. 2019;112(5):882-91.e1. Nishi Y, Yanase T, Mu Y, Oba K, Ichino I, Saito M, et al. Establishment and characterization of a steroidogenic human granulosa-like tumor cell line, KGN, that expresses functional follicle-stimulating hormone receptor. Endocrinology. 2001;142(1):437-45. Li Y, Liu YD, Chen SL, Chen X, Ye DS, Zhou XY, et al. Down-regulation of long non-coding RNA MALAT1 inhibits granulosa cell proliferation in endometriosis by up-regulating P21 via activation of the ERK/MAPK pathway. Mol Hum Reprod. 2019;25(1):17-29. Li M, Zhao H, Zhao SG, Wei DM, Zhao YR, Huang T, et al. The HMGA2-IMP2 Pathway Promotes Granulosa Cell Proliferation in Polycystic Ovary Syndrome. J Clin Endocrinol Metab. 2019;104(4):1049-59. Cao J, Huo P, Cui K, Wei H, Cao J, Wang J, et al. Follicular fluid-derived exosomal miR-143-3p/miR-155-5p regulate follicular dysplasia by modulating glycolysis in granulosa cells in polycystic ovary syndrome. Cell Commun Signal. 2022;20(1):61. Yates LA, Norbury CJ, Gilbert RJ. The long and short of microRNA. Cell. 2013;153(3):516-9. Zhang J, Xu Y, Liu H, Pan Z. MicroRNAs in ovarian follicular atresia and granulosa cell apoptosis. Reprod Biol Endocrinol. 2019;17(1):9. Ghafouri-Fard S, Shoorei H, Taheri M. Role of Non-coding RNAs in the Pathogenesis of Endometriosis. Front Oncol. 2020;10:1370. Yao W, Pan Z, Du X, Zhang J, Li Q. miR-181b-induced SMAD7 downregulation controls granulosa cell apoptosis through TGF-β signaling by interacting with the TGFBR1 promoter. J Cell Physiol. 2018;233(9):6807-21. Ma L, Zheng Y, Tang X, Gao H, Liu N, Gao Y, et al. miR-21-3p inhibits autophagy of bovine granulosa cells by targeting VEGFA via PI3K/AKT signaling. Reproduction. 2019;158(5):441-52. Shao S, Wang H, Shao W, Liu N. miR-199a-5p stimulates ovarian granulosa cell apoptosis in polycystic ovary syndrome. J Mol Endocrinol. 2020;65(4):187-201. Daguia Zambe JC, Zhai Y, Zhou Z, Du X, Wei Y, Ma F, et al. miR-19b-3p induces cell proliferation and reduces heterochromatin-mediated senescence through PLZF in goat male germline stem cells. J Cell Physiol. 2018;233(6):4652-65. Zhong Z, Li F, Li Y, Qin S, Wen C, Fu Y, et al. Inhibition of microRNA-19b promotes ovarian granulosa cell proliferation by targeting IGF-1 in polycystic ovary syndrome. Mol Med Rep. 2018;17(4):4889-98. Mazerbourg S, Bondy CA, Zhou J, Monget P. The insulin-like growth factor system: a key determinant role in the growth and selection of ovarian follicles? a comparative species study. Reprod Domest Anim. 2003;38(4):247-58. Gurgan T, Bukulmez O, Yarali H, Tanir M, Akyildiz S. Serum and peritoneal fluid levels of IGF I and II and insulinlike growth binding protein-3 in endometriosis. J Reprod Med. 1999;44(5):450-4. Kim JG, Suh CS, Kim SH, Choi YM, Moon SY, Lee JY. Insulin-like growth factors (IGFs), IGF-binding proteins (IGFBPs), and IGFBP-3 protease activity in the peritoneal fluid of patients with and without endometriosis. Fertil Steril. 2000;73(5):996-1000. Matalliotakis IM, Goumenou AG, Koumantakis GE, Neonaki MA, Koumantakis EE, Dionyssopoulou E, et al. Serum concentrations of growth factors in women with and without endometriosis: the action of anti-endometriosis medicines. Int Immunopharmacol. 2003;3(1):81-9. Kucera R, Babuska V, Ulcova-Gallova Z, Kulda V, Topolcan O. Follicular fluid levels of anti-Müllerian hormone, insulin-like growth factor 1 and leptin in women with fertility disorders. Syst Biol Reprod Med. 2018;64(3):220-3. Foshay KM, Gallicano GI. miR-17 family miRNAs are expressed during early mammalian development and regulate stem cell differentiation. Dev Biol. 2009;326(2):431-43. Abu-Halima M, Becker LS, Ayesh BM, Meese E. MicroRNA-targeting in male infertility: Sperm microRNA-19a/b-3p and its spermatogenesis related transcripts content in men with oligoasthenozoospermia. Front Cell Dev Biol. 2022;10:973849. Abu-Halima M, Galata V, Backes C, Keller A, Hammadeh M, Meese E. MicroRNA signature in spermatozoa and seminal plasma of proven fertile men and in testicular tissue of men with obstructive azoospermia. Andrologia. 2020;52(2):e13503. Xie S, Batnasan E, Zhang Q, Li Y. MicroRNA Expression is Altered in Granulosa Cells of Ovarian Hyperresponders. Reprod Sci. 2016;23(8):1001-10. Souza V, Souza GT, Lemos DR, Guimarães JMO, Quintão CCR, Munk M, et al. Heat shock during in vitro maturation of bovine oocytes disturbs bta-miR-19b and DROSHA transcripts abundance after in vitro fertilization. Reprod Domest Anim. 2021;56(8):1128-36. Adashi EY, Resnick CE, D'Ercole AJ, Svoboda ME, Van Wyk JJ. Insulin-like growth factors as intraovarian regulators of granulosa cell growth and function. Endocr Rev. 1985;6(3):400-20. Druckmann R, Rohr UD. IGF-1 in gynaecology and obstetrics: update 2002. Maturitas. 2002;41 Suppl 1:S65-83. Ginther OJ, Gastal EL, Gastal MO, Siddiqui MA, Beg MA. Relationships of follicle versus oocyte maturity to ultrasound morphology, blood flow, and hormone concentrations of the preovulatory follicle in mares. Biol Reprod. 2007;77(2):202-8. Liu Y, Beyer A, Aebersold R. On the Dependency of Cellular Protein Levels on mRNA Abundance. Cell. 2016;165(3):535-50. Makker A, Goel MM, Mahdi AA. PI3K/PTEN/Akt and TSC/mTOR signaling pathways, ovarian dysfunction, and infertility: an update. J Mol Endocrinol. 2014;53(3):R103-18. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-2892549","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":197636228,"identity":"c4920e73-a851-4506-b7d5-cc3915737e8f","order_by":0,"name":"Youzhu Li","email":"","orcid":"","institution":"the First Affiliated Hospital of Xiamen University, Xiamen University","correspondingAuthor":false,"prefix":"","firstName":"Youzhu","middleName":"","lastName":"Li","suffix":""},{"id":197636229,"identity":"8e3cbf3c-2ce0-476c-8a07-eec59151a8d4","order_by":1,"name":"Yuanyuan Ye","email":"","orcid":"","institution":"the First Affiliated Hospital of Xiamen University, Xiamen University","correspondingAuthor":false,"prefix":"","firstName":"Yuanyuan","middleName":"","lastName":"Ye","suffix":""},{"id":197636230,"identity":"7bbd1d86-88c0-4c35-b761-73b0567612b5","order_by":2,"name":"Hengyuan Zhang","email":"","orcid":"","institution":"Huaqiao University","correspondingAuthor":false,"prefix":"","firstName":"Hengyuan","middleName":"","lastName":"Zhang","suffix":""},{"id":197636231,"identity":"51b5468e-d570-4919-b272-9298756a3f93","order_by":3,"name":"Ye Yang","email":"","orcid":"","institution":"Xiamen University","correspondingAuthor":false,"prefix":"","firstName":"Ye","middleName":"","lastName":"Yang","suffix":""},{"id":197636232,"identity":"4d6e955b-e4ee-449e-9783-70fd7e21ac99","order_by":4,"name":"Ningqing Zhang","email":"","orcid":"","institution":"the First Affiliated Hospital of Xiamen University, Xiamen University","correspondingAuthor":false,"prefix":"","firstName":"Ningqing","middleName":"","lastName":"Zhang","suffix":""},{"id":197636233,"identity":"2bb88a3e-bf72-49f0-a850-c4f16980ef86","order_by":5,"name":"Hong Gao","email":"","orcid":"","institution":"the First Affiliated Hospital of Xiamen University, Xiamen University","correspondingAuthor":false,"prefix":"","firstName":"Hong","middleName":"","lastName":"Gao","suffix":""},{"id":197636234,"identity":"af3f03f4-3253-4db2-ae22-e1ac0fc41343","order_by":6,"name":"Rongfeng Wu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA8UlEQVRIiWNgGAWjYFACxgdAwoaHjeHwAYjAAYJamA2ARJocH+OxBJK0HDaWYz5jQJwWg9uHGR8X/GJObGM7803qZhuDHN+NBMbPBfi0nEtmNp7Zx5bYxnN2s3FuG4Ox5I0EZukZeLSYneE/Js3bw5PYJnF242OglsQNNxLYmHnwamFm/83bI5HYJv/mwWGglnpitAAV/DAwZmM4wwiyJcGAkBb7M8zM0rwNCXJsDMeMjXPOSRjOPPOwWRqfFskeZsbPPH/+88g3HH4mnVNmI893PPngZ3xawICxDc6UAHEbCGkAgj9EqBkFo2AUjIKRCwAdjEsJLhbIlQAAAABJRU5ErkJggg==","orcid":"","institution":"the First Affiliated Hospital of Xiamen University, Xiamen University","correspondingAuthor":true,"prefix":"","firstName":"Rongfeng","middleName":"","lastName":"Wu","suffix":""}],"badges":[],"createdAt":"2023-05-04 06:59:30","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-2892549/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-2892549/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":36721866,"identity":"b9a5d041-91d2-488c-9693-16a189e1e6bf","added_by":"auto","created_at":"2023-05-08 22:13:26","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":28864,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eExpression of miR-19b-3p in human cumulus cells. \u003c/strong\u003eAbundance of miR-19b-3p was significantly increased in cumulus cells in EM-associated infertility patients.\u003cstrong\u003e \u003c/strong\u003e**\u003cem\u003eP\u003c/em\u003e<0.01.\u003c/p\u003e","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-2892549/v1/4520adf9151f6a8d846e75bb.png"},{"id":36721863,"identity":"47e6f41a-ebd2-44e3-9f1c-edf264189277","added_by":"auto","created_at":"2023-05-08 22:13:26","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":117308,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe effects of miR-19b-3p on viability, proliferation, apoptosis and cell cycle in KGN cells.\u003c/strong\u003e MiR-19b-3p mimic and control, miR-19b-3p inhibitor and control were transfected into KGN cells. \u003cstrong\u003e(A)\u003c/strong\u003e Cell viability was determined by MTT assay at each indicated time points (0, 24, 48, 72 h). The y-axis displays the OD value at 490 nm. Overexpression of miR-19b-3p inhibited viability in KGN cells.\u003cstrong\u003e (B, C)\u003c/strong\u003e KGN cells were cultured for 48 h after transfection and cell proliferation was determined by EdU assay. The cell proliferation was quantified by counting the amount of Edu-positive cells vs total cells from each group. Green represents the proliferative cells and blue indicates cell nuclei. Overexpression of miR-19b-3p inhibited proliferation in KGN cells.\u003cstrong\u003e (D, E)\u003c/strong\u003eKGN cells were cultured for 48 h after transfection and cell apoptosis was determined using Annexin V/PI staining. Overexpression of miR-19b-3p promoted apoptosis in KGN cells. \u003cstrong\u003e(F, G) \u003c/strong\u003eKGN cells were cultured for 48 h after transfection and cell cycle distribution was determined by Flow cytometry analysis. Overexpression of miR-19b-3p arrested cell cycle at G0/G1 phase in KGN cells. *\u003cem\u003eP\u003c/em\u003e<0.05. **\u003cem\u003eP\u003c/em\u003e<0.01. ***\u003cem\u003eP\u003c/em\u003e<0.001.\u003c/p\u003e","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-2892549/v1/81e24c5141c077fc5c3ccabf.png"},{"id":36723056,"identity":"34b17f0e-57b7-4d6a-9d23-f14bb41f9b6a","added_by":"auto","created_at":"2023-05-08 22:29:26","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":128819,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePrediction and confirmation of direct interaction of IGF1 and miR-19b-3p. (A) \u003c/strong\u003eThe predicted binding sites between IGF1 and miR-19b-3p. \u003cstrong\u003e(B)\u003c/strong\u003eValidation of the miR-19b-3p binding target, determined by luciferase reporter assays. \u003cstrong\u003e(C)\u003c/strong\u003e The mRNA abundance of IGF1 was decreased in KGN cells transfected with miR-19b-3p mimic, determined by qRT-PCR.\u003cstrong\u003e (D) \u003c/strong\u003eThe IGF1 protein concentration was decreased in KGN cells transfected with miR-19b-3p mimic, determined by western blot. \u003cstrong\u003e(E)\u003c/strong\u003e IGF1 protein concentration decreased in the follicular fluid in EM-associated infertility patients, determined by Elisa. \u003cstrong\u003e(F)\u003c/strong\u003eThe mRNA abundance of IGF1 increased in cumulus cells in EM-associated infertility patients, determined by qRT-PCR. *\u003cem\u003eP\u003c/em\u003e<0.05. **\u003cem\u003eP\u003c/em\u003e<0.01.\u003c/p\u003e","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-2892549/v1/48fd6688c2f102c50ee5799c.png"},{"id":36722727,"identity":"bdd14322-513c-4bcd-999f-378598f6e2b5","added_by":"auto","created_at":"2023-05-08 22:21:26","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":128044,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe effects of miR-19b-3p in KGN cells, including inhibiting viability and proliferation, promoting apoptosis and arresting cell cycle at G0/G1, were mediated by IGF1. \u003c/strong\u003eMiR-19b-3p control, miR-19b-3p+vector, miR-19b-3p+pcDNA3.3-IGF1(without 3’UTR) and miR-19b-3p+pcDNA3.3-IGF1(with 3’UTR) were transfected into KGN cells.\u003cstrong\u003e (A) \u003c/strong\u003eCell viability was determined by MTT assay at each indicated time points (0, 24, 48, 72 h). The y-axis displays the OD value at 490 nm. KGN cells transfected with miR-19b-3p+pcDNA3.3-IGF1(with 3’UTR) decreased viability compared with cells transfected with miR-19b-3p+pcDNA3.3-IGF1(without 3’UTR) \u003cstrong\u003e(B, C)\u003c/strong\u003e KGN cells were cultured for 48 h after transfection and cell proliferation was determined by EdU assay. The cell proliferation was quantified by counting the amount of Edu-positive cells vs total cells from each group. Green represents the proliferative cells and blue indicates cell nuclei. KGN cells transfected with miR-19b-3p+pcDNA3.3-IGF1(with 3’UTR) decreased proliferation compared with cells transfected with miR-19b-3p+pcDNA3.3-IGF1(without 3’UTR). \u003cstrong\u003e(D, E)\u003c/strong\u003e KGN cells were cultured for 48 h after transfection and cell apoptosis was determined using Annexin V/PI staining. KGN cells transfected with miR-19b-3p+pcDNA3.3-IGF1(with 3’UTR) increased apoptosis compared with cells transfected with miR-19b-3p+pcDNA3.3-IGF1(without 3’UTR). \u003cstrong\u003e(F,G)\u003c/strong\u003e KGN cells were cultured for 48 h after transfection and cell cycle distribution was determined by Flow cytometry analysis. KGN cells transfected with miR-19b-3p+pcDNA3.3-IGF1(with 3’UTR) increased G0/G1 phase cells compared with cells transfected with miR-19b-3p+pcDNA3.3-IGF1(without 3’UTR). *\u003cem\u003eP\u003c/em\u003e<0.05. **\u003cem\u003eP\u003c/em\u003e<0.01. ***\u003cem\u003eP\u003c/em\u003e<0.001.\u003c/p\u003e","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-2892549/v1/895829c444d5d89827ee43ec.png"},{"id":36722729,"identity":"c7cd314a-11f4-4131-8be4-b63c2a1c2647","added_by":"auto","created_at":"2023-05-08 22:21:26","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":38469,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMiR-19b-3p targets IGF1 to downregulate AKT phosphorylation and participate in apoptotic pathway in KGN cells.\u003c/strong\u003e KGN cells transfected with miR-19b-3p+pcDNA3.3-IGF1(with 3’UTR) exhibited a lower concentration of the protein of IGF1, p-AKT/t-AKT and BCL2, and a higher concentration of the protein of BAX compared with cells transfected with miR-19b-3p+pcDNA3.3-IGF1(without 3’UTR), as determined by Western blot. *\u003cem\u003eP\u003c/em\u003e<0.05. **\u003cem\u003eP\u003c/em\u003e<0.01. ***\u003cem\u003eP\u003c/em\u003e<0.001.\u003c/p\u003e","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-2892549/v1/0c72bc9786a8307265b07e58.png"},{"id":36996584,"identity":"d1d2c33a-8cca-46a3-8cf7-f956b8786dee","added_by":"auto","created_at":"2023-05-14 03:44:26","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1842503,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-2892549/v1/b7264901-637e-47a6-b443-f825f563827b.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"MiR-19b-3p inhibits cell viability and proliferation and promotes apoptosis by targeting IGF1 in KGN cells","fulltext":[{"header":"Background","content":"\u003cp\u003eEndometriosis (EM) is a common gynecological, often chronic and inflammatory condition characterized by the presence of endometrial-like tissue in aberrant locations outside the uterus, mainly in the pelvic area including the ovaries, ligaments and peritoneal surfaces. The disease arises during the reproductive years of women and affects 5\u0026ndash;10% of reproductive-age women(\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e). The prevalence of EM increases dramatically to as high as 25\u0026ndash;50% in women with infertility and 30\u0026ndash;50% of women with EM are infertility(\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e). The association between EM and infertility is well supported by the literatures, but the pathogenesis and mechanisms of EM-associated infertility have not been fully elucidated. Techniques of assisted reproduction to stimulate the follicular development and ovulation represent effective treatment alternatives for EM-associated infertility patients(\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e). Granulosa cells(GCs) in the follicular microenvironment play an important role in the competency of oocyte via direct gap junctions(\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e). It has been shown that the follicular microenvironment altered in EM-associated infertility patients, involvement of the imbalance between reactive oxygen species and antioxidants in the follicular fluid(\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e) and changes in the concentrations of various cytokines caused by differences in endocrine, paracrine and autocrine environments(\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e). These changes have been speculated to have detrimental effects in normal physiology of the GCs including changes in cell cycle, increased apoptosis, increased oxidative stress(\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e) and dysregulation of molecular pathways involved in development and growth of GCs(\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e), and thus have a negative effect on folliculogenesis and oocyte maturation, ultimately affect the fertility of EM patients. Cumulus cells (CCs) are originating from granulosa cells (GCs) differentiation during antrum formation in the follicle. In this study, we aimed to investigate the functional changes of CCs in EM-associated infertility patients, however, it is difficult to obtain primary human CCs in a sizable amount and culture many generations in vitro. Human granulosa-like tumor cell line KGN maintains the physiological characteristics of normal GCs and well grows many times of passages in culture(\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e), and KGN cells have been extensively used to study the function and regulatory mechanism of biological factors of GCs (\u003cspan additionalcitationids=\"CR14\" citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e). Therefore, KGN cells were used for further functional and mechanistic studies.\u003c/p\u003e \u003cp\u003eMicroRNAs (miRNAs) are endogenously produced, small non-coding single-stranded RNAs, which function primarily by binding to the 3\u0026prime;-untranslated region (3\u0026prime;UTR) of target message RNA (mRNAs), to block translation or impact mRNA stability(\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e). It has been shown that aberrant expression of miRNAs are associated with various diseases, including EM and infertility(\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e). Furthermore, several miRNAs are revealed to be involved in the regulation of proliferation, apoptosis and autophagy in GCs, such as miR-181b, miR-199a-5p and miR-21-3p(\u003cspan additionalcitationids=\"CR20\" citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e). MiR-19b-3p has been shown to induce cell proliferation in goat male germline stem cells(\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e) and inhibition of miR-19b promoted ovarian GCs proliferation in polycystic ovary syndrome (PCOS)(\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e). However, the functional role of miR-19b-3p in CCs in EM-associated infertility patients has not been investigated.\u003c/p\u003e \u003cp\u003eInsulin-like growth factor 1 (IGF1) is a peptide hormone, which serves significant roles in cell proliferation, survival and differentiation of numerous cell types. IGF1 has been reported to act through a paracrine/autocrine mode on GCs and on the oocyte, regulating cell proliferation, differentiation, survival, and steroidogenesis as well as oocyte maturation(\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e). The IGF system has been implicated in the pathogenesis of EM. However, the association between IGF1 level and EM-associated infertility is under debate. Early case-control studies showed a positive association(\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e), but some other studies found no association(\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e). In addition, little is known about the relation between follicular fluid IGF1 concentration and EM-associated infertility.\u003c/p\u003e \u003cp\u003eTherefore, the aim of the study was to examine miR-19b-3p abundance and IGF1 concentration in CCs and follicular fluid in EM-associated infertility patients and investigate the role of miR-19b-3p in KGN cells and elucidate the underlying mechanisms.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003e\u003cstrong\u003ePatient information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study was approved by the ethics committee of the First Affiliated Hospital of Xiamen University and written informed consents for participation were obtained from patients. A total of 36 infertile patients (18 patients with ovarian EM and 18 patients with tubal infertility) who underwent ovarian stimulation for in vitro fertilization(IVF) at the Reproductive Medicine Center (the First Affiliated Hospital of Xiamen University, Xiamen) were enrolled in our study. The common inclusion criteria for the two groups were as follows: age between 20 and 37 years, normal sexual life for at least 12 months without contraception and lack of pregnancy, regular menstrual cycle (23\u0026ndash;35 days), normal ovulation, normal male semen quality, BMI \u0026lt; 30, serum basal follicle follicle-stimulating hormone \u0026lt; 10 IU/L; and normal liver and kidney function and lack of additional gynecological diseases. Patients in EM-associated infertility group were diagnosed with ovarian EM diagnosed by laparoscopy and histology. Factors of fallopian tubes such as tubal obstruction are an isolated cause of infertility comprised the control group. The exclusion criteria of the two groups included patients with PCOS, poor ovarian function or hyperprolactinemia; diabetes or other endocrine diseases, cardiovascular diseases, dyslipidemia, systemiclupus erythematosus and other rheumatic diseases; a history of smoking, alcoholism and drug addiction; and patients with uterine fibroids, endometritis and ovarian malignant tumors. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eOvarian stimulation protocols\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePatients in control group were treated with the long protocol. Gonadotrophin releasing hormone agonist (GnRH-a) (Ipson Pharma Biotech, Paris, France) was subcutaneous injected from the 2\u003csup\u003end\u003c/sup\u003e to the 4\u003csup\u003eth\u003c/sup\u003e day of the menstrual cycle or in the luteal stage (5\u0026ndash;6 days after ovulation). Patients in EM-associated infertility group were treated with the improved super-long protocol. 3.75mg of GnRH-a was injected from the 2\u003csup\u003end\u003c/sup\u003e to the 4\u003csup\u003eth\u003c/sup\u003e day of the menstrual cycle. Half dose of GnRH-a was injected 28 days later. Ultrasound examination and serum hormone detection were conducted on the 20\u003csup\u003eth\u003c/sup\u003e day following the second GnRH-a injection. For the both group, ovarian stimulation was carried out when pituitary desensitization was achieved. In the process of controlled ovarian stimulation, the starting dose of recombinant human FSH (rhFSH) (Merck Serono, Rome, Italy) was determined according to the ovarian responsiveness. When there were two follicles diameter \u0026gt; 18 mm or three follicles diameter \u0026gt; 17 mm, recombinant human villous gonadotropin (hCG) (Ovitrelle\u0026reg;; Merck-Serono) was used for triggering final oocyte maturation.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eThe collection of follicular fluid and CCs\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOn the oocyte retrieval day, clear follicular fluid without blood or flushing solution was collected in a 15 ml disposable sterile tube and centrifuged at 3000\u0026times;g for 10 min at 4 \u0026deg;C. CCs were collected from oocyte-corona-cumulus complex (OCCC) transvaginally 38 h following hCG administration. Following the completion of follicular puncture, OCCC were collected in MOPS culture medium (Vitrolife, Goteborg, Sweden). The oocytes were rapidly stripped by a mechanical method under stereomicroscopy. CCs were washed in culture medium three-times and subsequently stored at \u0026minus;80◦C for RNA extraction.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eELISA\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe follicular fluid was collected after centrifugation at 3000\u0026times;g for 10 min at 4 \u0026deg;C. IGF1 ELISA kit with a detection range of 1.56-100ng/mL and coefficient of variation <10% (CAT# E-EL-H0086c, Elabscience, Wuhan, Hubei, China) was used to measure IGF1 concentration in follicular fluid according to manufacturer instructions.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell culture, plasmid construction and cell transfection\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe human granulosa-like tumor cell line KGN was purchased from IMMOCELL (Xiamen, Fujian, China) and cultured in Dulbecco\u0026apos;s modified Eagle\u0026apos;s medium and Ham\u0026apos;s F-12 medium (DMEM/F12, GIBCO, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (FBS, Hyclone, South Logan, UT, USA) at 37 \u0026deg;C in a humidified atmosphere of 5% CO2. MiR-19b-3p mimic and its negative control (mimic NC), as well as miR-19b-3p inhibitor and its negative control (inhibitor NC), were designed and cloned by GeneCopoeia (Guangzhou, Guangdong, People\u0026rsquo;s Republic of China). The sequences are as follows: miR-19b-3p mimic, 5\u0026rsquo;-UGUGCAAAUCCAUGCAAAACUGA-3\u0026rsquo;; mimic NC, 5\u0026rsquo;-UUUGUACUACACAAAAGUACUG-3\u0026rsquo;; miR-19b-3p inhibitor, 5\u0026rsquo;-UCAGUUUUGCAUGGAUUUGCACA-3\u0026rsquo;; inhibitor NC, 5\u0026rsquo;-CAGUACUUUUGUGUAGUACAAA-3\u0026rsquo;. The transfection was performed using Lipofectamine RNAiMAX transfection reagent (Thermo Fisher Scientific) according to the manufacturer\u0026rsquo;s protocol. PcDNA3.3 (+) plasmid backbone (Life Technologies) was used to construct the pcDNA3.3-IGF1 (with 3\u0026rsquo; UTR and without 3\u0026rsquo; UTR) expression vectors and the empty vector was used as a blank control. They were bought from GeneCopoeia (Guangzhou, Guangdong, People\u0026rsquo;s Republic of China) and were transfected into KGN cell using the Lipofectamine 3000 transfection reagent (Thermo Fisher Scientific). For transfection, oligonucleotides were allowed to form transfection complexes with Lipofectamine 2000 (Life Technologies), subsequently added to KGN cells at a final concentration of 100 nmol/L, and left to incubate for 8 h before medium change. For co-transfections, cells seeded in six-well plates were transfected with 1.6 \u0026mu;g of oligonucleotides and 1.6 \u0026mu;g of control or overexpression vectors with the addition of 8 \u0026mu;l of Lipofectamine 2000. Functional experiments were performed 2 days after the transfection and each detection was conducted in triplicate.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eQuantitative real-time RT\u0026ndash;PCR (qRT-PCR)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was isolated from cell cultures using the RNAiso Plus kit (Takara, Dalian, China) according to the manufacturer\u0026rsquo;s instructions, and was reverse transcribed to cDNA with the PrimeScript\u0026trade; RT Reagent Kit (Takara, Dalian, China). QRT-PCR was conducted to detect the abundance of miR-19b-3p and IGF1 with the SYBR Premix Ex Taq kit (Takara, Dalian, China) on\u0026nbsp;the Light\u0026nbsp;Cycler 480 system (Roche, USA). The thermocycling conditions were: 95\u0026deg;C for 30 sec, followed by 40 cycles of 95\u0026deg;C for 5 sec, 58\u0026deg;C for 20 sec, and 72\u0026deg;C for 20 sec. Relative gene expression values were obtained using 2\u003csup\u003e(-\u0026Delta;\u0026Delta;Ct)\u003c/sup\u003e method and normalized using controls U6. All samples were examined in triplicate. The primers used for PCR were as follows: IGF1, 5\u0026rsquo;- CTCTTCAGTTCGTGTGTGGAGAC-3\u0026rsquo; (forward) and 5\u0026rsquo;-CAGCCTCCTTAGATCACAGCTC-3\u0026rsquo; (reverse); miR-19b-3p, 5\u0026rsquo;-CGTGTGCAAATCCATGCAA-3\u0026rsquo; (forward) and 5\u0026rsquo;- AGTGCAGGGTCCGAGGTATT\u0026rsquo; (reverse); GAPDH 5\u0026apos;-GAAGGTGAAGGTCGGAGTC-3\u0026apos; (forward)and reverse 5\u0026apos;-GAAGATGGTGATGGGATTTC-3\u0026apos;(reverse); U6, 5\u0026rsquo;-GCTTCGGCAGCACATATACTAAAAT-3\u0026rsquo; (forward) and 5\u0026rsquo;-CGCTTCACGAATTTGCGTGTCAT-3\u0026rsquo; (reverse).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLuciferase reporter constructs and luciferase activity assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe IGF1 3\u0026prime;UTR was amplified using PCR from the genomic DNA of KGN cells using the following primers: forward primer, 5\u0026prime;-CTCGCTAGCCTCGAGGCCACCGCAGGATCCTTTGC-3\u0026prime;; reverse primer, 5\u0026prime;-CATGCCTGCAGGTCGACCTCAAAGTTGCAACTATTTGC-3\u0026prime;. The IGF1 3\u0026prime;UTR fragment was cloned downstream firefly luciferase reporter gene in the pmirGLO vector (Antihela, Xiamen, Fujian, China). The mutant version of pmirGLO-IGF1 3\u0026prime;UTR, pmirGLO-IGF1 3\u0026prime;UTR Mut, was constructed using the QuikChange XL SiteDirected Mutagenesis Kit (Agilent Technologies, Santa Clara, CA, USA). The following primers were used: Mut1 forward primer, 5-\u0026prime;TTAGGAGTGATCGACGCCTTGCAAAAATGG -3\u0026prime;; Mut1 reverse primer, 5\u0026prime;- AAGGCGTCGATCACTCCTAAAGACAATGTTG -3\u0026prime;; Mut2 forward primer, 5-\u0026prime;TTTCCTTATCGACGCTTCTTTCTACACAAC -3\u0026prime;; Mut2 reverse primer, 5-\u0026prime;AAGAAGCGTCGATAAGGAAACAATTCATAAAC -3\u0026prime;. KGN cells were seeded into 6-well plates at a density of 2 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e per well and were co-transfected with 200 pmol/well miR-19b-3p mimic or mimic NC and 4 \u0026mu;g/well pmirGLO-IGF1 3\u0026prime;UTR or pmirGLO-IGF1 3\u0026prime;UTR Mut using Lipofectamine RNAiMAX transfection reagent. Cells were collected 24 h after transfection and the luciferase activity was detected using a luciferase reporter gene assay kit (Promega, Madison, WI, USA) according to the manufacture\u0026rsquo;s instruction.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3-(4,5-Dimethylthiazol-2-yl)-2,5-di-Phenyltetrazolium Bromide (MTT) Assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eKGN cells (3 \u0026times; 10\u003csup\u003e3\u003c/sup\u003e/well) were seeded into 96-well plates and then transfected with 15 pmol/well miR-19b-3p\u0026nbsp;mimic\u0026nbsp;or 15 pmol/well miR-19b-3p\u0026nbsp;inhibitor. At different time points (0 h, 24 h, 48 h, 72 h), 20 \u0026mu;L MTT solution (Yeason) was added into each well and then incubated at 37\u0026deg;C for 4 h. The medium was removed and 150 \u0026mu;L dimethyl sulfoxide (DMSO, Sigma-Aldrich, St. Louis, MO, USA) was added into each well. After 20 min incubation, the optical density at 490 nm (OD\u003csub\u003e490\u003c/sub\u003e) was measured using a SpectraMax Absorbance Reader (Molecular Devices, San Francisco, CA, USA).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEdU assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eKGN cells were seeded into 96-well plates at a density of 1 \u0026times; 10\u003csup\u003e4\u003c/sup\u003e cells per well and transfected with 15 pmol/well miR-19b-3p mimic or 15 pmol/well miR-19b-3p inhibitor. After a 48 h transfection, the EdU assay was performed using an Edu kFluor647-EdU Cell Proliferation Assay kit (KGA335, KeyGen Biotech) in accordance with the manufacturer\u0026apos;s instructions. EdU-positive cells (green nuclei) and EdU-negative cells (only blue nuclei) were observed and photographed under a microscope (200\u0026times;, BX53, Olympus, TKY, Japan). The number of EdU-positive cells were counted using Image J 1.8.0v (NIH, Bethesda, MD, USA) and the percentage of EdU-positive cells was calculated.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFlow cytometry analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eKGN cells were seeded into 6-well plates at a density of 1 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e cells per well and transfected with 200 pmol/well miR-19b-3p mimic or 200 pmol/well miR-19b-3p inhibitor. After a 48 h transfection, the cells were harvested for apoptosis and cell cycle assays. For cell apoptosis assay, the cells were stained with 200 \u0026micro;g/mL Annexin V-fluorescein isothiocyanate (Annexin V-FITC, Life Technologies) and 20 \u0026micro;g/mL propidium iodide (PI, CAT# C1052, Beyotime, Shanghai, China) in the dark for 10 min. For cell cycle analysis, cells were resuspended in PBS and then fixed in 70% ethanol for 4 h at 4 \u0026deg;C. The fixed cells were incubated with 0.5 mL PBS containing 10\u0026mu;g/mL RNase and 0.2% Triton X-100 for 30 min at 37\u0026deg;C, then stained with 20 \u0026mu;g/mL PI for 10 min in the dark. Finally, the stained cells were subjected to a flow cytometer NovoCyte 1300 (ACEA, San Diego, CA, USA).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWestern Blot\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe total protein was extracted from the cell lysates using RIPA buffer (Tian Gen, Beijing, China). The concentration of protein in the samples was determined using the BCA quantification method (CAT# 20201ES76, Yeason, Shanghai, China). Samples (20 \u0026mu;g protein per lane) were loaded on 10% sodium dodecyl sulfate\u0026ndash;polyacrylamide (SDS-PAGE) gels for electrophoresis and then transferred onto PVDF membranes (Millipore, MA, USA). The membranes were blocked with 5% bovine serum albumin (BSA, Sangon Biotech. Shanghai, China) at 28 ℃ for 1 h and probed with primary antibodies against IGF1 (1:1000, CAT# ab263907, Abcam, Shanghai, China), p-AKT (1:1000, CAT# 66444-1-Ig, Proteintech, Wuhan, Hubei, China), AKT(1:2000, CAT# 60203-2-Ig, Proteintech), BAX(1:1000, CAT# ab182733, Abcam), BCL-2(1:4000, CAT# 60178-1-Ig, Proteintech), or GAPDH (1:3000, CAT# 10494-1-AP, Proteintech) at 4 \u0026deg;C overnight. After wash with TBST buffer for five times, the membranes were incubated with horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG (H + L) (1:5000, CAT# SA00001‑2, Proteintech) or HRP- conjugated goat anti-mouse IgG (H + L) (1:2000, CAT# ab6728, Abcam) at 28 ℃ for 1 h and washed again with TBST. Band densities were measured using image analysis system (WD-9413B, Liuyi, Beijing, China) and analyzed using ImageJ software (National Institutes of Health, Bethesda, Maryland) .\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eStatistical analyses were performed using SPSS 18.0 (SPSS, Inc., Chicago, IL, USA). Differences between two groups were analyzed using Student\u0026apos;s \u003cem\u003et\u003c/em\u003e test (unpaired, two-tailed) or chi-square\u0026nbsp;\u003cem\u003ec\u003c/em\u003e\u003cem\u003e\u003csup\u003e2\u0026nbsp;\u003c/sup\u003e\u003c/em\u003etest.\u0026nbsp;A\u0026nbsp;\u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.05 was considered to be a statistically significant difference.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eThe percentage of mature oocytes in IVF is decreased in EM-associated infertility group and miR-19b-3p in CCs is increased in EM-associated infertility patients\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe age of patients, the number of oocytes retrieved and the number of mature oocytes in the EM-associated infertility group and the control group showed no statistical differences, but EM-associated infertility group had a significant lower percentage of mature oocytes (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). In order to determine the possible function of miR-19b-3p in the EM-associated infertility patients, we first examined the abundance of miR-19b-3p in CCs in the EM-associated infertility group and the control group by qRT-PCR, the result showed that miR-19b-3p abundance is increased in the EM group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eGeneral characteristics of patients in two groups\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCharacteristics\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eEM-associated infertility group\u003c/p\u003e \u003cp\u003e(n\u0026thinsp;=\u0026thinsp;18)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eControl group\u003c/p\u003e \u003cp\u003e(n\u0026thinsp;=\u0026thinsp;18)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003et / χ\u003c/em\u003e\u003csup\u003e\u003cem\u003e2\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAge(years)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e29.89\u0026plusmn;4.78\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e28.94\u0026plusmn;2.78\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.725\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.473\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eThe number of oocytes retrieved\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e12.11\u0026plusmn;6.37\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e11.67\u0026plusmn;4.55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.241\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.811\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eThe number of mature oocytes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e9.33\u0026plusmn;6.23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e11.33\u0026plusmn;4.59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1.097\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.281\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePercentage of mature oocytes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e77.06% (168/218)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e97.14% (204/210)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e37.919\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e༜0.01\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eMiR-19b-3p overexpression inhibits cell viability and proliferation, promotes apoptosis and arrests cell cycle at G0/G1 phase in KGN cells\u003c/b\u003e \u003c/p\u003e \u003cp\u003eIn order to investigate the impact of miR-19b-3p in CCs, we transfected miR-19b-3p mimic and inhibitor into human granulosa-like tumor cell line KGN, then MTT assay, EdU assay and apoptosis assay were performed. As indicated in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, overexpression of miR-19b-3p impaired the cell viability compared to cells transfected with a control miRNA(mimic NC), and miR-19b-3p inhibitor led to markedly increased cell viability. Figure\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC displayed that the number of EdU-positive cells was clearly decreased in cells transfected with miR-19b-3p mimic but increased in cells transfected with miR-19b-3p-inhibitor. Figure\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE showed that overexpression of miR-19b-3p increased the rate of apoptosis in KGN cells, and underexpression of miR-19b-3p exhibited an opposite result. In addition, the effects of abnormal expression of miR-19b-3p on the cell cycle distribution were investigated using flow cytometry. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG, the cells transfected with miR-19b-3p mimic exhibited a significantly increased percentage of G0/G1 phase cells. In contrast with that, the cells transfected with miR-19b-3p inhibitor exhibited a significantly decreased proportion of G0/G1 phase cells. Taken together, these results indicated that miR-19b-3p overexpression inhibited viability and proliferation, promoted apoptosis and arrested cell cycle at G0/G1 phase in KGN cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eMiR-19b-3p decreased IGF1 concentration by targeting its 3\u003c/b\u003e\u0026prime;\u003cb\u003eUTR in KGN cells\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo explore the underlying mechanism of miR-19b-3p in KGN cells, TargetScan bioinformatics tool was used to analyze potential direct targets of miR-19b-3p. Of all of the hypothetical targets which have multiple binding sites with miR-19b-3p, IGF1, an important growth-promoting polypeptide that plays an important role in cell proliferation was selected (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). To directly test the target relationship, we constructed the luciferase reporter vector by cloning the wild type (Wt) or mutant (Mut) of IGF1-3\u0026rsquo;UTR into pmirGLO vector, and then co-transfected with miR-19b-3p mimic or miR control (miR-NC). The results showed that the luciferase activity was significantly attenuated by co-transfection of miR-19b-3p with IGF1 3\u0026rsquo;UTR Wt in KGN cells, however, no significant difference was observed by co-transfection of miR-19b-3p with IGF1 3\u0026rsquo;UTR Mut (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). By qRT-PCR and western blot analysis, we found that both mRNA abundance (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC) and protein concentration (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD) of IGF1 were significantly reduced in KGN cells transfected with miR-19b-3p mimic, compared to those transfected with mimic NC. These results indicated that IGF1 was a direct target of miR-19b-3p and was negatively regulated by miR-19b-3p in KGN cells. We also examined the concentrations of IGF1 protein in the follicular fluid by using Elisa analysis and the mRNA abundance of IGF1 in CCs in EM-associated infertility patients. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE and Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF, IGF1 protein concentration was decreased in the follicular fluid in EM group, however, the mRNA abundance of IGF1 was increased in the CCs in EM group.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003eIGF1 is required for the biological effects of miR-19b-3p in KGN cells\u003c/h3\u003e\n\u003cp\u003eTo further verify the functional connection between miR-19b-3p and its target IGF1, KGN cells were transfected with miR-NC, miR-19b-3p, miR-19b-3p\u0026thinsp;+\u0026thinsp;pcDNA3.3-IGF1 (without 3\u0026prime;UTR) and miR-19b-3p\u0026thinsp;+\u0026thinsp;pcDNA3.3-IGF1 (with 3\u0026prime;UTR). When IGF1 was ectopically overexpressed, the inhibition of cell viability and proliferation (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA\u0026thinsp;~\u0026thinsp;C) and the promotion of cell apoptosis (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD\u0026amp;E) were partially reversed, which indicated that co-transfection of IGF1 partially rescued the impact resulted by miR-19b-3p. Besides, compared with cells transfected with miR-19b-3p\u0026thinsp;+\u0026thinsp;pcDNA3.3-IGF1 (without 3\u0026prime;UTR), cells transfected with miR-19b-3p\u0026thinsp;+\u0026thinsp;pcDNA3.3-IGF1 (with 3\u0026prime;UTR) exhibited decreased cell viability and proliferation (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA\u0026thinsp;~\u0026thinsp;C), increased cell apoptosis (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD\u0026amp;E) and increased G0/G1 phase cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF\u0026amp;G), which further confirmed that miR-19b-3p functions via interacting with IGF1-3\u0026prime;UTR. These results indicated that the effects of miR-19b-3p on KGN cells, including inhibits cell viability and proliferation, promotes apoptosis and arrests cell cycle at G0/G1, were mediated by IGF1.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eEffects of miR-19b-3p on the AKT phosphorylation and apoptotic regulatory genes BCL2 and BAX in KGN cells\u003c/b\u003e \u003c/p\u003e \u003cp\u003eWe next investigated whether miR-19b-3p activated AKT by suppressing IGF1 expression and the effect of miR-19b-3p on apoptotic regulatory genes BCL2 and BAX. Western blot analysis was performed to measure the concentration of related proteins. As Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e showed, the concentration of p-AKT/t-AKT decreased following transfection of the miR-19b-3p. And co-transfection of IGF1 significantly increased the concentration of p-AKT/t-AKT, besides, compared with KGN cells transfected with miR-19b-3p\u0026thinsp;+\u0026thinsp;pcDNA3.3-IGF1(without 3\u0026rsquo;UTR), p-AKT/t-AKT concentration was significantly lower in cells treated with miR-19b-3p\u0026thinsp;+\u0026thinsp;pcDNA3.3-IGF1(with 3\u0026rsquo;UTR). These findings suggested that IGF1 promotes AKT phosphorylation and miR-19b-3p targeted IGF1 to downregulate AKT phosphorylation in KGN cells. Similarly, the concentration of BAX increased and BCL2 decreased in cells transfected with miR-19b-3p. Co-transfection of IGF1 significantly downregulated BAX and upregulated BCL2 expression, and compared with KGN cells transfected with miR-19b-3p\u0026thinsp;+\u0026thinsp;pcDNA3.3-IGF1 (without 3\u0026rsquo;UTR), BAX concentration was significantly higher and BCL2 concentration was significantly lower in cells treated with miR-19b-3p\u0026thinsp;+\u0026thinsp;pcDNA3.3-IGF1 (with 3\u0026rsquo;UTR). These findings suggested that miR-19b-3p might participate in apoptotic pathway by targeting IGF1 in KGN cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study, we first demonstrated a possible relationship between miR-19b-3p and CCs in EM-associated infertility, and focused on the functional role of miR-19b-3p in KGN cells and its underlying mechanism. Our results showed that the expression level of miR-19b-3p was significantly increased in CCs in EM-associated infertility patients. Overexpression of miR-19b-3p significantly inhibited cell viability and proliferation, promoted apoptosis, and arrested cell cycle at G0/G1 phase in KGN cells. Conversely, inhibition of miR-19b-3p expression exhibited the opposite results. Additionally, it was identified that IGF1 was a direct target of miR-19b-3p in KGN cells and was negatively regulated by miR-19b-3p. Co-transfection of IGF1 rescued the impact resulted by miR-19b-3p, and the biological effects of miR-19b-3p in KGN cells were mediated by IGF1.\u003c/p\u003e \u003cp\u003eMiR-19b belongs to the miR17 family, which plays a critical role during early mammalian development and regulates stem cell differentiation(\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e). It has been demonstrated that miR-19b is involved in the regulation of various biological process, including cellular proliferation, differentiation, migration, invasion and apoptosis. It was reported that higher expression of miR-19b-3p were associated with oligoasthenozoospermia and male infertility(\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e). MiR-19b-3p was differentially expressed in the spent culture media after embryo transfer and showed an AUC value for predicting positive pregnancy outcomes, both, from spent culture media and sperm collected from infertile couples attending infertility treatment(\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e). In was also shown that miR-19b-3p was differentially expressed in ovarian hyperresponders and normal responders(\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e). Heat shock during in vitro maturation of bovine oocytes disturbs bta-miR-19b abundance after in vitro fertilization(\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e). These findings lead us to hypothesize that the miR-19b could play an essential role in reproduction, however, there was limited information about the role in EM-associated infertility. This was the first time to confirm that miR-19b-3p was involved in EM-associated infertility. In the current study, we demonstrated that the abundance level of miR-19b-3p was increased in the CCs of EM-associated infertility patients, suggesting a potential role for miR-19b-3p in the pathogenesis of EM-associated infertility. Subsequently, overexpression and underexpression of miR-19b-3p was conducted in KGN cells, and the viability, proliferation and apoptosis ability were evaluated. These results demonstrated that miR-19b-3p inhibited viability and proliferation and promoted apoptosis in KGN cells and the mechanism for proliferation inhibition was probably due to that miR-19b-3p overexpression arrested cell cycle at G0/G1 phase. Interestingly, ZHONG ZH et al(\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e) determined that miR-19b is decreased in PCOS GCs and miR-19b could be a GCs proliferation inhibitor, however, the mechanism regarding cell proliferation was that miR-19b overexpression arrested cell cycle at G2/M phase. The reason for the differences is unknown, and further research is needed to reveal it.\u003c/p\u003e \u003cp\u003eIt has been reported that IGF1 was a direct target of miR-19b in PCOS GCs(\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e). In consistent with that, our research further demonstrated that IGF1 was a direct target of miR-19b-3p in KGN cells. IGF1 is a critical growth-promoting polypeptide, which has been shown to serve as an intra-ovarian regulator of follicle function and exerts direct effects on human GCs function(\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e). IGF1 acts on GCs in an autocrine fashion and in conjunction with gonadotropins, appears to have role in promoting follicle growth, steroid secretion and as an anti-atretic hormone(\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e). There was an indication that the bioavailability of IGF1 was reduced during the oocyte maturation process in the sense that the concentration of free IGF1 in the follicular fluid was lower in the oocyte-mature group than in the oocyte-immature group. A study of mares follicles showed that lower free IGF1 concentrations were associated with maturation of oocyte but not with maturation of the follicle, which suggested a possible function of IGF1 on oocyte maturation(\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e). Kucera R et al. (\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e), who investigated follicular fluid level of IGF1 in women with fertility disorders, demonstrated that IGF1 was significantly lower in the entire group with fertility disorders, but no significant difference was found in fertility disorders caused by EM. However, in our study, we found that IGF1 protein concentration in the follicular fluid and the percentage of mature oocytes were both significantly decreased in EM-associated infertility patients. Whether there is a relation between IGF1 concentration in the follicular fluid and oocyte maturation remains to be seen. In addition, the mRNA abundance of IGF1 was increased in the CCs in EM-associated infertility patients. There is no forceful evidence to explain the discrepancy between IGF1 protein concentration in follicular fluid and IGF1 mRNA abundance in CCs and further research is needed to reveal it. We speculated it might be due to the complicated regulation in vivo. There is no trivial relationship between the concentration of a transcript and the concentration of the protein derived from a particular locus. Systematic studies quantifying transcripts and proteins at genomic scales revealed that multiple processes beyond transcript concentration that contribute to establishing the expression level of a protein, including translation rates, translation rate modulation, modulation of a protein\u0026rsquo;s half-life, protein synthesis delay and protein transport(\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eFurthermore, our study found that co-transfection of IGF1 and miR-19b-3p in KGN cells rescued the proliferation inhibition and apoptosis promotion effects resulted by miR-19b-3p, whereas co-transfection of IGF1-3\u0026rsquo;UTR and miR-19b-3p in KGN cells decreased the rescue effects. These results further confirmed that IGF1 could promote proliferation and inhibit apoptosis in KGN cells and the functions of it were mediated by IGF1.\u003c/p\u003e \u003cp\u003eIncreasing evidence suggests that phosphatidylinositol-3-kinase/protein kinase B (PI3K-AKT) signaling regulates ovarian function, including the recruitment of primordial follicles, GCs proliferation, survival of the corpus luteum and oocyte maturation(\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e). Our study further showed that miR-19b-3p overexpression regulated IGF1 to decrease p-AKT level in KGN cells. The investigation of the mechanisms of apoptosis may help elucidate the pathologies of uncontrolled cell grow or death. BCL-2 family of proteins participates in controlling and regulating the intrinsic apoptosis pathway. Our study demonstrated that miR-19b-3p overexpression significantly decreased BCL-2 concentration and increased BAX concentration, which suggested that miR-19b-3p might participate in regulating cell apoptosis in KGN cells.\u003c/p\u003e \u003cp\u003eThere are some limitations and weaknesses in this study. Firstly, the stimulation methods and the hormonal treatment used in IVF are different in the two groups. Secondly, due to the difficulty in obtaining primary human CCs or GCs in sizable amounts and surviving many generations in culture, KGN cells rather than primary human GCs were used for functional and mechanistic studies.\u003c/p\u003e \u003cp\u003eIn conclusion, we found that the abundance of miR-19b-3p in CCs was significantly increased and IGF1 concentration in the follicular fluid was significantly decreased in EM-associated infertility patients. Overexpression of miR-19b-3p inhibited viability and proliferation, promoted apoptosis and arrested cell cycle at G0/G1 phase by directly targeting IGF1 in KGN cells. In addition, overexpression of miR-19b-3p activated PI3K-AKT pathway and regulated the expression of apoptotic related genes BCL2 and BAX. These results provide new evidence for elucidating the mechanism of EM-associated infertility.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.887323943661972%\"\u003e\n \u003cp\u003eEM \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"77.11267605633803%\"\u003e\n \u003cp\u003eEndometriosis\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.887323943661972%\"\u003e\n \u003cp\u003eGCs \u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"77.11267605633803%\"\u003e\n \u003cp\u003eGranulosa cells\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.887323943661972%\"\u003e\n \u003cp\u003eCCs \u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"77.11267605633803%\"\u003e\n \u003cp\u003eCumulus cells\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.887323943661972%\"\u003e\n \u003cp\u003emiR-19b-3p\u0026nbsp; \u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"77.11267605633803%\"\u003e\n \u003cp\u003eMicroRNA-19b-3p\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.887323943661972%\"\u003e\n \u003cp\u003e3\u0026prime;UTR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"77.11267605633803%\"\u003e\n \u003cp\u003e3\u0026prime;-untranslated region\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.887323943661972%\"\u003e\n \u003cp\u003emRNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"77.11267605633803%\"\u003e\n \u003cp\u003eMessage RNA\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.887323943661972%\"\u003e\n \u003cp\u003eIGF1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"77.11267605633803%\"\u003e\n \u003cp\u003eInsulin-like growth factor 1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.887323943661972%\"\u003e\n \u003cp\u003eIVF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"77.11267605633803%\"\u003e\n \u003cp\u003eIn vitro fertilization\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.887323943661972%\"\u003e\n \u003cp\u003ePCOS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"77.11267605633803%\"\u003e\n \u003cp\u003ePolycystic ovary syndrome\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.887323943661972%\"\u003e\n \u003cp\u003eGnRH-a\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"77.11267605633803%\"\u003e\n \u003cp\u003eGonadotrophin releasing hormone agonist\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.887323943661972%\"\u003e\n \u003cp\u003eOCCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"77.11267605633803%\"\u003e\n \u003cp\u003eOocyte-corona-cumulus complex\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.887323943661972%\"\u003e\n \u003cp\u003eNC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"77.11267605633803%\"\u003e\n \u003cp\u003eNegative control\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.887323943661972%\"\u003e\n \u003cp\u003eqRT-PCR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"77.11267605633803%\"\u003e\n \u003cp\u003eQuantitative real-time RT\u0026ndash;PCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.887323943661972%\"\u003e\n \u003cp\u003eMTT Assay\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"77.11267605633803%\"\u003e\n \u003cp\u003e3-(4,5-Dimethylthiazol-2-yl)-2,5-di-Phenyltetrazolium Bromide Assay\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.887323943661972%\"\u003e\n \u003cp\u003eMut\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"77.11267605633803%\"\u003e\n \u003cp\u003eMutant\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.887323943661972%\"\u003e\n \u003cp\u003eWt\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"77.11267605633803%\"\u003e\n \u003cp\u003eWide type\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eYouzhu Li conceived the study and analyzed data. Yuanyuan Ye drafted the manuscript. Hengyuan Zhang, Ye Yang and Ningqing Zhang performed experiments. Hong Gao made suggestions for data collection and revised the drafts. Rongfeng Wu supervised the study and had substantial inputs into the analysis.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Natural Science Foundation of Fujian Province of China (Grant No. 2019J01565), the National Natural Science Foundation of China (No. 82171638) and Xiamen City Medical and Health Guidance Project (No. 3502Z20214ZD1008).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated or analyzed using this study was included in this published article.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors thank all the participants for their support and cooperation.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eZondervan KT, Becker CM, Koga K, Missmer SA, Taylor RN, Vigano P. Endometriosis. Nat Rev Dis Primers. 2018;4(1):9.\u003c/li\u003e\n\u003cli\u003eMacer ML, Taylor HS. Endometriosis and infertility: a review of the pathogenesis and treatment of endometriosis-associated infertility. Obstet Gynecol Clin North Am. 2012;39(4):535-49.\u003c/li\u003e\n\u003cli\u003eEisenberg VH, Weil C, Chodick G, Shalev V. Epidemiology of endometriosis: a large population-based database study from a healthcare provider with 2 million members. Bjog. 2018;125(1):55-62.\u003c/li\u003e\n\u003cli\u003eFilip L, Duică F, Prădatu A, Crețoiu D, Suciu N, Crețoiu SM, et al. Endometriosis Associated Infertility: A Critical Review and Analysis on Etiopathogenesis and Therapeutic Approaches. Medicina (Kaunas). 2020;56(9).\u003c/li\u003e\n\u003cli\u003eAlbertini DF, Combelles CM, Benecchi E, Carabatsos MJ. Cellular basis for paracrine regulation of ovarian follicle development. Reproduction. 2001;121(5):647-53.\u003c/li\u003e\n\u003cli\u003eDa Broi MG, de Albuquerque FO, de Andrade AZ, Cardoso RL, Jord\u0026atilde;o Junior AA, Navarro PA. Increased concentration of 8-hydroxy-2\u0026apos;-deoxyguanosine in follicular fluid of infertile women with endometriosis. Cell Tissue Res. 2016;366(1):231-42.\u003c/li\u003e\n\u003cli\u003eDa Broi MG, Jord\u0026atilde;o AA, Jr., Ferriani RA, Navarro PA. Oocyte oxidative DNA damage may be involved in minimal/mild endometriosis-related infertility. Mol Reprod Dev. 2018;85(2):128-36.\u003c/li\u003e\n\u003cli\u003eGarrido N, Navarro J, Remoh\u0026iacute; J, Sim\u0026oacute;n C, Pellicer A. Follicular hormonal environment and embryo quality in women with endometriosis. Hum Reprod Update. 2000;6(1):67-74.\u003c/li\u003e\n\u003cli\u003eCunha-Filho JS, Lemos NA, Freitas FM, Kiefer K, Faller M, Passos EP. Insulin-like growth factor (IGF)-1 and IGF binding protein-1 and -3 in the follicular fluid of infertile patients with endometriosis. Hum Reprod. 2003;18(2):423-8.\u003c/li\u003e\n\u003cli\u003eSaito H, Seino T, Kaneko T, Nakahara K, Toya M, Kurachi H. Endometriosis and oocyte quality. Gynecol Obstet Invest. 2002;53 Suppl 1:46-51.\u003c/li\u003e\n\u003cli\u003eLi Y, Li R, Ouyang N, Dai K, Yuan P, Zheng L, et al. Investigating the impact of local inflammation on granulosa cells and follicular development in women with ovarian endometriosis. Fertil Steril. 2019;112(5):882-91.e1.\u003c/li\u003e\n\u003cli\u003eNishi Y, Yanase T, Mu Y, Oba K, Ichino I, Saito M, et al. Establishment and characterization of a steroidogenic human granulosa-like tumor cell line, KGN, that expresses functional follicle-stimulating hormone receptor. Endocrinology. 2001;142(1):437-45.\u003c/li\u003e\n\u003cli\u003eLi Y, Liu YD, Chen SL, Chen X, Ye DS, Zhou XY, et al. Down-regulation of long non-coding RNA MALAT1 inhibits granulosa cell proliferation in endometriosis by up-regulating P21 via activation of the ERK/MAPK pathway. Mol Hum Reprod. 2019;25(1):17-29.\u003c/li\u003e\n\u003cli\u003eLi M, Zhao H, Zhao SG, Wei DM, Zhao YR, Huang T, et al. The HMGA2-IMP2 Pathway Promotes Granulosa Cell Proliferation in Polycystic Ovary Syndrome. J Clin Endocrinol Metab. 2019;104(4):1049-59.\u003c/li\u003e\n\u003cli\u003eCao J, Huo P, Cui K, Wei H, Cao J, Wang J, et al. Follicular fluid-derived exosomal miR-143-3p/miR-155-5p regulate follicular dysplasia by modulating glycolysis in granulosa cells in polycystic ovary syndrome. Cell Commun Signal. 2022;20(1):61.\u003c/li\u003e\n\u003cli\u003eYates LA, Norbury CJ, Gilbert RJ. The long and short of microRNA. Cell. 2013;153(3):516-9.\u003c/li\u003e\n\u003cli\u003eZhang J, Xu Y, Liu H, Pan Z. MicroRNAs in ovarian follicular atresia and granulosa cell apoptosis. Reprod Biol Endocrinol. 2019;17(1):9.\u003c/li\u003e\n\u003cli\u003eGhafouri-Fard S, Shoorei H, Taheri M. Role of Non-coding RNAs in the Pathogenesis of Endometriosis. Front Oncol. 2020;10:1370.\u003c/li\u003e\n\u003cli\u003eYao W, Pan Z, Du X, Zhang J, Li Q. miR-181b-induced SMAD7 downregulation controls granulosa cell apoptosis through TGF-\u0026beta; signaling by interacting with the TGFBR1 promoter. J Cell Physiol. 2018;233(9):6807-21.\u003c/li\u003e\n\u003cli\u003eMa L, Zheng Y, Tang X, Gao H, Liu N, Gao Y, et al. miR-21-3p inhibits autophagy of bovine granulosa cells by targeting VEGFA via PI3K/AKT signaling. Reproduction. 2019;158(5):441-52.\u003c/li\u003e\n\u003cli\u003eShao S, Wang H, Shao W, Liu N. miR-199a-5p stimulates ovarian granulosa cell apoptosis in polycystic ovary syndrome. J Mol Endocrinol. 2020;65(4):187-201.\u003c/li\u003e\n\u003cli\u003eDaguia Zambe JC, Zhai Y, Zhou Z, Du X, Wei Y, Ma F, et al. miR-19b-3p induces cell proliferation and reduces heterochromatin-mediated senescence through PLZF in goat male germline stem cells. J Cell Physiol. 2018;233(6):4652-65.\u003c/li\u003e\n\u003cli\u003eZhong Z, Li F, Li Y, Qin S, Wen C, Fu Y, et al. Inhibition of microRNA-19b promotes ovarian granulosa cell proliferation by targeting IGF-1 in polycystic ovary syndrome. Mol Med Rep. 2018;17(4):4889-98.\u003c/li\u003e\n\u003cli\u003eMazerbourg S, Bondy CA, Zhou J, Monget P. The insulin-like growth factor system: a key determinant role in the growth and selection of ovarian follicles? a comparative species study. Reprod Domest Anim. 2003;38(4):247-58.\u003c/li\u003e\n\u003cli\u003eGurgan T, Bukulmez O, Yarali H, Tanir M, Akyildiz S. Serum and peritoneal fluid levels of IGF I and II and insulinlike growth binding protein-3 in endometriosis. J Reprod Med. 1999;44(5):450-4.\u003c/li\u003e\n\u003cli\u003eKim JG, Suh CS, Kim SH, Choi YM, Moon SY, Lee JY. Insulin-like growth factors (IGFs), IGF-binding proteins (IGFBPs), and IGFBP-3 protease activity in the peritoneal fluid of patients with and without endometriosis. Fertil Steril. 2000;73(5):996-1000.\u003c/li\u003e\n\u003cli\u003eMatalliotakis IM, Goumenou AG, Koumantakis GE, Neonaki MA, Koumantakis EE, Dionyssopoulou E, et al. Serum concentrations of growth factors in women with and without endometriosis: the action of anti-endometriosis medicines. Int Immunopharmacol. 2003;3(1):81-9.\u003c/li\u003e\n\u003cli\u003eKucera R, Babuska V, Ulcova-Gallova Z, Kulda V, Topolcan O. Follicular fluid levels of anti-M\u0026uuml;llerian hormone, insulin-like growth factor 1 and leptin in women with fertility disorders. Syst Biol Reprod Med. 2018;64(3):220-3.\u003c/li\u003e\n\u003cli\u003eFoshay KM, Gallicano GI. miR-17 family miRNAs are expressed during early mammalian development and regulate stem cell differentiation. Dev Biol. 2009;326(2):431-43.\u003c/li\u003e\n\u003cli\u003eAbu-Halima M, Becker LS, Ayesh BM, Meese E. MicroRNA-targeting in male infertility: Sperm microRNA-19a/b-3p and its spermatogenesis related transcripts content in men with oligoasthenozoospermia. Front Cell Dev Biol. 2022;10:973849.\u003c/li\u003e\n\u003cli\u003eAbu-Halima M, Galata V, Backes C, Keller A, Hammadeh M, Meese E. MicroRNA signature in spermatozoa and seminal plasma of proven fertile men and in testicular tissue of men with obstructive azoospermia. Andrologia. 2020;52(2):e13503.\u003c/li\u003e\n\u003cli\u003eXie S, Batnasan E, Zhang Q, Li Y. MicroRNA Expression is Altered in Granulosa Cells of Ovarian Hyperresponders. Reprod Sci. 2016;23(8):1001-10.\u003c/li\u003e\n\u003cli\u003eSouza V, Souza GT, Lemos DR, Guimar\u0026atilde;es JMO, Quint\u0026atilde;o CCR, Munk M, et al. Heat shock during in vitro maturation of bovine oocytes disturbs bta-miR-19b and DROSHA transcripts abundance after in vitro fertilization. Reprod Domest Anim. 2021;56(8):1128-36.\u003c/li\u003e\n\u003cli\u003eAdashi EY, Resnick CE, D\u0026apos;Ercole AJ, Svoboda ME, Van Wyk JJ. Insulin-like growth factors as intraovarian regulators of granulosa cell growth and function. Endocr Rev. 1985;6(3):400-20.\u003c/li\u003e\n\u003cli\u003eDruckmann R, Rohr UD. IGF-1 in gynaecology and obstetrics: update 2002. Maturitas. 2002;41 Suppl 1:S65-83.\u003c/li\u003e\n\u003cli\u003eGinther OJ, Gastal EL, Gastal MO, Siddiqui MA, Beg MA. Relationships of follicle versus oocyte maturity to ultrasound morphology, blood flow, and hormone concentrations of the preovulatory follicle in mares. Biol Reprod. 2007;77(2):202-8.\u003c/li\u003e\n\u003cli\u003eLiu Y, Beyer A, Aebersold R. On the Dependency of Cellular Protein Levels on mRNA Abundance. Cell. 2016;165(3):535-50.\u003c/li\u003e\n\u003cli\u003eMakker A, Goel MM, Mahdi AA. PI3K/PTEN/Akt and TSC/mTOR signaling pathways, ovarian dysfunction, and infertility: an update. J Mol Endocrinol. 2014;53(3):R103-18.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Endometriosis, infertility, miR-19b-3p, Insulin-like growth factor 1","lastPublishedDoi":"10.21203/rs.3.rs-2892549/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-2892549/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground:\u003c/strong\u003e Endometriosis(EM) is a major cause of infertility, but the pathogenesis and mechanisms have not been fully elucidated. MiR-19b-3p is involved in many diseases, but its functional role in EM-associated infertility has not been investigated. In this study, we aimed to examine miR-19b-3p abundance and IGF1 concentration in cumulus cells (CCs) and follicular fluid in EM-associated infertility patients and to reveal the potential role of miR-19b-3p in KGN cells by identifying its target and elucidating the underlying mechanisms.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults: \u003c/strong\u003eThe results showed that compared to the control group (patients with tubal infertility), EM-associated infertility patients had a lower percentage of mature oocytes. Abundance of miR-19b-3p was increased in CCs in EM-associated infertility patients. IGF1 was a direct target of miR-19b-3p and was negatively regulated by miR-19b-3p in KGN cells. Overexpression of miR-19b-3p significantly inhibited viability and proliferation, promoted apoptosis, and arrested cell cycle at G0/G1 phase in KGN cells. The effects of miR-19b-3p could be reversed by co-transfection of IGF1 and the biological effects of miR-19b-3p in KGN cells were mediated by IGF1. In addition, miR-19b-3p targeted IGF1 to downregulate AKT phosphorylation and to participate in apoptotic pathway in KGN cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusions:\u003c/strong\u003e This study demonstrates that miR-19b-3p abundance is increased in CCs and IGF1 concentration is decreased in follicular fluid in EM-associated infertility patients, and miR-19b-3p participates in the regulation of biological effects of KGN cells by targeting IGF1.\u003c/p\u003e","manuscriptTitle":"MiR-19b-3p inhibits cell viability and proliferation and promotes apoptosis by targeting IGF1 in KGN cells","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-05-08 22:13:22","doi":"10.21203/rs.3.rs-2892549/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"66b8df54-173d-45c8-8c92-5f1a5803c34e","owner":[],"postedDate":"May 8th, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2023-05-14T03:44:13+00:00","versionOfRecord":[],"versionCreatedAt":"2023-05-08 22:13:22","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-2892549","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-2892549","identity":"rs-2892549","version":["v1"]},"buildId":"B-jG_2CBjPDmsCi4Wdhf-","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Condition tags

endometriosisinfertility

Citation neighborhood

Papers in the corpus that this work cites (lower rings, blue) and that cite this one (upper rings, green). Dot size scales with the paper's in-corpus citation count — bigger dot = more influential within the endo/adeno field. Click a dot to open that paper. [ expand to 2 hops ] — adds papers reached through this work's immediate citers/citees. Heavier; up to 60 extra dots.

References (38)

Source provenance

europepmc
last seen: 2026-09-12T07:19:29.859086+00:00
openalex
last seen: 2026-06-10T17:14:06.276822+00:00
License: CC0 · commercial use OK