A high dose of total recombinant FSH suppresses granulosa cell apoptosis and maintains oocyte quality in endometriosis: A cross-sectional study

A high dose of total recombinant FSH suppresses... | F1000Research "use strict";function _typeof(t){return(_typeof="function"==typeof Symbol&&"symbol"==typeof Symbol.iterator?function(t){return typeof t}:function(t){return t&&"function"==typeof Symbol&&t.constructor===Symbol&&t!==Symbol.prototype?"symbol":typeof t})(t)}!function(){var t=function(){var t,e,o=[],n=window,r=n;for(;r;){try{if(r.frames.__tcfapiLocator){t=r;break}}catch(t){}if(r===n.top)break;r=r.parent}t||(!function t(){var e=n.document,o=!!n.frames.__tcfapiLocator;if(!o)if(e.body){var r=e.createElement("iframe");r.style.cssText="display:none",r.name="__tcfapiLocator",e.body.appendChild(r)}else setTimeout(t,5);return!o}(),n.__tcfapi=function(){for(var t=arguments.length,n=new Array(t),r=0;r 3&&2===parseInt(n[1],10)&&"boolean"==typeof n[3]&&(e=n[3],"function"==typeof n[2]&&n[2]("set",!0)):"ping"===n[0]?"function"==typeof n[2]&&n[2]({gdprApplies:e,cmpLoaded:!1,cmpStatus:"stub"}):o.push(n)},n.addEventListener("message",(function(t){var e="string"==typeof t.data,o={};if(e)try{o=JSON.parse(t.data)}catch(t){}else o=t.data;var n="object"===_typeof(o)&&null!==o?o.__tcfapiCall:null;n&&window.__tcfapi(n.command,n.version,(function(o,r){var a={__tcfapiReturn:{returnValue:o,success:r,callId:n.callId}};t&&t.source&&t.source.postMessage&&t.source.postMessage(e?JSON.stringify(a):a,"*")}),n.parameter)}),!1))};"undefined"!=typeof module?module.exports=t:t()}(); dataLayer = dataLayer || []; // Standard GTM initialization - Google Consent Mode handles consent automatically (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start': new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0], j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src= 'https://www.googletagmanager.com/gtm.js?id='+i+dl+ '>m_auth=hzk0Vc3qFsQYhCrIoHz68A>m_preview=env-1>m_cookies_win=x';f.parentNode.insertBefore(j,f); })(window,document,'script','dataLayer','GTM-MWFK8L5J'); ;window.NREUM||(NREUM={});NREUM.init={distributed_tracing:{enabled:true},privacy:{cookies_enabled:true},ajax:{deny_list:["bam.nr-data.net"]}}; ;NREUM.loader_config={accountID:"438030",trustKey:"438030",agentID:"772317073",licenseKey:"97f8f67f26",applicationID:"772317073"} ;NREUM.info={beacon:"bam.nr-data.net",errorBeacon:"bam.nr-data.net",licenseKey:"97f8f67f26",applicationID:"772317073",sa:1} ;/*! For license information please see nr-loader-spa-1.236.0.min.js.LICENSE.txt */ (()=>{"use strict";var e,t,r={5763:(e,t,r)=>{r.d(t,{P_:()=>l,Mt:()=>g,C5:()=>s,DL:()=>v,OP:()=>T,lF:()=>D,Yu:()=>y,Dg:()=>h,CX:()=>c,GE:()=>b,sU:()=>_});var n=r(8632),i=r(9567);const o={beacon:n.ce.beacon,errorBeacon:n.ce.errorBeacon,licenseKey:void 0,applicationID:void 0,sa:void 0,queueTime:void 0,applicationTime:void 0,ttGuid:void 0,user:void 0,account:void 0,product:void 0,extra:void 0,jsAttributes:{},userAttributes:void 0,atts:void 0,transactionName:void 0,tNamePlain:void 0},a={};function s(e){if(!e)throw new Error("All info objects require an agent identifier!");if(!a[e])throw new Error("Info for ".concat(e," was never set"));return a[e]}function c(e,t){if(!e)throw new Error("All info objects require an agent identifier!");a[e]=(0,i.D)(t,o),(0,n.Qy)(e,a[e],"info")}var u=r(7056);const d=()=>{const e={blockSelector:"[data-nr-block]",maskInputOptions:{password:!0}};return{allow_bfcache:!0,privacy:{cookies_enabled:!0},ajax:{deny_list:void 0,enabled:!0,harvestTimeSeconds:10},distributed_tracing:{enabled:void 0,exclude_newrelic_header:void 0,cors_use_newrelic_header:void 0,cors_use_tracecontext_headers:void 0,allowed_origins:void 0},session:{domain:void 0,expiresMs:u.oD,inactiveMs:u.Hb},ssl:void 0,obfuscate:void 0,jserrors:{enabled:!0,harvestTimeSeconds:10},metrics:{enabled:!0},page_action:{enabled:!0,harvestTimeSeconds:30},page_view_event:{enabled:!0},page_view_timing:{enabled:!0,harvestTimeSeconds:30,long_task:!1},session_trace:{enabled:!0,harvestTimeSeconds:10},harvest:{tooManyRequestsDelay:60},session_replay:{enabled:!1,harvestTimeSeconds:60,sampleRate:.1,errorSampleRate:.1,maskTextSelector:"*",maskAllInputs:!0,get blockClass(){return"nr-block"},get ignoreClass(){return"nr-ignore"},get maskTextClass(){return"nr-mask"},get blockSelector(){return e.blockSelector},set blockSelector(t){e.blockSelector+=",".concat(t)},get maskInputOptions(){return e.maskInputOptions},set maskInputOptions(t){e.maskInputOptions={...t,password:!0}}},spa:{enabled:!0,harvestTimeSeconds:10}}},f={};function l(e){if(!e)throw new Error("All configuration objects require an agent identifier!");if(!f[e])throw new Error("Configuration for ".concat(e," was never set"));return f[e]}function h(e,t){if(!e)throw new Error("All configuration objects require an agent identifier!");f[e]=(0,i.D)(t,d()),(0,n.Qy)(e,f[e],"config")}function g(e,t){if(!e)throw new Error("All configuration objects require an agent identifier!");var r=l(e);if(r){for(var n=t.split("."),i=0;i {r.d(t,{D:()=>i});var n=r(50);function i(e,t){try{if(!e||"object"!=typeof e)return(0,n.Z)("Setting a Configurable requires an object as input");if(!t||"object"!=typeof t)return(0,n.Z)("Setting a Configurable requires a model to set its initial properties");const r=Object.create(Object.getPrototypeOf(t),Object.getOwnPropertyDescriptors(t)),o=0===Object.keys(r).length?e:r;for(let a in o)if(void 0!==e[a])try{"object"==typeof e[a]&&"object"==typeof t[a]?r[a]=i(e[a],t[a]):r[a]=e[a]}catch(e){(0,n.Z)("An error occurred while setting a property of a Configurable",e)}return r}catch(e){(0,n.Z)("An error occured while setting a Configurable",e)}}},6818:(e,t,r)=>{r.d(t,{Re:()=>i,gF:()=>o,q4:()=>n});const n="1.236.0",i="PROD",o="CDN"},385:(e,t,r)=>{r.d(t,{FN:()=>a,IF:()=>u,Nk:()=>f,Tt:()=>s,_A:()=>o,il:()=>n,pL:()=>c,v6:()=>i,w1:()=>d});const n="undefined"!=typeof window&&!!window.document,i="undefined"!=typeof WorkerGlobalScope&&("undefined"!=typeof self&&self instanceof WorkerGlobalScope&&self.navigator instanceof WorkerNavigator||"undefined"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis.navigator instanceof WorkerNavigator),o=n?window:"undefined"!=typeof WorkerGlobalScope&&("undefined"!=typeof self&&self instanceof WorkerGlobalScope&&self||"undefined"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis),a=""+o?.location,s=/iPad|iPhone|iPod/.test(navigator.userAgent),c=s&&"undefined"==typeof SharedWorker,u=(()=>{const e=navigator.userAgent.match(/Firefox[/\s](\d+\.\d+)/);return Array.isArray(e)&&e.length>=2?+e[1]:0})(),d=Boolean(n&&window.document.documentMode),f=!!navigator.sendBeacon},1117:(e,t,r)=>{r.d(t,{w:()=>o});var n=r(50);const i={agentIdentifier:"",ee:void 0};class o{constructor(e){try{if("object"!=typeof e)return(0,n.Z)("shared context requires an object as input");this.sharedContext={},Object.assign(this.sharedContext,i),Object.entries(e).forEach((e=>{let[t,r]=e;Object.keys(i).includes(t)&&(this.sharedContext[t]=r)}))}catch(e){(0,n.Z)("An error occured while setting SharedContext",e)}}}},8e3:(e,t,r)=>{r.d(t,{L:()=>d,R:()=>c});var n=r(2177),i=r(1284),o=r(4322),a=r(3325);const s={};function c(e,t){const r={staged:!1,priority:a.p[t]||0};u(e),s[e].get(t)||s[e].set(t,r)}function u(e){e&&(s[e]||(s[e]=new Map))}function d(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:"",t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:"feature";if(u(e),!e||!s[e].get(t))return a(t);s[e].get(t).staged=!0;const r=[...s[e]];function a(t){const r=e?n.ee.get(e):n.ee,a=o.X.handlers;if(r.backlog&&a){var s=r.backlog[t],c=a[t];if(c){for(var u=0;s&&u {let[t,r]=e;return r.staged}))&&(r.sort(((e,t)=>e[1].priority-t[1].priority)),r.forEach((e=>{let[t]=e;a(t)})))}function f(e,t){var r=e[1];(0,i.D)(t[r],(function(t,r){var n=e[0];if(r[0]===n){var i=r[1],o=e[3],a=e[2];i.apply(o,a)}}))}},2177:(e,t,r)=>{r.d(t,{c:()=>f,ee:()=>u});var n=r(8632),i=r(2210),o=r(1284),a=r(5763),s="nr@context";let c=(0,n.fP)();var u;function d(){}function f(e){return(0,i.X)(e,s,l)}function l(){return new d}function h(){u.aborted=!0,u.backlog={}}c.ee?u=c.ee:(u=function e(t,r){var n={},c={},f={},g=!1;try{g=16===r.length&&(0,a.OP)(r).isolatedBacklog}catch(e){}var p={on:b,addEventListener:b,removeEventListener:y,emit:v,get:x,listeners:w,context:m,buffer:A,abort:h,aborted:!1,isBuffering:E,debugId:r,backlog:g?{}:t&&"object"==typeof t.backlog?t.backlog:{}};return p;function m(e){return e&&e instanceof d?e:e?(0,i.X)(e,s,l):l()}function v(e,r,n,i,o){if(!1!==o&&(o=!0),!u.aborted||i){t&&o&&t.emit(e,r,n);for(var a=m(n),s=w(e),d=s.length,f=0;fn,p:()=>i});var n=r(2177).ee.get("handle");function i(e,t,r,i,o){o?(o.buffer([e],i),o.emit(e,t,r)):(n.buffer([e],i),n.emit(e,t,r))}},4322:(e,t,r)=>{r.d(t,{X:()=>o});var n=r(5546);o.on=a;var i=o.handlers={};function o(e,t,r,o){a(o||n.E,i,e,t,r)}function a(e,t,r,i,o){o||(o="feature"),e||(e=n.E);var a=t[o]=t[o]||{};(a[r]=a[r]||[]).push([e,i])}},3239:(e,t,r)=>{r.d(t,{bP:()=>s,iz:()=>c,m$:()=>a});var n=r(385);let i=!1,o=!1;try{const e={get passive(){return i=!0,!1},get signal(){return o=!0,!1}};n._A.addEventListener("test",null,e),n._A.removeEventListener("test",null,e)}catch(e){}function a(e,t){return i||o?{capture:!!e,passive:i,signal:t}:!!e}function s(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;window.addEventListener(e,t,a(r,n))}function c(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;document.addEventListener(e,t,a(r,n))}},4402:(e,t,r)=>{r.d(t,{Ht:()=>u,M:()=>c,Rl:()=>a,ky:()=>s});var n=r(385);const i="xxxxxxxx-xxxx-4xxx-yxxx-xxxxxxxxxxxx";function o(e,t){return e?15&e[t]:16*Math.random()|0}function a(){const e=n._A?.crypto||n._A?.msCrypto;let t,r=0;return e&&e.getRandomValues&&(t=e.getRandomValues(new Uint8Array(31))),i.split("").map((e=>"x"===e?o(t,++r).toString(16):"y"===e?(3&o()|8).toString(16):e)).join("")}function s(e){const t=n._A?.crypto||n._A?.msCrypto;let r,i=0;t&&t.getRandomValues&&(r=t.getRandomValues(new Uint8Array(31)));const a=[];for(var s=0;s {r.d(t,{Bq:()=>n,Hb:()=>o,oD:()=>i});const n="NRBA",i=144e5,o=18e5},7894:(e,t,r)=>{function n(){return Math.round(performance.now())}r.d(t,{z:()=>n})},7243:(e,t,r)=>{r.d(t,{e:()=>o});var n=r(385),i={};function o(e){if(e in i)return i[e];if(0===(e||"").indexOf("data:"))return{protocol:"data"};let t;var r=n._A?.location,o={};if(n.il)t=document.createElement("a"),t.href=e;else try{t=new URL(e,r.href)}catch(e){return o}o.port=t.port;var a=t.href.split("://");!o.port&&a[1]&&(o.port=a[1].split("/")[0].split("@").pop().split(":")[1]),o.port&&"0"!==o.port||(o.port="https"===a[0]?"443":"80"),o.hostname=t.hostname||r.hostname,o.pathname=t.pathname,o.protocol=a[0],"/"!==o.pathname.charAt(0)&&(o.pathname="/"+o.pathname);var s=!t.protocol||":"===t.protocol||t.protocol===r.protocol,c=t.hostname===r.hostname&&t.port===r.port;return o.sameOrigin=s&&(!t.hostname||c),"/"===o.pathname&&(i[e]=o),o}},50:(e,t,r)=>{function n(e,t){"function"==typeof console.warn&&(console.warn("New Relic: ".concat(e)),t&&console.warn(t))}r.d(t,{Z:()=>n})},2587:(e,t,r)=>{r.d(t,{N:()=>c,T:()=>u});var n=r(2177),i=r(5546),o=r(8e3),a=r(3325);const s={stn:[a.D.sessionTrace],err:[a.D.jserrors,a.D.metrics],ins:[a.D.pageAction],spa:[a.D.spa],sr:[a.D.sessionReplay,a.D.sessionTrace]};function c(e,t){const r=n.ee.get(t);e&&"object"==typeof e&&(Object.entries(e).forEach((e=>{let[t,n]=e;void 0===u[t]&&(s[t]?s[t].forEach((e=>{n?(0,i.p)("feat-"+t,[],void 0,e,r):(0,i.p)("block-"+t,[],void 0,e,r),(0,i.p)("rumresp-"+t,[Boolean(n)],void 0,e,r)})):n&&(0,i.p)("feat-"+t,[],void 0,void 0,r),u[t]=Boolean(n))})),Object.keys(s).forEach((e=>{void 0===u[e]&&(s[e]?.forEach((t=>(0,i.p)("rumresp-"+e,[!1],void 0,t,r))),u[e]=!1)})),(0,o.L)(t,a.D.pageViewEvent))}const u={}},2210:(e,t,r)=>{r.d(t,{X:()=>i});var n=Object.prototype.hasOwnProperty;function i(e,t,r){if(n.call(e,t))return e[t];var i=r();if(Object.defineProperty&&Object.keys)try{return Object.defineProperty(e,t,{value:i,writable:!0,enumerable:!1}),i}catch(e){}return e[t]=i,i}},1284:(e,t,r)=>{r.d(t,{D:()=>n});const n=(e,t)=>Object.entries(e||{}).map((e=>{let[r,n]=e;return t(r,n)}))},4351:(e,t,r)=>{r.d(t,{P:()=>o});var n=r(2177);const i=()=>{const e=new WeakSet;return(t,r)=>{if("object"==typeof r&&null!==r){if(e.has(r))return;e.add(r)}return r}};function o(e){try{return JSON.stringify(e,i())}catch(e){try{n.ee.emit("internal-error",[e])}catch(e){}}}},3960:(e,t,r)=>{r.d(t,{K:()=>a,b:()=>o});var n=r(3239);function i(){return"undefined"==typeof document||"complete"===document.readyState}function o(e,t){if(i())return e();(0,n.bP)("load",e,t)}function a(e){if(i())return e();(0,n.iz)("DOMContentLoaded",e)}},8632:(e,t,r)=>{r.d(t,{EZ:()=>u,Qy:()=>c,ce:()=>o,fP:()=>a,gG:()=>d,mF:()=>s});var n=r(7894),i=r(385);const o={beacon:"bam.nr-data.net",errorBeacon:"bam.nr-data.net"};function a(){return i._A.NREUM||(i._A.NREUM={}),void 0===i._A.newrelic&&(i._A.newrelic=i._A.NREUM),i._A.NREUM}function s(){let e=a();return e.o||(e.o={ST:i._A.setTimeout,SI:i._A.setImmediate,CT:i._A.clearTimeout,XHR:i._A.XMLHttpRequest,REQ:i._A.Request,EV:i._A.Event,PR:i._A.Promise,MO:i._A.MutationObserver,FETCH:i._A.fetch}),e}function c(e,t,r){let i=a();const o=i.initializedAgents||{},s=o[e]||{};return Object.keys(s).length||(s.initializedAt={ms:(0,n.z)(),date:new Date}),i.initializedAgents={...o,[e]:{...s,[r]:t}},i}function u(e,t){a()[e]=t}function d(){return function(){let e=a();const t=e.info||{};e.info={beacon:o.beacon,errorBeacon:o.errorBeacon,...t}}(),function(){let e=a();const t=e.init||{};e.init={...t}}(),s(),function(){let e=a();const t=e.loader_config||{};e.loader_config={...t}}(),a()}},7956:(e,t,r)=>{r.d(t,{N:()=>i});var n=r(3239);function i(e){let t=arguments.length>1&&void 0!==arguments[1]&&arguments[1],r=arguments.length>2?arguments[2]:void 0,i=arguments.length>3?arguments[3]:void 0;return void(0,n.iz)("visibilitychange",(function(){if(t)return void("hidden"==document.visibilityState&&e());e(document.visibilityState)}),r,i)}},1214:(e,t,r)=>{r.d(t,{em:()=>v,u5:()=>N,QU:()=>S,_L:()=>I,Gm:()=>L,Lg:()=>M,gy:()=>U,BV:()=>Q,Kf:()=>ee});var n=r(2177);const i="nr@original";var o=Object.prototype.hasOwnProperty,a=!1;function s(e,t){return e||(e=n.ee),r.inPlace=function(e,t,n,i,o){n||(n="");var a,s,c,u="-"===n.charAt(0);for(c=0;c 2?n-2:0),o=2;o {r(A[T],e,w),r(E[T],e,w)})),r(l._A,"fetch",y),t.on(y+"end",(function(e,r){var n=this;if(r){var i=r.headers.get("content-length");null!==i&&(n.rxSize=i),t.emit(y+"done",[null,r],n)}else t.emit(y+"done",[e],n)})),t}const O={},j=["pushState","replaceState"];function S(e){const t=function(e){return(e||n.ee).get("history")}(e);return!l.il||O[t.debugId]++||(O[t.debugId]=1,s(t).inPlace(window.history,j,"-")),t}var P=r(3239);const C={},R=["appendChild","insertBefore","replaceChild"];function I(e){const t=function(e){return(e||n.ee).get("jsonp")}(e);if(!l.il||C[t.debugId])return t;C[t.debugId]=!0;var r=s(t),i=/[?&](?:callback|cb)=([^&#]+)/,o=/(.*)\.([^.]+)/,a=/^(\w+)(\.|$)(.*)$/;function c(e,t){var r=e.match(a),n=r[1],i=r[3];return i?c(i,t[n]):t[n]}return r.inPlace(Node.prototype,R,"dom-"),t.on("dom-start",(function(e){!function(e){if(!e||"string"!=typeof e.nodeName||"script"!==e.nodeName.toLowerCase())return;if("function"!=typeof e.addEventListener)return;var n=(a=e.src,s=a.match(i),s?s[1]:null);var a,s;if(!n)return;var u=function(e){var t=e.match(o);if(t&&t.length>=3)return{key:t[2],parent:c(t[1],window)};return{key:e,parent:window}}(n);if("function"!=typeof u.parent[u.key])return;var d={};function f(){t.emit("jsonp-end",[],d),e.removeEventListener("load",f,(0,P.m$)(!1)),e.removeEventListener("error",l,(0,P.m$)(!1))}function l(){t.emit("jsonp-error",[],d),t.emit("jsonp-end",[],d),e.removeEventListener("load",f,(0,P.m$)(!1)),e.removeEventListener("error",l,(0,P.m$)(!1))}r.inPlace(u.parent,[u.key],"cb-",d),e.addEventListener("load",f,(0,P.m$)(!1)),e.addEventListener("error",l,(0,P.m$)(!1)),t.emit("new-jsonp",[e.src],d)}(e[0])})),t}var k=r(5763);const H={};function L(e){const t=function(e){return(e||n.ee).get("mutation")}(e);if(!l.il||H[t.debugId])return t;H[t.debugId]=!0;var r=s(t),i=k.Yu.MO;return i&&(window.MutationObserver=function(e){return this instanceof i?new i(r(e,"fn-")):i.apply(this,arguments)},MutationObserver.prototype=i.prototype),t}const z={};function M(e){const t=function(e){return(e||n.ee).get("promise")}(e);if(z[t.debugId])return t;z[t.debugId]=!0;var r=n.c,o=s(t),a=k.Yu.PR;return a&&function(){function e(r){var n=t.context(),i=o(r,"executor-",n,null,!1);const s=Reflect.construct(a,[i],e);return t.context(s).getCtx=function(){return n},s}l._A.Promise=e,Object.defineProperty(e,"name",{value:"Promise"}),e.toString=function(){return a.toString()},Object.setPrototypeOf(e,a),["all","race"].forEach((function(r){const n=a[r];e[r]=function(e){let i=!1;[...e||[]].forEach((e=>{this.resolve(e).then(a("all"===r),a(!1))}));const o=n.apply(this,arguments);return o;function a(e){return function(){t.emit("propagate",[null,!i],o,!1,!1),i=i||!e}}}})),["resolve","reject"].forEach((function(r){const n=a[r];e[r]=function(e){const r=n.apply(this,arguments);return e!==r&&t.emit("propagate",[e,!0],r,!1,!1),r}})),e.prototype=a.prototype;const n=a.prototype.then;a.prototype.then=function(){var e=this,i=r(e);i.promise=e;for(var a=arguments.length,s=new Array(a),c=0;c e())),t};function m(e,t){i.inPlace(t,["onreadystatechange"],"fn-",E)}function b(){var e=this,t=r.context(e);e.readyState>3&&!t.resolved&&(t.resolved=!0,r.emit("xhr-resolved",[],e)),i.inPlace(e,f,"fn-",E)}if(function(e,t){for(var r in e)t[r]=e[r]}(o,p),p.prototype=o.prototype,i.inPlace(p.prototype,J,"-xhr-",E),r.on("send-xhr-start",(function(e,t){m(e,t),function(e){h.push(e),a&&(y?y.then(A):u?u(A):(w=-w,x.data=w))}(t)})),r.on("open-xhr-start",m),a){var y=c&&c.resolve();if(!u&&!c){var w=1,x=document.createTextNode(w);new a(A).observe(x,{characterData:!0})}}else t.on("fn-end",(function(e){e[0]&&e[0].type===d||A()}));function A(){for(var e=0;e {r.d(t,{t:()=>n});const n=r(3325).D.ajax},6660:(e,t,r)=>{r.d(t,{A:()=>i,t:()=>n});const n=r(3325).D.jserrors,i="nr@seenError"},3081:(e,t,r)=>{r.d(t,{gF:()=>o,mY:()=>i,t9:()=>n,vz:()=>s,xS:()=>a});const n=r(3325).D.metrics,i="sm",o="cm",a="storeSupportabilityMetrics",s="storeEventMetrics"},4649:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageAction},7633:(e,t,r)=>{r.d(t,{Dz:()=>i,OJ:()=>a,qw:()=>o,t9:()=>n});const n=r(3325).D.pageViewEvent,i="firstbyte",o="domcontent",a="windowload"},9251:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageViewTiming},3614:(e,t,r)=>{r.d(t,{BST_RESOURCE:()=>i,END:()=>s,FEATURE_NAME:()=>n,FN_END:()=>u,FN_START:()=>c,PUSH_STATE:()=>d,RESOURCE:()=>o,START:()=>a});const n=r(3325).D.sessionTrace,i="bstResource",o="resource",a="-start",s="-end",c="fn"+a,u="fn"+s,d="pushState"},7836:(e,t,r)=>{r.d(t,{BODY:()=>A,CB_END:()=>E,CB_START:()=>u,END:()=>x,FEATURE_NAME:()=>i,FETCH:()=>_,FETCH_BODY:()=>v,FETCH_DONE:()=>m,FETCH_START:()=>p,FN_END:()=>c,FN_START:()=>s,INTERACTION:()=>l,INTERACTION_API:()=>d,INTERACTION_EVENTS:()=>o,JSONP_END:()=>b,JSONP_NODE:()=>g,JS_TIME:()=>T,MAX_TIMER_BUDGET:()=>a,REMAINING:()=>f,SPA_NODE:()=>h,START:()=>w,originalSetTimeout:()=>y});var n=r(5763);const i=r(3325).D.spa,o=["click","submit","keypress","keydown","keyup","change"],a=999,s="fn-start",c="fn-end",u="cb-start",d="api-ixn-",f="remaining",l="interaction",h="spaNode",g="jsonpNode",p="fetch-start",m="fetch-done",v="fetch-body-",b="jsonp-end",y=n.Yu.ST,w="-start",x="-end",A="-body",E="cb"+x,T="jsTime",_="fetch"},5938:(e,t,r)=>{r.d(t,{W:()=>o});var n=r(5763),i=r(2177);class o{constructor(e,t,r){this.agentIdentifier=e,this.aggregator=t,this.ee=i.ee.get(e,(0,n.OP)(this.agentIdentifier).isolatedBacklog),this.featureName=r,this.blocked=!1}}},9144:(e,t,r)=>{r.d(t,{j:()=>m});var n=r(3325),i=r(5763),o=r(5546),a=r(2177),s=r(7894),c=r(8e3),u=r(3960),d=r(385),f=r(50),l=r(3081),h=r(8632);function g(){const e=(0,h.gG)();["setErrorHandler","finished","addToTrace","inlineHit","addRelease","addPageAction","setCurrentRouteName","setPageViewName","setCustomAttribute","interaction","noticeError","setUserId"].forEach((t=>{e[t]=function(){for(var r=arguments.length,n=new Array(r),i=0;i 1?r-1:0),i=1;i {e.exposed&&e.api[t]&&o.push(e.api[t](...n))})),o.length>1?o:o[0]}(t,...n)}}))}var p=r(2587);function m(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:{},m=arguments.length>2?arguments[2]:void 0,v=arguments.length>3?arguments[3]:void 0,{init:b,info:y,loader_config:w,runtime:x={loaderType:m},exposed:A=!0}=t;const E=(0,h.gG)();y||(b=E.init,y=E.info,w=E.loader_config),(0,i.Dg)(e,b||{}),(0,i.GE)(e,w||{}),(0,i.sU)(e,x),y.jsAttributes??={},d.v6&&(y.jsAttributes.isWorker=!0),(0,i.CX)(e,y),g();const T=function(e,t){t||(0,c.R)(e,"api");const h={};var g=a.ee.get(e),p=g.get("tracer"),m="api-",v=m+"ixn-";function b(t,r,n,o){const a=(0,i.C5)(e);return null===r?delete a.jsAttributes[t]:(0,i.CX)(e,{...a,jsAttributes:{...a.jsAttributes,[t]:r}}),x(m,n,!0,o||null===r?"session":void 0)(t,r)}function y(){}["setErrorHandler","finished","addToTrace","inlineHit","addRelease"].forEach((e=>h[e]=x(m,e,!0,"api"))),h.addPageAction=x(m,"addPageAction",!0,n.D.pageAction),h.setCurrentRouteName=x(m,"routeName",!0,n.D.spa),h.setPageViewName=function(t,r){if("string"==typeof t)return"/"!==t.charAt(0)&&(t="/"+t),(0,i.OP)(e).customTransaction=(r||"http://custom.transaction")+t,x(m,"setPageViewName",!0)()},h.setCustomAttribute=function(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2];if("string"==typeof e){if(["string","number"].includes(typeof t)||null===t)return b(e,t,"setCustomAttribute",r);(0,f.Z)("Failed to execute setCustomAttribute.\nNon-null value must be a string or number type, but a type of was provided."))}else(0,f.Z)("Failed to execute setCustomAttribute.\nName must be a string type, but a type of was provided."))},h.setUserId=function(e){if("string"==typeof e||null===e)return b("enduser.id",e,"setUserId",!0);(0,f.Z)("Failed to execute setUserId.\nNon-null value must be a string type, but a type of was provided."))},h.interaction=function(){return(new y).get()};var w=y.prototype={createTracer:function(e,t){var r={},i=this,a="function"==typeof t;return(0,o.p)(v+"tracer",[(0,s.z)(),e,r],i,n.D.spa,g),function(){if(p.emit((a?"":"no-")+"fn-start",[(0,s.z)(),i,a],r),a)try{return t.apply(this,arguments)}catch(e){throw p.emit("fn-err",[arguments,this,"string"==typeof e?new Error(e):e],r),e}finally{p.emit("fn-end",[(0,s.z)()],r)}}}};function x(e,t,r,i){return function(){return(0,o.p)(l.xS,["API/"+t+"/called"],void 0,n.D.metrics,g),i&&(0,o.p)(e+t,[(0,s.z)(),...arguments],r?null:this,i,g),r?void 0:this}}function A(){r.e(439).then(r.bind(r,7438)).then((t=>{let{setAPI:r}=t;r(e),(0,c.L)(e,"api")})).catch((()=>(0,f.Z)("Downloading runtime APIs failed...")))}return["actionText","setName","setAttribute","save","ignore","onEnd","getContext","end","get"].forEach((e=>{w[e]=x(v,e,void 0,n.D.spa)})),h.noticeError=function(e,t){"string"==typeof e&&(e=new Error(e)),(0,o.p)(l.xS,["API/noticeError/called"],void 0,n.D.metrics,g),(0,o.p)("err",[e,(0,s.z)(),!1,t],void 0,n.D.jserrors,g)},d.il?(0,u.b)((()=>A()),!0):A(),h}(e,v);return(0,h.Qy)(e,T,"api"),(0,h.Qy)(e,A,"exposed"),(0,h.EZ)("activatedFeatures",p.T),T}},3325:(e,t,r)=>{r.d(t,{D:()=>n,p:()=>i});const n={ajax:"ajax",jserrors:"jserrors",metrics:"metrics",pageAction:"page_action",pageViewEvent:"page_view_event",pageViewTiming:"page_view_timing",sessionReplay:"session_replay",sessionTrace:"session_trace",spa:"spa"},i={[n.pageViewEvent]:1,[n.pageViewTiming]:2,[n.metrics]:3,[n.jserrors]:4,[n.ajax]:5,[n.sessionTrace]:6,[n.pageAction]:7,[n.spa]:8,[n.sessionReplay]:9}}},n={};function i(e){var t=n[e];if(void 0!==t)return t.exports;var o=n[e]={exports:{}};return r[e](o,o.exports,i),o.exports}i.m=r,i.d=(e,t)=>{for(var r in t)i.o(t,r)&&!i.o(e,r)&&Object.defineProperty(e,r,{enumerable:!0,get:t[r]})},i.f={},i.e=e=>Promise.all(Object.keys(i.f).reduce(((t,r)=>(i.f[r](e,t),t)),[])),i.u=e=>(({78:"page_action-aggregate",147:"metrics-aggregate",242:"session-manager",317:"jserrors-aggregate",348:"page_view_timing-aggregate",412:"lazy-feature-loader",439:"async-api",538:"recorder",590:"session_replay-aggregate",675:"compressor",733:"session_trace-aggregate",786:"page_view_event-aggregate",873:"spa-aggregate",898:"ajax-aggregate"}[e]||e)+"."+{78:"ac76d497",147:"3dc53903",148:"1a20d5fe",242:"2a64278a",317:"49e41428",348:"bd6de33a",412:"2f55ce66",439:"30bd804e",538:"1b18459f",590:"cf0efb30",675:"ae9f91a8",733:"83105561",786:"06482edd",860:"03a8b7a5",873:"e6b09d52",898:"998ef92b"}[e]+"-1.236.0.min.js"),i.o=(e,t)=>Object.prototype.hasOwnProperty.call(e,t),e={},t="NRBA:",i.l=(r,n,o,a)=>{if(e[r])e[r].push(n);else{var s,c;if(void 0!==o)for(var u=document.getElementsByTagName("script"),d=0;d {s.onerror=s.onload=null,clearTimeout(h);var i=e[r];if(delete e[r],s.parentNode&&s.parentNode.removeChild(s),i&&i.forEach((e=>e(n))),t)return t(n)},h=setTimeout(l.bind(null,void 0,{type:"timeout",target:s}),12e4);s.onerror=l.bind(null,s.onerror),s.onload=l.bind(null,s.onload),c&&document.head.appendChild(s)}},i.r=e=>{"undefined"!=typeof Symbol&&Symbol.toStringTag&&Object.defineProperty(e,Symbol.toStringTag,{value:"Module"}),Object.defineProperty(e,"__esModule",{value:!0})},i.j=364,i.p="https://js-agent.newrelic.com/",(()=>{var e={364:0,953:0};i.f.j=(t,r)=>{var n=i.o(e,t)?e[t]:void 0;if(0!==n)if(n)r.push(n[2]);else{var o=new Promise(((r,i)=>n=e[t]=[r,i]));r.push(n[2]=o);var a=i.p+i.u(t),s=new Error;i.l(a,(r=>{if(i.o(e,t)&&(0!==(n=e[t])&&(e[t]=void 0),n)){var o=r&&("load"===r.type?"missing":r.type),a=r&&r.target&&r.target.src;s.message="Loading chunk "+t+" failed.\n("+o+": "+a+")",s.name="ChunkLoadError",s.type=o,s.request=a,n[1](s)}}),"chunk-"+t,t)}};var t=(t,r)=>{var n,o,[a,s,c]=r,u=0;if(a.some((t=>0!==e[t]))){for(n in s)i.o(s,n)&&(i.m[n]=s[n]);if(c)c(i)}for(t&&t(r);u {i.r(o);var e=i(3325),t=i(5763);const r=Object.values(e.D);function n(e){const n={};return r.forEach((r=>{n[r]=function(e,r){return!1!==(0,t.Mt)(r,"".concat(e,".enabled"))}(r,e)})),n}var a=i(9144);var s=i(5546),c=i(385),u=i(8e3),d=i(5938),f=i(3960),l=i(50);class h extends d.W{constructor(e,t,r){let n=!(arguments.length>3&&void 0!==arguments[3])||arguments[3];super(e,t,r),this.auto=n,this.abortHandler,this.featAggregate,this.onAggregateImported,n&&(0,u.R)(e,r)}importAggregator(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:{};if(this.featAggregate||!this.auto)return;const r=c.il&&!0===(0,t.Mt)(this.agentIdentifier,"privacy.cookies_enabled");let n;this.onAggregateImported=new Promise((e=>{n=e}));const o=async()=>{let t;try{if(r){const{setupAgentSession:e}=await Promise.all([i.e(860),i.e(242)]).then(i.bind(i,3228));t=e(this.agentIdentifier)}}catch(e){(0,l.Z)("A problem occurred when starting up session manager. This page will not start or extend any session.",e)}try{if(!this.shouldImportAgg(this.featureName,t))return void(0,u.L)(this.agentIdentifier,this.featureName);const{lazyFeatureLoader:r}=await i.e(412).then(i.bind(i,8582)),{Aggregate:o}=await r(this.featureName,"aggregate");this.featAggregate=new o(this.agentIdentifier,this.aggregator,e),n(!0)}catch(e){(0,l.Z)("Downloading and initializing ".concat(this.featureName," failed..."),e),this.abortHandler?.(),n(!1)}};c.il?(0,f.b)((()=>o()),!0):o()}shouldImportAgg(r,n){return r!==e.D.sessionReplay||!1!==(0,t.Mt)(this.agentIdentifier,"session_trace.enabled")&&(!!n?.isNew||!!n?.state.sessionReplay)}}var g=i(7633),p=i(7894);class m extends h{static featureName=g.t9;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];if(super(r,n,g.t9,i),("undefined"==typeof PerformanceNavigationTiming||c.Tt)&&"undefined"!=typeof PerformanceTiming){const n=(0,t.OP)(r);n[g.Dz]=Math.max(Date.now()-n.offset,0),(0,f.K)((()=>n[g.qw]=Math.max((0,p.z)()-n[g.Dz],0))),(0,f.b)((()=>{const t=(0,p.z)();n[g.OJ]=Math.max(t-n[g.Dz],0),(0,s.p)("timing",["load",t],void 0,e.D.pageViewTiming,this.ee)}))}this.importAggregator()}}var v=i(1117),b=i(1284);class y extends v.w{constructor(e){super(e),this.aggregatedData={}}store(e,t,r,n,i){var o=this.getBucket(e,t,r,i);return o.metrics=function(e,t){t||(t={count:0});return t.count+=1,(0,b.D)(e,(function(e,r){t[e]=w(r,t[e])})),t}(n,o.metrics),o}merge(e,t,r,n,i){var o=this.getBucket(e,t,n,i);if(o.metrics){var a=o.metrics;a.count+=r.count,(0,b.D)(r,(function(e,t){if("count"!==e){var n=a[e],i=r[e];i&&!i.c?a[e]=w(i.t,n):a[e]=function(e,t){if(!t)return e;t.c||(t=x(t.t));return t.min=Math.min(e.min,t.min),t.max=Math.max(e.max,t.max),t.t+=e.t,t.sos+=e.sos,t.c+=e.c,t}(i,a[e])}}))}else o.metrics=r}storeMetric(e,t,r,n){var i=this.getBucket(e,t,r);return i.stats=w(n,i.stats),i}getBucket(e,t,r,n){this.aggregatedData[e]||(this.aggregatedData[e]={});var i=this.aggregatedData[e][t];return i||(i=this.aggregatedData[e][t]={params:r||{}},n&&(i.custom=n)),i}get(e,t){return t?this.aggregatedData[e]&&this.aggregatedData[e][t]:this.aggregatedData[e]}take(e){for(var t={},r="",n=!1,i=0;i t.max&&(t.max=e),e 2&&void 0!==arguments[2])||arguments[2];super(e,r,j.t,n),c.il&&((0,t.OP)(e).initHidden=Boolean("hidden"===document.visibilityState),(0,N.N)((()=>(0,s.p)("docHidden",[(0,p.z)()],void 0,j.t,this.ee)),!0),(0,O.bP)("pagehide",(()=>(0,s.p)("winPagehide",[(0,p.z)()],void 0,j.t,this.ee))),this.importAggregator())}}var P=i(3081);class C extends h{static featureName=P.t9;constructor(e,t){let r=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(e,t,P.t9,r),this.importAggregator()}}var R,I=i(2210),k=i(1214),H=i(2177),L={};try{R=localStorage.getItem("__nr_flags").split(","),console&&"function"==typeof console.log&&(L.console=!0,-1!==R.indexOf("dev")&&(L.dev=!0),-1!==R.indexOf("nr_dev")&&(L.nrDev=!0))}catch(e){}function z(e){try{L.console&&z(e)}catch(e){}}L.nrDev&&H.ee.on("internal-error",(function(e){z(e.stack)})),L.dev&&H.ee.on("fn-err",(function(e,t,r){z(r.stack)})),L.dev&&(z("NR AGENT IN DEVELOPMENT MODE"),z("flags: "+(0,b.D)(L,(function(e,t){return e})).join(", ")));var M=i(6660);class B extends h{static featureName=M.t;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(r,n,M.t,i),this.skipNext=0;try{this.removeOnAbort=new AbortController}catch(e){}const o=this;o.ee.on("fn-start",(function(e,t,r){o.abortHandler&&(o.skipNext+=1)})),o.ee.on("fn-err",(function(t,r,n){o.abortHandler&&!n[M.A]&&((0,I.X)(n,M.A,(function(){return!0})),this.thrown=!0,(0,s.p)("err",[n,(0,p.z)()],void 0,e.D.jserrors,o.ee))})),o.ee.on("fn-end",(function(){o.abortHandler&&!this.thrown&&o.skipNext>0&&(o.skipNext-=1)})),o.ee.on("internal-error",(function(t){(0,s.p)("ierr",[t,(0,p.z)(),!0],void 0,e.D.jserrors,o.ee)})),this.origOnerror=c._A.onerror,c._A.onerror=this.onerrorHandler.bind(this),c._A.addEventListener("unhandledrejection",(t=>{const r=function(e){let t="Unhandled Promise Rejection: ";if(e instanceof Error)try{return e.message=t+e.message,e}catch(t){return e}if(void 0===e)return new Error(t);try{return new Error(t+(0,D.P)(e))}catch(e){return new Error(t)}}(t.reason);(0,s.p)("err",[r,(0,p.z)(),!1,{unhandledPromiseRejection:1}],void 0,e.D.jserrors,this.ee)}),(0,O.m$)(!1,this.removeOnAbort?.signal)),(0,k.gy)(this.ee),(0,k.BV)(this.ee),(0,k.em)(this.ee),(0,t.OP)(r).xhrWrappable&&(0,k.Kf)(this.ee),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}onerrorHandler(t,r,n,i,o){"function"==typeof this.origOnerror&&this.origOnerror(...arguments);try{this.skipNext?this.skipNext-=1:(0,s.p)("err",[o||new F(t,r,n),(0,p.z)()],void 0,e.D.jserrors,this.ee)}catch(t){try{(0,s.p)("ierr",[t,(0,p.z)(),!0],void 0,e.D.jserrors,this.ee)}catch(e){}}return!1}}function F(e,t,r){this.message=e||"Uncaught error with no additional information",this.sourceURL=t,this.line=r}let U=1;const q="nr@id";function G(e){const t=typeof e;return!e||"object"!==t&&"function"!==t?-1:e===c._A?0:(0,I.X)(e,q,(function(){return U++}))}function V(e){if("string"==typeof e&&e.length)return e.length;if("object"==typeof e){if("undefined"!=typeof ArrayBuffer&&e instanceof ArrayBuffer&&e.byteLength)return e.byteLength;if("undefined"!=typeof Blob&&e instanceof Blob&&e.size)return e.size;if(!("undefined"!=typeof FormData&&e instanceof FormData))try{return(0,D.P)(e).length}catch(e){return}}}var X=i(7243);class W{constructor(e){this.agentIdentifier=e,this.generateTracePayload=this.generateTracePayload.bind(this),this.shouldGenerateTrace=this.shouldGenerateTrace.bind(this)}generateTracePayload(e){if(!this.shouldGenerateTrace(e))return null;var r=(0,t.DL)(this.agentIdentifier);if(!r)return null;var n=(r.accountID||"").toString()||null,i=(r.agentID||"").toString()||null,o=(r.trustKey||"").toString()||null;if(!n||!i)return null;var a=(0,_.M)(),s=(0,_.Ht)(),c=Date.now(),u={spanId:a,traceId:s,timestamp:c};return(e.sameOrigin||this.isAllowedOrigin(e)&&this.useTraceContextHeadersForCors())&&(u.traceContextParentHeader=this.generateTraceContextParentHeader(a,s),u.traceContextStateHeader=this.generateTraceContextStateHeader(a,c,n,i,o)),(e.sameOrigin&&!this.excludeNewrelicHeader()||!e.sameOrigin&&this.isAllowedOrigin(e)&&this.useNewrelicHeaderForCors())&&(u.newrelicHeader=this.generateTraceHeader(a,s,c,n,i,o)),u}generateTraceContextParentHeader(e,t){return"00-"+t+"-"+e+"-01"}generateTraceContextStateHeader(e,t,r,n,i){return i+"@nr=0-1-"+r+"-"+n+"-"+e+"----"+t}generateTraceHeader(e,t,r,n,i,o){if(!("function"==typeof c._A?.btoa))return null;var a={v:[0,1],d:{ty:"Browser",ac:n,ap:i,id:e,tr:t,ti:r}};return o&&n!==o&&(a.d.tk=o),btoa((0,D.P)(a))}shouldGenerateTrace(e){return this.isDtEnabled()&&this.isAllowedOrigin(e)}isAllowedOrigin(e){var r=!1,n={};if((0,t.Mt)(this.agentIdentifier,"distributed_tracing")&&(n=(0,t.P_)(this.agentIdentifier).distributed_tracing),e.sameOrigin)r=!0;else if(n.allowed_origins instanceof Array)for(var i=0;i 2&&void 0!==arguments[2])||arguments[2];super(r,n,Z.t,i),(0,t.OP)(r).xhrWrappable&&(this.dt=new W(r),this.handler=(e,t,r,n)=>(0,s.p)(e,t,r,n,this.ee),(0,k.u5)(this.ee),(0,k.Kf)(this.ee),function(r,n,i,o){function a(e){var t=this;t.totalCbs=0,t.called=0,t.cbTime=0,t.end=E,t.ended=!1,t.xhrGuids={},t.lastSize=null,t.loadCaptureCalled=!1,t.params=this.params||{},t.metrics=this.metrics||{},e.addEventListener("load",(function(r){_(t,e)}),(0,O.m$)(!1)),c.IF||e.addEventListener("progress",(function(e){t.lastSize=e.loaded}),(0,O.m$)(!1))}function s(e){this.params={method:e[0]},T(this,e[1]),this.metrics={}}function u(e,n){var i=(0,t.DL)(r);i.xpid&&this.sameOrigin&&n.setRequestHeader("X-NewRelic-ID",i.xpid);var a=o.generateTracePayload(this.parsedOrigin);if(a){var s=!1;a.newrelicHeader&&(n.setRequestHeader("newrelic",a.newrelicHeader),s=!0),a.traceContextParentHeader&&(n.setRequestHeader("traceparent",a.traceContextParentHeader),a.traceContextStateHeader&&n.setRequestHeader("tracestate",a.traceContextStateHeader),s=!0),s&&(this.dt=a)}}function d(e,t){var r=this.metrics,i=e[0],o=this;if(r&&i){var a=V(i);a&&(r.txSize=a)}this.startTime=(0,p.z)(),this.listener=function(e){try{"abort"!==e.type||o.loadCaptureCalled||(o.params.aborted=!0),("load"!==e.type||o.called===o.totalCbs&&(o.onloadCalled||"function"!=typeof t.onload)&&"function"==typeof o.end)&&o.end(t)}catch(e){try{n.emit("internal-error",[e])}catch(e){}}};for(var s=0;s 1?e[1]=i:e.push(i)}else e[0]&&e[0].headers&&s(e[0].headers,n)&&(this.dt=n);function s(e,t){var r=!1;return t.newrelicHeader&&(e.set("newrelic",t.newrelicHeader),r=!0),t.traceContextParentHeader&&(e.set("traceparent",t.traceContextParentHeader),t.traceContextStateHeader&&e.set("tracestate",t.traceContextStateHeader),r=!0),r}}function x(e,t){this.params={},this.metrics={},this.startTime=(0,p.z)(),this.dt=t,e.length>=1&&(this.target=e[0]),e.length>=2&&(this.opts=e[1]);var r,n=this.opts||{},i=this.target;"string"==typeof i?r=i:"object"==typeof i&&i instanceof Y?r=i.url:c._A?.URL&&"object"==typeof i&&i instanceof URL&&(r=i.href),T(this,r);var o=(""+(i&&i instanceof Y&&i.method||n.method||"GET")).toUpperCase();this.params.method=o,this.txSize=V(n.body)||0}function A(t,r){var n;this.endTime=(0,p.z)(),this.params||(this.params={}),this.params.status=r?r.status:0,"string"==typeof this.rxSize&&this.rxSize.length>0&&(n=+this.rxSize);var o={txSize:this.txSize,rxSize:n,duration:(0,p.z)()-this.startTime};i("xhr",[this.params,o,this.startTime,this.endTime,"fetch"],this,e.D.ajax)}function E(t){var r=this.params,n=this.metrics;if(!this.ended){this.ended=!0;for(var o=0;o 2&&void 0!==arguments[2])||arguments[2];super(e,t,we.t,r),this.importAggregator()}}new class{constructor(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:(0,_.ky)(16);c._A?(this.agentIdentifier=t,this.sharedAggregator=new y({agentIdentifier:this.agentIdentifier}),this.features={},this.desiredFeatures=new Set(e.features||[]),this.desiredFeatures.add(m),Object.assign(this,(0,a.j)(this.agentIdentifier,e,e.loaderType||"agent")),this.start()):(0,l.Z)("Failed to initial the agent. Could not determine the runtime environment.")}get config(){return{info:(0,t.C5)(this.agentIdentifier),init:(0,t.P_)(this.agentIdentifier),loader_config:(0,t.DL)(this.agentIdentifier),runtime:(0,t.OP)(this.agentIdentifier)}}start(){const t="features";try{const r=n(this.agentIdentifier),i=[...this.desiredFeatures];i.sort(((t,r)=>e.p[t.featureName]-e.p[r.featureName])),i.forEach((t=>{if(r[t.featureName]||t.featureName===e.D.pageViewEvent){const n=function(t){switch(t){case e.D.ajax:return[e.D.jserrors];case e.D.sessionTrace:return[e.D.ajax,e.D.pageViewEvent];case e.D.sessionReplay:return[e.D.sessionTrace];case e.D.pageViewTiming:return[e.D.pageViewEvent];default:return[]}}(t.featureName);n.every((e=>r[e]))||(0,l.Z)("".concat(t.featureName," is enabled but one or more dependent features has been disabled (").concat((0,D.P)(n),"). This may cause unintended consequences or missing data...")),this.features[t.featureName]=new t(this.agentIdentifier,this.sharedAggregator)}})),(0,T.Qy)(this.agentIdentifier,this.features,t)}catch(e){(0,l.Z)("Failed to initialize all enabled instrument classes (agent aborted) -",e);for(const e in this.features)this.features[e].abortHandler?.();const r=(0,T.fP)();return delete r.initializedAgents[this.agentIdentifier]?.api,delete r.initializedAgents[this.agentIdentifier]?.[t],delete this.sharedAggregator,r.ee?.abort(),delete r.ee?.get(this.agentIdentifier),!1}}}({features:[J,m,S,class extends h{static featureName=oe;constructor(t,r){if(super(t,r,oe,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;const n=this.ee;let i;(0,k.QU)(n),this.eventsEE=(0,k.em)(n),this.eventsEE.on(se,(function(e,t){this.bstStart=(0,p.z)()})),this.eventsEE.on(ae,(function(t,r){(0,s.p)("bst",[t[0],r,this.bstStart,(0,p.z)()],void 0,e.D.sessionTrace,n)})),n.on(ce+ne,(function(e){this.time=(0,p.z)(),this.startPath=location.pathname+location.hash})),n.on(ce+ie,(function(t){(0,s.p)("bstHist",[location.pathname+location.hash,this.startPath,this.time],void 0,e.D.sessionTrace,n)}));try{i=new PerformanceObserver((t=>{const r=t.getEntries();(0,s.p)(te,[r],void 0,e.D.sessionTrace,n)})),i.observe({type:re,buffered:!0})}catch(e){}this.importAggregator({resourceObserver:i})}},C,xe,B,class extends h{static featureName=de;constructor(e,r){if(super(e,r,de,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;if(!(0,t.OP)(e).xhrWrappable)return;try{this.removeOnAbort=new AbortController}catch(e){}let n,i=0;const o=this.ee.get("tracer"),a=(0,k._L)(this.ee),s=(0,k.Lg)(this.ee),u=(0,k.BV)(this.ee),d=(0,k.Kf)(this.ee),f=this.ee.get("events"),l=(0,k.u5)(this.ee),h=(0,k.QU)(this.ee),g=(0,k.Gm)(this.ee);function m(e,t){h.emit("newURL",[""+window.location,t])}function v(){i++,n=window.location.hash,this[ve]=(0,p.z)()}function b(){i--,window.location.hash!==n&&m(0,!0);var e=(0,p.z)();this[pe]=~~this[pe]+e-this[ve],this[ye]=e}function y(e,t){e.on(t,(function(){this[t]=(0,p.z)()}))}this.ee.on(ve,v),s.on(be,v),a.on(be,v),this.ee.on(ye,b),s.on(ge,b),a.on(ge,b),this.ee.buffer([ve,ye,"xhr-resolved"],this.featureName),f.buffer([ve],this.featureName),u.buffer(["setTimeout"+le,"clearTimeout"+fe,ve],this.featureName),d.buffer([ve,"new-xhr","send-xhr"+fe],this.featureName),l.buffer([me+fe,me+"-done",me+he+fe,me+he+le],this.featureName),h.buffer(["newURL"],this.featureName),g.buffer([ve],this.featureName),s.buffer(["propagate",be,ge,"executor-err","resolve"+fe],this.featureName),o.buffer([ve,"no-"+ve],this.featureName),a.buffer(["new-jsonp","cb-start","jsonp-error","jsonp-end"],this.featureName),y(l,me+fe),y(l,me+"-done"),y(a,"new-jsonp"),y(a,"jsonp-end"),y(a,"cb-start"),h.on("pushState-end",m),h.on("replaceState-end",m),window.addEventListener("hashchange",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener("load",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener("popstate",(function(){m(0,i>1)}),(0,O.m$)(!0,this.removeOnAbort?.signal)),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}}],loaderType:"spa"})})(),window.NRBA=o})(); window.jQuery || document.write(' ') CKEDITOR_BASEPATH='https://f1000research.com/js/vendor/ckeditor/' window.reactTheme = 'research'; window.MathJax = { CommonHTML: { linebreaks: { automatic: true } }, 'HTML-CSS': { linebreaks: { automatic: true } }, SVG: { linebreaks: { automatic: true } }, AuthorInit: function() { MathJax.Hub.Register.MessageHook('End Process', function () { let timeout = false; // holder for timeout id const delay = 250; // delay after event is "complete" to run callback const reflowMath = function() { const dispFormulas = document.querySelectorAll('.disp-formula.panel'); if (!dispFormulas) { return; } for (const dispFormula of dispFormulas) { const child = dispFormula.querySelector('.MathJax_Preview').nextSibling.firstChild; const isMultiline = MathJax.Hub.getAllJax(dispFormula)[0].root.isMultiline; if (dispFormula.offsetWidth < child.offsetWidth || isMultiline) { MathJax.Hub.Queue(['Rerender', MathJax.Hub, dispFormula]); } } }; window.addEventListener('resize', function() { clearTimeout(timeout); // clear the timeout timeout = setTimeout(reflowMath, delay); // start timing for event "completion" }); }); }, }; if (window.location.hash == '#_=_'){ window.location = window.location.href.split('#')[0] } !function(f,b,e,v,n,t,s){if(f.fbq)return;n=f.fbq=function() {n.callMethod? n.callMethod.apply(n,arguments):n.queue.push(arguments)} ;if(!f._fbq)f._fbq=n; n.push=n;n.loaded=!0;n.version='2.0';n.queue=[];t=b.createElement(e);t.async=!0; t.src=v;s=b.getElementsByTagName(e)[0];s.parentNode.insertBefore(t,s)}(window, document,'script','https://connect.facebook.net/en_US/fbevents.js'); fbq('init', '1641728616063202'); fbq('track', "PixelInitialized", {}); (function(h,o,t,j,a,r){ h.hj=h.hj||function(){(h.hj.q=h.hj.q||[]).push(arguments)}; h._hjSettings={hjid:2318163,hjsv:6}; a=o.getElementsByTagName('head')[0]; r=o.createElement('script');r.async=1; r.src=t+h._hjSettings.hjid+j+h._hjSettings.hjsv; a.appendChild(r); })(window,document,'https://static.hotjar.com/c/hotjar-','.js?sv='); search file_upload Submit your research search menu close search Browse Gateways & Collections How to Publish Submit your Research My Submissions Article Guidelines Article Guidelines (New Versions) Open Data, Software and Code Guidelines Open Data and Accessible Source Materials Guidelines (HSS) Open Data, Software and Code Guidelines (PSE) Prepublication Checks Production Process Posters and Slides Guidelines Document Guidelines Article Processing Charges Peer Review Finding Article Reviewers About How it Works For Reviewers Our Advisors Policies Glossary FAQs For Developers Newsroom Contact My Research Submissions Content and Tracking Alerts My Details Sign In file_upload Submit your research { "@context": "https://schema.org", "@type": "ScholarlyArticle", "mainEntityOfPage": { "@type": "WebPage", "@id": "https://f1000research.com/articles/8-93" }, "headline": "A high dose of total recombinant FSH suppresses granulosa cell apoptosis and maintains oocyte quality in...", "datePublished": "2019-01-23T16:37:29", "dateModified": "2019-01-23T16:37:29", "author": [ { "@type": "Person", "name": "Budi Wiweko" }, { "@type": "Person", "name": "Yassin Yanuar Mohammad" }, { "@type": "Person", "name": "Naylah Muna" }, { "@type": "Person", "name": "Kresna Mutia" }, { "@type": "Person", "name": "Julianto Witjaksono" }, { "@type": "Person", "name": "Nuri Purwito Adi" }, { "@type": "Person", "name": "Mila Maidarti" }, { "@type": "Person", "name": "Achmad Kemal Harzif" }, { "@type": "Person", "name": "Gita Pratama" }, { "@type": "Person", "name": "Kanadi Sumapraja" }, { "@type": "Person", "name": "R. Muharam" }, { "@type": "Person", "name": "Andon Hestiantoro" } ], "publisher": { "@type": "Organization", "name": "F1000Research", "logo": { "@type": "ImageObject", "url": "https://f1000research.com/img/AMP/F1000Research_image.png", "height": 480, "width": 60 } }, "image": { "@type": "ImageObject", "url": "https://f1000research.com/img/AMP/F1000Research_image.png", "height": 1200, "width": 150 }, "description": "Background: Endometriosis is one of the most common conditions causing infertility and an indication to undergo in vitro fertilization (IVF). High apoptosis rate and oxidative stress in patients with endometriosis are believed to negatively affect the IVF success rate. However, there have been conflicting results on the effect of endometriosis on IVF success, and there have been limited studies that directly assess endometriosis and its effect on oocyte quality. This study was performed to explore the correlation between mRNA BAX/BCL-2 expression and oocyte quality in endometriosis compared to non-endometriosis subjects. Methods: This was a cross-sectional study. 15 endometriosis and 15 non-endometriosis subjects were recruited through convenience sampling at Cipto Mangunkusumo Hospital, Jakarta. All subjects underwent follicle stimulation with recombinant follicle-stimulating hormone (FSH). Granulosa cells were collected and tested for BAX and BCL-2 expression and the results were compared to the oocyte quality and fertilization rate of the patients. Results: The total dose of recombinant FSH received by the endometriosis group was significantly higher compared with that of the non-endometriosis group (p = 0.005). There was a difference in BAX level (p = 0.029) and BCL-2 level (p<0.001) between groups. However, the BAX/BCL-2 ratio did not differ significantly (p = 0.787) between groups. No significant correlation was found between the BAX/BCL-2 ratio and any of the oocyte quality parameters measured. Conclusion: We found that there is a significantly higher dose in total dose recombinant FSH received by the endometriosis group compared with the non-endometriosis group. We also found that there was no significant difference in BAX/BCL-2 ratio between the endometriosis and non-endometriosis groups." } { "@context": "http://schema.org", "@type": "BreadcrumbList", "itemListElement": [ { "@type": "ListItem", "position": "1", "item": { "@id": "https://f1000research.com/", "name": "Home" } }, { "@type": "ListItem", "position": "2", "item": { "@id": "https://f1000research.com/browse/articles", "name": "Browse" } }, { "@type": "ListItem", "position": "3", "item": { "@id": "https://f1000research.com/articles/8-93", "name": "A high dose of total recombinant FSH suppresses granulosa cell apoptosis..." } } ] } Home Browse A high dose of total recombinant FSH suppresses granulosa cell apoptosis... ALL Metrics - Views Downloads Get PDF Get XML Cite How to cite this article Wiweko B, Mohammad YY, Muna N et al. A high dose of total recombinant FSH suppresses granulosa cell apoptosis and maintains oocyte quality in endometriosis: A cross-sectional study [version 1; peer review: 1 not approved] . F1000Research 2019, 8 :93 ( https://doi.org/10.12688/f1000research.17058.1 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. Close Copy Citation Details Export Export Citation Sciwheel EndNote Ref. Manager Bibtex ProCite Sente EXPORT Select a format first Track Share ▬ ✚ Research Article A high dose of total recombinant FSH suppresses granulosa cell apoptosis and maintains oocyte quality in endometriosis: A cross-sectional study [version 1; peer review: 1 not approved] Budi Wiweko 1-3 , Yassin Yanuar Mohammad 1 , Naylah Muna https://orcid.org/0000-0002-7320-8828 3 , [...] Kresna Mutia https://orcid.org/0000-0001-5323-874X 3 , Julianto Witjaksono 1-3 , Nuri Purwito Adi 4 , Mila Maidarti 1-3 , Achmad Kemal Harzif https://orcid.org/0000-0002-3552-1610 1-3 , Gita Pratama https://orcid.org/0000-0001-5626-1283 1-3 , Kanadi Sumapraja 1-3 , R. Muharam https://orcid.org/0000-0001-5712-3931 1-3 , Andon Hestiantoro https://orcid.org/0000-0001-7424-679X 1-3 Budi Wiweko 1-3 , Yassin Yanuar Mohammad 1 , [...] Naylah Muna https://orcid.org/0000-0002-7320-8828 3 , Kresna Mutia https://orcid.org/0000-0001-5323-874X 3 , Julianto Witjaksono 1-3 , Nuri Purwito Adi 4 , Mila Maidarti 1-3 , Achmad Kemal Harzif https://orcid.org/0000-0002-3552-1610 1-3 , Gita Pratama https://orcid.org/0000-0001-5626-1283 1-3 , Kanadi Sumapraja 1-3 , R. Muharam https://orcid.org/0000-0001-5712-3931 1-3 , Andon Hestiantoro https://orcid.org/0000-0001-7424-679X 1-3 PUBLISHED 23 Jan 2019 Author details Author details 1 Division of Reproductive Endocrinology and Infertility Department of Obstetrics and Gynaecology, Faculty of Medicine, Universitas Indonesia, Jakarta, 10430, Indonesia 2 Yasmin IVF Clinic, Dr. Cipto Mangunkusumo General Hospital, Jakarta, 10430, Indonesia 3 Human Reproductive, Infertility and Family Planning Research Center, Indonesia Medical Education and Research Institute (IMERI), Faculty of Medicine, Universitas Indonesia, Jakarta, 10430, Indonesia 4 Department of Community Medicine, Faculty of Medicine, Universitas Indonesia, Jakarta, Indonesia Budi Wiweko Roles: Conceptualization, Funding Acquisition, Supervision, Validation, Visualization, Writing – Original Draft Preparation Yassin Yanuar Mohammad Roles: Conceptualization, Data Curation, Supervision, Validation Naylah Muna Roles: Investigation, Methodology, Project Administration, Resources Kresna Mutia Roles: Formal Analysis, Investigation, Methodology, Resources Julianto Witjaksono Roles: Investigation, Supervision, Validation, Writing – Review & Editing Nuri Purwito Adi Roles: Data Curation, Investigation, Supervision, Validation Mila Maidarti Roles: Investigation, Supervision, Validation Achmad Kemal Harzif Roles: Investigation, Supervision, Validation Gita Pratama Roles: Investigation, Supervision, Validation Kanadi Sumapraja Roles: Investigation, Supervision, Validation R. Muharam Roles: Investigation, Supervision, Validation Andon Hestiantoro Roles: Investigation, Supervision, Validation OPEN PEER REVIEW DETAILS REVIEWER STATUS Abstract Background: Endometriosis is one of the most common conditions causing infertility and an indication to undergo in vitro fertilization (IVF). High apoptosis rate and oxidative stress in patients with endometriosis are believed to negatively affect the IVF success rate. However, there have been conflicting results on the effect of endometriosis on IVF success, and there have been limited studies that directly assess endometriosis and its effect on oocyte quality. This study was performed to explore the correlation between mRNA BAX/BCL-2 expression and oocyte quality in endometriosis compared to non-endometriosis subjects. Methods: This was a cross-sectional study. 15 endometriosis and 15 non-endometriosis subjects were recruited through convenience sampling at Cipto Mangunkusumo Hospital, Jakarta. All subjects underwent follicle stimulation with recombinant follicle-stimulating hormone (FSH). Granulosa cells were collected and tested for BAX and BCL-2 expression and the results were compared to the oocyte quality and fertilization rate of the patients. Results: The total dose of recombinant FSH received by the endometriosis group was significantly higher compared with that of the non-endometriosis group (p = 0.005). There was a difference in BAX level (p = 0.029) and BCL-2 level (p<0.001) between groups. However, the BAX/BCL-2 ratio did not differ significantly (p = 0.787) between groups. No significant correlation was found between the BAX/BCL-2 ratio and any of the oocyte quality parameters measured. Conclusion: We found that there is a significantly higher dose in total dose recombinant FSH received by the endometriosis group compared with the non-endometriosis group. We also found that there was no significant difference in BAX/BCL-2 ratio between the endometriosis and non-endometriosis groups. READ ALL READ LESS Keywords Apoptosis, BAX/BCL-2 ratio, Endometriosis, Oocyte Quality, r-FSH Corresponding Author(s) Budi Wiweko ( [email protected] ) Kresna Mutia ( [email protected] ) Close Corresponding authors: Budi Wiweko, Kresna Mutia Competing interests: No competing interests were disclosed. Grant information: Financial support research grant from University of Indonesia—Dr Cipto Mangunkusumo General Hospital, Jakarta and Indonesia. Copyright: © 2019 Wiweko B et al . This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. How to cite: Wiweko B, Mohammad YY, Muna N et al. A high dose of total recombinant FSH suppresses granulosa cell apoptosis and maintains oocyte quality in endometriosis: A cross-sectional study [version 1; peer review: 1 not approved] . F1000Research 2019, 8 :93 ( https://doi.org/10.12688/f1000research.17058.1 ) First published: 23 Jan 2019, 8 :93 ( https://doi.org/10.12688/f1000research.17058.1 ) Latest published: 23 Jan 2019, 8 :93 ( https://doi.org/10.12688/f1000research.17058.1 ) Introduction Endometriosis is a condition in which endometrial tissues and glands are found outside the uterine cavity. This condition might cause pelvic pain and infertility. Ectopic endometrial tissue causes chronic inflammation, widespread fibrotic change, and adhesion 1 , 2 . Endometriosis occurs in 25–40% of women with infertility, and 30–50% of women with endometriosis also have infertility 3 , 4 . Endometriosis has been found to cause folliculogenesis and oocyte maturation disturbances, an increase in oxidative stress, and an imbalance in inflammatory cytokines that result in infertility 5 – 8 . In vitro fertilization (IVF) is one of the treatment options for patients with endometriosis. In 2016, in Indonesia, there were 8152 IVF cycles were performed, 7.03% of them were in women with endometriosis 9 . Studies on endometriosis affecting IVF success rate have shown conflicting results 10 . Some meta-analyses report that endometriosis affects the rate of pregnancy, miscarriage, and live birth during IVF. However, there has not been any adequate study that evaluates oocyte quality as an outcome of endometriosis. Oocyte quality is defined as the oocyte’s ability to undergo maturation and fertilization 11 . Some studies that evaluated oocytes quality from endometriosis patients found that oocyte quality were poorer regardless of sperm quality and uterine cavity condition 12 , 13 . Increased apoptosis rates have been found in endometriosis ovaries, and this has been linked to decreased oocyte quality 14 . Studies on apoptosis show a difference between endometriosis ovaries and non-endometriosis ovaries due to increased oxidative stress 15 . This condition triggers apoptosis through intrinsic and extrinsic pathways as well as meiotic spindle dysfunction and direct destruction through lipid peroxidase 16 , 17 . Apoptosis is regulated by specific genes that code protein and initiate the whole process. B-cell lymphoma/leukemia 2 (BCL-2) plays a crucial role in regulating apoptosis. This protein family consists of two categories: apoptosis inhibitors, BCL-2 and BCL-2-like 1 (BCL-2-LI or BCL-XL); as well as an apoptosis trigger, BCL-2-associated X protein (BAX) 18 . This study aimed to measure the gene expression of these apoptosis regulators, BCL-2 and BAX, and evaluate their correlation with oocyte quality in endometriosis and non-endometriosis IVF patients. The proposed conclusion was that there was significant difference in BAX/BCL-2 mRNA expression in patients with endometriosis and non-endometriosis. Methods Sample selection Subjects were selected through convenience sampling. In total, 30 women were recruited for the study, who were undergoing IVF treatment at Yasmin Kencana Clinic, Cipto Mangunkusumo Hospital, Jakarta. Sample recruitment was done in June 2016 to August 2017. All subjects found to positively have endometriosis, determined from a clinical examination and imaging procedures done by an obstetrician/gynecologist, were included in this study as a case group. However, subjects found to have other ovarian disturbances, history of ovarian removal, smoking, alcohol consumption, and sperm factor were excluded. For control group, we included all subjects with ovarian disturbance other than endometriosis and excluded subjects with male infertility factor. Granulosa cell sampling was conducted in the IVF Laboratory, while RNA isolation and quantitative real-time polymerase chain reaction (PCR) were done in the Integrated Laboratory Faculty of Medicine, Universitas Indonesia, between August and October 2017. This study was conducted according to ethical standards in the Declaration of Helsinki and approved by the Faculty of Medicine Universitas Indonesia-Dr. Cipto Mangunkusumo General Hospital Research Ethical Committee with approval number LB.02.01/X.2/871/2017. All subjects in this study had the research clearly explained to them and have signed informed consent. Data collection RNA and DNA extraction from granulosa cells . Follicular fluid and granulosa cells were taken during ovum pickup, as part of routine IVF treatment. Granulosa cells were obtained during follicular aspiration and separated from the oocyte. These cells were then kept in a tube containing 500 uL RNA Later solution and stored at a temperature of -80°C. RNA was isolated from granulosa cells using the QIAamp RNA Blood Mini Kit (QIAGEN) according to the modified QIAamp RNA Blood Mini Handbook 19 . Buffer RLT and beta-mercaptoethanol were set with a 600 uL:6 uL ratio for each sample. Briefly, the granulosa cell samples in RNA Later solution were thawed and centrifuged at 20°C for 5 minutes (8000 × g). The supernatant was discarded, and RLT buffer mixed with beta-mercaptoethanol was added and homogenized. The sample was moved to a QIAshredder spin column and centrifuged for 8 minutes at 20°C (8000 × g). 600 uL Ethanol 70% was added to flow-through liquid, homogenized, and moved into QIAmp spin column. The QIAamp spin column was then centrifuged for 15 seconds (16.000 × g). The flow-through was then discarded and the column was washed using 600 uL RW1 buffer, centrifuged for 15 seconds (16.000 × g), and the flow-through was discarded. 500 uL RPE buffer was then added into the column for final washing, centrifuged for 15 seconds (16.000 × g), and the flow-through was discarded. This step was repeated twice. 25 uL RNase-free water was then added into the column as an elution solution to bind the RNA and the column was incubated for 10 minutes. The column then underwent centrifuge for 1 minute (16.000 × g) and the RNA collected at the collection tube under QIAamp spin column. The RNA concentration was measured with Nano Drop and stored at -80°C. cDNA was synthesized from RNA using the Qiagen Quantitect Reverse Transcription Kit according to the modified Quantitect Reverse Transcription Mini Handbook protocol 20 . The RNA template was mixed with RNase-free water with certain ratio according to RNA concentration obtained to gain equal cDNA concentration for all samples. This RNA and RNase-free water mix will obtain total volume of 14 uL. gDNA Wipeout buffer was then added into the mix and then incubated at 42°C for 10 minutes. Into each sample was then added Reverse-transcription master mix 1 uL, Quantiscript RT buffer 4 uL, and RT Primer mix 1 uL. the sample was then incubate at 42°C for 15 minutes and 95°C for 3 minutes. cDNA samples were then stored at -20°C until ready to be used. Real-time PCR for BAX and BCL-2 expression Quantitative real-time PCR was conducted using Qiagen Quantitect SYBR Green PCR Kit according to the modified Quantitect SYBR Green PCR Mini Handbook protocol 21 . qPCR was done by using absolute quantification, which measures sample by referring to standard curve. Standard curve was constructed using gBlocks oligonucleotide which made from amplicon product from each BAX and BCL-2 primer. The quantitative real-time PCR was performed using primers in Table 1 . Table 1. BAX and BCL-2 Primer List. Gene Primer Sequence Amplicon size Tm (°C) BAX Forward CGGCCTCCTCTCCTACTT 106 58 BAX Reverse GCCTCAGCCCATCTTCTTC 106 58 BCL-2 Forward ACCGGGAGATAGTGATGAAGTA 128 60 BCL-2 Reverse GGGCTGGGAGGAGAAGA 128 58 PCR master mix was firstly prepared and contain of 12.5 uL SYBR Green PCR mix, 0.25 uL forward primer, 0.25 uL reverse primer, and 10 uL nuclease-free water for each sample. After homogenized, the cDNA samples were then added into tube containing PCR mix and placed in real-time PCR instrument (Qiagen Rotor Gene-Q real-time PCR). Thermal profile of the instrument was set as shown in Table 2 , while annealing temperature was set according do melting temperature in Table 1 for each gene, 58°C for BAX and 60°C for BCL-2. Table 2. Thermal Profile for Quantitative Real-time PCR. Step Time Temperature (°C) PCR activation 15 minutes 95 Denaturation 15 seconds 95 Annealing 30 seconds variable Extension 30 seconds 72 Number of Cycles 40 Construction of standard curve was performed using the same PCR master mix composition, except for the cDNA samples. The cDNA was replaced by gBlocks oligonucleotide which has known concentration and diluted 5 times. The concentration of each gBlocks used were 1 until 1 × 10ˆ-8 ng/uL. Each gBlocks concentration was run duplicate to obtain standard curve with coefficient of determination value close to 1. The standard curve was then used to measure each sample. Oocyte quality assessment . Oocyte quality was measured by assessing morphology, maturation index, and fertilization rate. This assessment was performed under an Inverted Microscope (Olympus). Oocyte morphology was classified with Xia criteria, and mean score was calculated from the total number of oocytes obtained per subject 22 . The maturation index was defined as percentage of oocytes in metaphase II, whereas the fertilization rate was defined as percentage of metaphase II oocytes which successfully fertilized. Data analysis During the stimulation phase, subjects were exposed to recombinant FSH, and the total dose of FSH might influence the result of the study; therefore, the total dose of FSH provided to the participants was noted. BAX/BCL-2 ratio was the independent variable, whereas the oocyte quality was the dependent variable. Statistical analysis was conducted with IBM SPSS (Statistical Package for Social Sciences) version 22, to test distribution and comparison between the endometriosis group and the control group for each variable. A correlation test was done to test any association between BAX/BCL-2 ratio and oocyte quality indicators in both groups. Variables with normally distributed data were tested with an independent t test, whereas other variables were tested with the Mann-Whitney test. Results A total of 30 subjects took part in this study: endometriosis group (n = 15) and control group (n = 15). Characteristics of these subjects are in Table 3 . The patients’ age in both groups showed a normal distribution, with a mean age of 33.27 ± 4.448 for endometriosis group and 32.67 ± 3.559 for non-endometriosis group. Total dose of recombinant FSH received was calculated and there was a significant difference between the groups; mean dose of FSH received by the endometriosis group was 3760.0 ± 1054.15 while the non-endometriosis group was 2763.3 ± 700.82 (p=0.005). The total number of oocytes obtained during ovum pickup was normally distributed in both groups ( Table 3 ). The mean number of oocytes was lower in the endometriosis group, although the difference was not significant. Table 3. Endometriosis and non-endometriosis patient characteristics undergoing IVF treatment. Characteristics (mean±SD) Endometriosis (n=15) Non-en (n=15) p-value Age (years) 33.27±4.45 32.67±3.56 0.686 FSH dose (IU) 3760±1054.15 2763.3±700.82 0.005 Oocyte number 9.93±5.216 12.27±7.620 0.336 Oocyte score 2.61±0.60 2.50±0.57 0.611 Gene expression of BAX and BCL-2 were significantly different between the groups, with the concentrations of both genes being lower in the endometriosis group ( Table 4 ). However, there was no statistically significant difference between the BAX/BCL-2 ratio between groups (p=0.787). Oocyte quality was measured with three indicators: morphology, maturation index, and fertilization rate. We found no oocyte quality difference in the endometriosis group compared with the non-endometriosis group ( Table 4 ). Table 4. Gene expression of BAX and BCL-2, maturation index and fertilization rate for endometriosis and non-endometriosis patients undergoing IVF treatment. Gene expression (mean (95%CI)) Endometriosis (n=15) Non-en (n=15) p-value BAX ng/uL) 7.47 (0.270 – 38.2) 73.00 (0.119 – 66200) 0.029 BCL-2 (ng/uL) 0.10 (0.011 – 15.5) 9.87 (0.278 – 38.1) 0.001 BAX/BCL-2 ratio 74.69 (0.03 – 591.41) 94.80 (0.01 – 56101.69) 0.787 Maturation index 0.8 (0.50 – 1.00) 1.0 (0.25 – 1.00) 0.225 Fertilization rate 0.67 (0.17 – 1.25) 0.67 (0.00 – 0.93) 0.693 Discussion BAX and BCL-2 are two proteins that play a crucial role in cell apoptosis through the intrinsic pathway. BAX is an apoptosis initiator, whereas BCL-2 is anti-apoptotic. A previous study by Tommi et al . found that the ratio between BAX and BCL-2 is one of the important indicators of apoptosis activity in cells 23 . The increases in BAX/BCL-2 ratio correspond to increased apoptosis activity and vice versa. In this study, we found significant differences in BAX and BCL-2 mRNA concentrations in both groups. The expression of both genes was lower in the endometriosis group compared with the non-endometriosis group (p = 0.029 in BAX and p<0.001 in BCL-2). However, there was no difference in the BAX/BCL-2 mRNA ratio between groups (p = 0.787). This result showed that there is no difference in apoptosis activity in endometriosis granulosa cells compared with non-endometriosis cells. This finding is inconsistent with a previous study by Wiweko et al , which stated that BAX mRNA concentration in endometriosis granulosa cells is higher than in the control group 24 . However, the lower level of BAX mRNA does not imply less apoptotic activity. One interaction model of BAX and BCL-2 protein showed that while BAX induces apoptosis, BCL-2 inhibits the process 25 . In this case, the low level of BCL-2 in endometriosis might result in decreased anti-apoptotic activity. There was also a study that showed fewer follicles in rats with BCL-2 deficiency, and that higher BCL-2 expression would suppress apoptosis and atresia 26 . Filali et al. reported the essential role of BCL-2 mRNA in granulosa cells in determining oocyte quality. BCL-2 mRNA expression was found to be higher in the granulosa cells of mature oocytes, whereas there was no difference in BAX mRNA in the same cells. Moreover, BCL-2 mRNA correlates with the fertilization rate due to the lower apoptosis activity 27 . BAX/BCL-2 ratio has a more important role as an apoptosis marker, as mentioned earlier. However, in this study, we found no significant difference in apoptosis activity. This finding is inconsistent with a previous study by Wiweko et al. in 2017, which showed a higher BAX/BCL-2 ratio in the endometriosis group compared with the control group 28 . In the present study, the oocyte number in the endometriosis group was lower than in the non-endometriosis group, but was not significant (p = 0.336). This finding is in line with studies by Rossi et al. and Yang et al. that showed a smaller number of oocytes in endometriosis subjects 29 , 30 . Regarding oocyte quality, we found no differences in the mean oocyte score, maturation index, and fertilization rate between the groups. The mean oocyte score showed no significant difference (p = 0.611). The oocyte score was assessed by Xia criteria, which analyzes oocyte morphology based on perivitelline space, polar body II, and cytoplasm. This result is inconsistent with Shebl et al , who reported that fewer normal oocytes were observed in patients with endometriosis compared with control subjects 31 . Similarly, the maturation index and fertilization rate in both groups did not show a marked difference (p=0.225 and p=0.693, respectively). This is inconsistent with other related studies that showed maturation index and fertilization rate in endometriosis were poor; Rossi et al. and Yang et al. reported that less MII oocytes were found in endometriosis patients 29 , 30 . On the other hand, Luca et al. stated that there was no difference in the number of MII oocytes in an endometriosis group compared with a control group 32 . Inconsistent with our finding, Barnhart et al. showed a lower fertilization rate in endometriosis patients 33 . The fertilization rate in patients with severe endometriosis was higher compared with subjects with mild/moderate endometriosis and control subjects. However, Yang reported that a decrease in fertilization rate only occurred in subjects with endometriosis grade III/IV, not those with grade I/II, compared with control subjects 30 . In this study, there was no correlation between BAX/BCL-2 mRNA ratio and mean oocyte score, maturation index, and fertilization rate in both groups. This result suggests that similar apoptosis activity will result in similar oocyte quality. Although we found no difference in BAX/BCL-2 mRNA ratio and oocyte quality, there was a significant discrepancy in recombinant FSH dose given to each group (p=0.005). The mean FSH dose in the endomteriosis group was 3760 IU, whereas the control group 2763.3 received IU. Shen et al. reported that FSH might play a role in protecting granulosa cells from oxidative stress, although the mechanism is currently unknown. FSH also protects mitochondria in granulosa cells undergoing oxidative stress 34 . Our study shows that subjects with endometriosis may benefit from higher dose of recombinant FSH to produce oocytes with similar quality to those in the control group. Therefore, further studies on FSH and its correlation with apoptosis activity and oocyte quality during ovum pickup are needed. Conclusions Although we found lower levels of BAX mRNA and BCL-2 mRNA in patients with endometriosis, the ratio of these mRNAs was not statistically significant between groups. There was also no correlation between BAX/BCL-2 mRNA ratio and oocyte number, FSH dose, and oocyte quality in both groups. However, we noted a significantly higher dose of recombinant FSH given to the subjects with endometriosis compared with those in the non-endometriosis group. We suggest for future studies a similar protocol in collecting granulosa cells from size-matched follicles to minimize the discrepancy in BAX and BCL-2 mRNA concentrations. Moreover, examination and records on basal antral follicle and anti-müllerian hormone concentration should become a part of the standard IVF protocol. Data availability Figshare: DATA_A High Dose of Total Recombinant FSH Suppress Granulosa Cells Apoptosis, https://doi.org/10.6084/m9.figshare.7483574.v1 35 . Data are available under the terms of the Creative Commons Zero “No rights reserved” data waiver ( CC0 1.0 Public domain dedication ). Grant information Financial support research grant from University of Indonesia—Dr Cipto Mangunkusumo General Hospital, Jakarta and Indonesia. Acknowledgements The authors would like to thank Indonesian Reproductive Medicine Research and Training Center (INAREPROMED) and Yasmin Clinic Rumah Sakit Dr. Cipto Mangunkusumo Hospital teams for assistance and support in this study. F1000 recommended References 1. Giudice LC, Kao LC: Endometriosis. Lancet. 2004; 364 (9447): 1789–99. PubMed Abstract | Publisher Full Text 2. Somigliana E, Viganò P, Tirelli AS, et al. : Use of the concomitant serum dosage of CA 125, CA 19-9 and interleukin-6 to detect the presence of endometriosis. Results from a series of reproductive age women undergoing laparoscopic surgery for benign gynaecological conditions. Hum Reprod. 2004; 19 (8): 1871–6. PubMed Abstract | Publisher Full Text 3. Hummelshoj L, Prentice A, Groothuis P: Update on endometriosis. Womens Health (Lond). 2006; 2 (1): 53–6. PubMed Abstract | Publisher Full Text 4. Ozkan S, Murk W, Arici A: Endometriosis and infertility: epidemiology and evidence-based treatments. Ann N Y Acad Sci. 2008; 1127 : 92–100. PubMed Abstract | Publisher Full Text 5. Garrido N, Navarro J, Remohí J, et al. : Follicular hormonal environment and embryo quality in women with endometriosis. Hum Reprod Update. 2000; 6 (1): 67–74. PubMed Abstract | Publisher Full Text 6. Matsuzaki S, Schubert B: Oxidative stress status in normal ovarian cortex surrounding ovarian endometriosis. Fertil Steril. 2010; 93 (7): 2431–2. PubMed Abstract | Publisher Full Text 7. Richter ON, Dorn C, Rösing B, et al. : Tumor necrosis factor alpha secretion by peritoneal macrophages in patients with endometriosis. Arch Gynecol Obstet. 2005; 271 (2): 143–7. PubMed Abstract | Publisher Full Text 8. Toya M, Saito H, Ohta N, et al. : Moderate and severe endometriosis is associated with alterations in the cell cycle of granulosa cells in patients undergoing in vitro fertilization and embryo transfer. Fertil Steril. 2000; 73 (2): 344–50. PubMed Abstract | Publisher Full Text 9. PERFITRI: Indonesian Association for In Vitro Fertization’s National Report 2017. IAIVF; 2018. 10. González-Comadran M, Schwarze JE, Zegers-Hochschild F, et al. : The impact of endometriosis on the outcome of Assisted Reproductive Technology. Reprod Biol Endocrinol. 2017; 15 (1): 8. PubMed Abstract | Publisher Full Text | Free Full Text 11. Sanchez AM, Vanni VS, Bartiromo L, et al. : Is the oocyte quality affected by endometriosis? A review of the literature. J Ovarian Res. 2017; 10 (1): 43. PubMed Abstract | Publisher Full Text | Free Full Text 12. Hull MG, Williams JA, Ray B, et al. : The contribution of subtle oocyte or sperm dysfunction affecting fertilization in endometriosis-associated or unexplained infertility: a controlled comparison with tubal infertility and use of donor spermatozoa. Hum Reprod. 1998; 13 (7): 1825–30. PubMed Abstract | Publisher Full Text 13. Navarro J, Garrido N, Remohi J, et al. : How does endometriosis affect infertility? Obstet Gynecol Clin North Am. 2003; 30 (1): 181–92. PubMed Abstract | Publisher Full Text 14. Díaz I, Navarro J, Blasco L, et al. : Impact of stage III-IV endometriosis on recipients of sibling oocytes: matched case-control study. Fertil Steril. 2000; 74 (1): 31–4. PubMed Abstract | Publisher Full Text 15. Garcia-Velasco JA, Arici A: Is the endometrium or oocyte/embryo affected in endometriosis? Hum Reprod. 1999; 14 (Suppl 2): 77–89. PubMed Abstract | Publisher Full Text 16. Agarwal A, Gupta S, Sikka S: The role of free radicals and antioxidants in reproduction. Curr Opin Obstet Gynecol. 2006; 18 (3): 325–32. PubMed Abstract | Publisher Full Text 17. Sanchez AM, Somigliana E, Vercellini P, et al. : Endometriosis as a detrimental condition for granulosa cell steroidogenesis and development: From molecular alterations to clinical impact. J Steroid Biochem Mol Biol. 2016; 155 (Pt A): 35–46. PubMed Abstract | Publisher Full Text 18. Depalo R, Cavallini A, Lorusso F, et al. : Apoptosis in normal ovaries of women with and without endometriosis. Reprod Biomed Online. 2009; 19 (6): 808–15. PubMed Abstract | Publisher Full Text 19. QIAGEN: QIAamp ®. RNA Blood Mini Handbook. 2010. Reference Source 20. QIAGEN: QuantiTect ®. Reverse Transcription Handbook. 2009. Reference Source 21. QIAGEN: QuantiTect ® SYBR ® Green PCR Handbook.2011. Reference Source 22. Xia P: Intracytoplasmic sperm injection: correlation of oocyte grade based on polar body, perivitelline space and cytoplasmic inclusions with fertilization rate and embryo quality. Hum Reprod. 1997; 12 (8): 1750–5. PubMed Abstract 23. Tommi V, editor. Regulation of apoptosis in the female reproductive system. University of Oulu; 2002. Reference Source 24. Wiweko B, Bowolaksono A, Narasati S, et al. : The Expression of Granulosa Cells BAX mRNA Among Endometriosis and Normal Women. Adv Sci Lett. 2017; 23 : 7012–4. Publisher Full Text 25. Hadi R: Mekanisme Apoptosis Pada Regresi Sel Luteal. Maj Kesehat PharmaMedika. 2011; 3 : 246–54. Reference Source 26. Hussein MR: Apoptosis in the ovary: molecular mechanisms. Hum Reprod Update. 2005; 11 (2): 162–77. PubMed Abstract | Publisher Full Text 27. Filali M, Frydman N, Belot MP, et al. : Oocyte in-vitro maturation: BCL2 mRNA content in cumulus cells reflects oocyte competency. Reprod Biomed Online. 2009; 19 (Suppl 4): 4309. PubMed Abstract | Publisher Full Text 28. Wiweko B, Muna N, Gunawarti D, et al. : High bax-bcl-2 Ratio Expression on Granulosa Cells from Endometriosis Patients. Adv Sci Lett. 2017; 23 (7): 6720–2. Publisher Full Text 29. Rossi AC, Prefumo F: The effects of surgery for endometriosis on pregnancy outcomes following in vitro fertilization and embryo transfer: a systematic review and meta-analysis. Arch Gynecol Obstet. 2016; 294 (3): 647–55. PubMed Abstract | Publisher Full Text 30. Yang C, Geng Y, Li Y, et al. : Impact of ovarian endometrioma on ovarian responsiveness and IVF: a systematic review and meta-analysis. Reprod Biomed Online. 2015; 31 (1): 9–19. PubMed Abstract | Publisher Full Text 31. Shebl O, Sifferlinger I, Habelsberger A, et al. : Oocyte competence in in vitro fertilization and intracytoplasmic sperm injection patients suffering from endometriosis and its possible association with subsequent treatment outcome: a matched case-control study. Acta Obstet Gynecol Scand. 2017; 96 (6): 736–44. PubMed Abstract | Publisher Full Text 32. Luca A, Nemescu D, Butnaru M, et al. : Ovarian stimulation outcome in infertile women with endometriosis undergoing IVF. Ginekol Pol. 2016; 87 (1): 37–41. PubMed Abstract | Publisher Full Text 33. Barnhart K, Dunsmoor-Su R, Coutifaris C: Effect of endometriosis on in vitro fertilization. Fertil Steril. 2002; 77 (6): 1148–55. PubMed Abstract | Publisher Full Text 34. Shen M, Jiang Y, Guan Z, et al. : FSH protects mouse granulosa cells from oxidative damage by repressing mitophagy. Sci Rep. 2016; 6 : 38090. PubMed Abstract | Publisher Full Text | Free Full Text 35. Muna N: DATA_A High Dose ofTotal Recombinant FSH Suppress Granulosa Cells Apoptosis.xlsx. figshare. Dataset. 2018. https://www.doi.org/10.6084/m9.figshare.7483574.v1 Comments on this article Comments (0) Version 1 VERSION 1 PUBLISHED 23 Jan 2019 ADD YOUR COMMENT Comment Author details Author details 1 Division of Reproductive Endocrinology and Infertility Department of Obstetrics and Gynaecology, Faculty of Medicine, Universitas Indonesia, Jakarta, 10430, Indonesia 2 Yasmin IVF Clinic, Dr. Cipto Mangunkusumo General Hospital, Jakarta, 10430, Indonesia 3 Human Reproductive, Infertility and Family Planning Research Center, Indonesia Medical Education and Research Institute (IMERI), Faculty of Medicine, Universitas Indonesia, Jakarta, 10430, Indonesia 4 Department of Community Medicine, Faculty of Medicine, Universitas Indonesia, Jakarta, Indonesia Budi Wiweko Roles: Conceptualization, Funding Acquisition, Supervision, Validation, Visualization, Writing – Original Draft Preparation Yassin Yanuar Mohammad Roles: Conceptualization, Data Curation, Supervision, Validation Naylah Muna Roles: Investigation, Methodology, Project Administration, Resources Kresna Mutia Roles: Formal Analysis, Investigation, Methodology, Resources Julianto Witjaksono Roles: Investigation, Supervision, Validation, Writing – Review & Editing Nuri Purwito Adi Roles: Data Curation, Investigation, Supervision, Validation Mila Maidarti Roles: Investigation, Supervision, Validation Achmad Kemal Harzif Roles: Investigation, Supervision, Validation Gita Pratama Roles: Investigation, Supervision, Validation Kanadi Sumapraja Roles: Investigation, Supervision, Validation R. Muharam Roles: Investigation, Supervision, Validation Andon Hestiantoro Roles: Investigation, Supervision, Validation Competing interests No competing interests were disclosed. Grant information Financial support research grant from University of Indonesia—Dr Cipto Mangunkusumo General Hospital, Jakarta and Indonesia. Article Versions (1) version 1 Published: 23 Jan 2019, 8:93 https://doi.org/10.12688/f1000research.17058.1 Copyright © 2019 Wiweko B et al . This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Download Export To Sciwheel Bibtex EndNote ProCite Ref. Manager (RIS) Sente metrics Views Downloads F1000Research - - PubMed Central info_outline Data from PMC are received and updated monthly. - - Citations open_in_new 0 open_in_new 0 open_in_new SEE MORE DETAILS CITE how to cite this article Wiweko B, Mohammad YY, Muna N et al. A high dose of total recombinant FSH suppresses granulosa cell apoptosis and maintains oocyte quality in endometriosis: A cross-sectional study [version 1; peer review: 1 not approved] . F1000Research 2019, 8 :93 ( https://doi.org/10.12688/f1000research.17058.1 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS track receive updates on this article Track an article to receive email alerts on any updates to this article. TRACK THIS ARTICLE Share Peer review discontinued Peer review at F1000Research is author-driven. Currently no reviewers are being invited. What does this mean? Version 1 VERSION 1 PUBLISHED 23 Jan 2019 Views 0 Cite How to cite this report: Tzeng Cr. Reviewer Report For: A high dose of total recombinant FSH suppresses granulosa cell apoptosis and maintains oocyte quality in endometriosis: A cross-sectional study [version 1; peer review: 1 not approved] . F1000Research 2019, 8 :93 ( https://doi.org/10.5256/f1000research.18648.r48952 ) The direct URL for this report is: https://f1000research.com/articles/8-93/v1#referee-response-48952 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 27 Jun 2019 Chii-ruey Tzeng , College of Medicine, Taipei Medical University Hospital, Taipei City, 110, Taiwan Not Approved VIEWS 0 https://doi.org/10.5256/f1000research.18648.r48952 The manuscript entitled “A high dose of total recombinant FSH suppresses granulosa cell apoptosis and maintains oocyte quality in endometriosis: A cross-sectional study” - this study was conducted in 15 patients with endometriosis and 15 control patients without endometriosis. The ... Continue reading READ ALL The manuscript entitled “A high dose of total recombinant FSH suppresses granulosa cell apoptosis and maintains oocyte quality in endometriosis: A cross-sectional study” - this study was conducted in 15 patients with endometriosis and 15 control patients without endometriosis. The draft is oversimplified with very preliminary results, and most data were published elsewhere. This study has a lack of novelty. The sample size was too small to interpret the results with a proper power. The sample size estimation to get a proper power should be performed before conduction of the study. Since the sample size is small, the baseline characteristics of patients with endometriosis should be described more clearly, such as BMI, duration of infertility, primary or secondary infertility, baseline FSH/LH/E2/P4, antral follicle count, AMH, or the revised American Fertility Society (rAFS) score, etc. Such information is basic and important. The stage of endometriosis could also be a confounding factor to affect the results. The size of endometriosis of ovary, unilateral or bilateral should also be mentioned. The title is interesting. However, their data didn’t support their title. The gene expression of BAX and BCL-2 is only an association in patients with endometriosis. There was no ex-vivo functional assay, such as comparing the apoptosis activity in granulosa cells from patients with endometriosis under different doses of recombinant FSH, to support the title of manuscript. Thereafter, the title should be considered to be rewritten. The conclusion section in the abstract should be rewritten. It was loosely organized and did not incorporate the title of this manuscript. Whether this was a retrospective or prospective study according to the statement in the methods section could not be determined clearly. Please describe it clearly. What are the diagnosis criteria of endometriosis in this manuscript, especially for clinical examination mentioned in the methods section? Besides, the grade of endometriosis should be illustrated. The authors collected follicular fluid during ovum pickup, but we did not see any data from the analysis of follicular fluid. Please describe the protocol of controlled ovarian hyperstimulation more clearly, including the medications used for COH, the method(s) of insemination, etc. It was not proper to interpret the data from two small groups as normal distribution. The goal of this study is not clear. One can not be sure if the authors tried to compare the results from endometriosis and non-endometriosis, or if they wanted to compare the dose effect of recombinant FSH in patients with endometriosis. Please make it more obvious. The basic characteristics of patients should be more detailed, including AMH and/or AFC, COH protocol, COH duration, medication for triggering, maximal E2 level, etc. In Table 4, the mean value of maturation index in the non-endo group is 1, but the range of maturation index is 0.25-1.00. Is the mean value correct? The results of this manuscript were different from previous studies, but the authors did not explain the possible reason for the different findings in the discussion section. They published similar studies in 2017. This manuscript is very similar to their previous studies. Thereafter, there were no new insights from this draft. Is the work clearly and accurately presented and does it cite the current literature? Partly Is the study design appropriate and is the work technically sound? No Are sufficient details of methods and analysis provided to allow replication by others? No If applicable, is the statistical analysis and its interpretation appropriate? Partly Are all the source data underlying the results available to ensure full reproducibility? Partly Are the conclusions drawn adequately supported by the results? No Competing Interests: No competing interests were disclosed. Reviewer Expertise: Endometriosis in ART I confirm that I have read this submission and believe that I have an appropriate level of expertise to state that I do not consider it to be of an acceptable scientific standard, for reasons outlined above. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Tzeng Cr. Reviewer Report For: A high dose of total recombinant FSH suppresses granulosa cell apoptosis and maintains oocyte quality in endometriosis: A cross-sectional study [version 1; peer review: 1 not approved] . F1000Research 2019, 8 :93 ( https://doi.org/10.5256/f1000research.18648.r48952 ) The direct URL for this report is: https://f1000research.com/articles/8-93/v1#referee-response-48952 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Respond or Comment COMMENT ON THIS REPORT Comments on this article Comments (0) Version 1 VERSION 1 PUBLISHED 23 Jan 2019 ADD YOUR COMMENT Comment keyboard_arrow_left keyboard_arrow_right Peer review discontinued Peer review at F1000Research is author-driven. Currently no reviewers are being invited. What does this mean? Reviewer Status info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Reviewer Reports Invited Reviewers 1 Version 1 23 Jan 19 read Chii-ruey Tzeng , Taipei Medical University Hospital, Taipei City, Taiwan Comments on this article All Comments (0) Add a comment Sign up for content alerts Sign Up You are now signed up to receive this alert Browse by related subjects keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2019 Tzeng C. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 27 Jun 2019 | for Version 1 Chii-ruey Tzeng , College of Medicine, Taipei Medical University Hospital, Taipei City, 110, Taiwan 0 Views copyright © 2019 Tzeng C. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Not Approved info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions The manuscript entitled “A high dose of total recombinant FSH suppresses granulosa cell apoptosis and maintains oocyte quality in endometriosis: A cross-sectional study” - this study was conducted in 15 patients with endometriosis and 15 control patients without endometriosis. The draft is oversimplified with very preliminary results, and most data were published elsewhere. This study has a lack of novelty. The sample size was too small to interpret the results with a proper power. The sample size estimation to get a proper power should be performed before conduction of the study. Since the sample size is small, the baseline characteristics of patients with endometriosis should be described more clearly, such as BMI, duration of infertility, primary or secondary infertility, baseline FSH/LH/E2/P4, antral follicle count, AMH, or the revised American Fertility Society (rAFS) score, etc. Such information is basic and important. The stage of endometriosis could also be a confounding factor to affect the results. The size of endometriosis of ovary, unilateral or bilateral should also be mentioned. The title is interesting. However, their data didn’t support their title. The gene expression of BAX and BCL-2 is only an association in patients with endometriosis. There was no ex-vivo functional assay, such as comparing the apoptosis activity in granulosa cells from patients with endometriosis under different doses of recombinant FSH, to support the title of manuscript. Thereafter, the title should be considered to be rewritten. The conclusion section in the abstract should be rewritten. It was loosely organized and did not incorporate the title of this manuscript. Whether this was a retrospective or prospective study according to the statement in the methods section could not be determined clearly. Please describe it clearly. What are the diagnosis criteria of endometriosis in this manuscript, especially for clinical examination mentioned in the methods section? Besides, the grade of endometriosis should be illustrated. The authors collected follicular fluid during ovum pickup, but we did not see any data from the analysis of follicular fluid. Please describe the protocol of controlled ovarian hyperstimulation more clearly, including the medications used for COH, the method(s) of insemination, etc. It was not proper to interpret the data from two small groups as normal distribution. The goal of this study is not clear. One can not be sure if the authors tried to compare the results from endometriosis and non-endometriosis, or if they wanted to compare the dose effect of recombinant FSH in patients with endometriosis. Please make it more obvious. The basic characteristics of patients should be more detailed, including AMH and/or AFC, COH protocol, COH duration, medication for triggering, maximal E2 level, etc. In Table 4, the mean value of maturation index in the non-endo group is 1, but the range of maturation index is 0.25-1.00. Is the mean value correct? The results of this manuscript were different from previous studies, but the authors did not explain the possible reason for the different findings in the discussion section. They published similar studies in 2017. This manuscript is very similar to their previous studies. Thereafter, there were no new insights from this draft. Is the work clearly and accurately presented and does it cite the current literature? Partly Is the study design appropriate and is the work technically sound? No Are sufficient details of methods and analysis provided to allow replication by others? No If applicable, is the statistical analysis and its interpretation appropriate? Partly Are all the source data underlying the results available to ensure full reproducibility? Partly Are the conclusions drawn adequately supported by the results? No Competing Interests No competing interests were disclosed. Reviewer Expertise Endometriosis in ART I confirm that I have read this submission and believe that I have an appropriate level of expertise to state that I do not consider it to be of an acceptable scientific standard, for reasons outlined above. reply Respond to this report Responses (0) Tzeng Cr. Peer Review Report For: A high dose of total recombinant FSH suppresses granulosa cell apoptosis and maintains oocyte quality in endometriosis: A cross-sectional study [version 1; peer review: 1 not approved] . F1000Research 2019, 8 :93 ( https://doi.org/10.5256/f1000research.18648.r48952) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/8-93/v1#referee-response-48952 Alongside their report, reviewers assign a status to the article: Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions Adjust parameters to alter display View on desktop for interactive features Includes Interactive Elements View on desktop for interactive features Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Stay Updated Sign up for content alerts and receive a weekly or monthly email with all newly published articles Register with F1000Research Already registered? Sign in Not now, thanks close PLEASE NOTE If you are an AUTHOR of this article, please check that you signed in with the account associated with this article otherwise we cannot automatically identify your role as an author and your comment will be labelled as a “User Comment”. If you are a REVIEWER of this article, please check that you have signed in with the account associated with this article and then go to your account to submit your report, please do not post your review here. If you do not have access to your original account, please contact us . All commenters must hold a formal affiliation as per our Policies . The information that you give us will be displayed next to your comment. User comments must be in English, comprehensible and relevant to the article under discussion. We reserve the right to remove any comments that we consider to be inappropriate, offensive or otherwise in breach of the User Comment Terms and Conditions . Commenters must not use a comment for personal attacks. When criticisms of the article are based on unpublished data, the data should be made available. I accept the User Comment Terms and Conditions Please confirm that you accept the User Comment Terms and Conditions. Affiliation ✕ refresh Please enter your institution. Note: To add your institution or organisation, start typing the name and then select the correct name from the list. Where applicable, the name will appear in both the original language and in English. Do not paste in the name. If the name does not appear in the drop-down list, we will display the information you have entered. ✕ refresh Country/Region * USA UK Canada China France Germany Afghanistan Aland Islands Albania Algeria American Samoa Andorra Angola Anguilla Antarctica Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Bahamas Bahrain Bangladesh Barbados Belarus Belgium Belize Benin Bermuda Bhutan Bolivia Bosnia and Herzegovina Botswana Bouvet Island Brazil British Indian Ocean Territory British Virgin Islands Brunei Bulgaria Burkina Faso Burundi Cambodia Cameroon Canada Cape Verde Cayman Islands Central African Republic Chad Chile China Christmas Island Cocos (Keeling) Islands Colombia Comoros Congo Cook Islands Costa Rica Cote d'Ivoire Croatia Cuba Cyprus Czech Republic Democratic Republic of the Congo Denmark Djibouti Dominica Dominican Republic Ecuador Egypt El Salvador Equatorial Guinea Eritrea Estonia Ethiopia Falkland Islands Faroe Islands Federated States of Micronesia Fiji Finland France French Guiana French Polynesia French Southern Territories Gabon Georgia Germany Ghana Gibraltar Greece Greenland Grenada Guadeloupe Guam Guatemala Guernsey Guinea Guinea-Bissau Guyana Haiti Heard Island and Mcdonald Islands Holy See (Vatican City State) Honduras Hong Kong Hungary Iceland India Indonesia Iran Iraq Ireland Israel Italy Jamaica Japan Jersey Jordan Kazakhstan Kenya Kiribati Kosovo (Serbia and Montenegro) Kuwait Kyrgyzstan Lao People's Democratic Republic Latvia Lebanon Lesotho Liberia Libya Liechtenstein Lithuania Luxembourg Macao Madagascar Malawi Malaysia Maldives Mali Malta Marshall Islands Martinique Mauritania Mauritius Mayotte Mexico Minor Outlying Islands of the United States Moldova Monaco Mongolia Montenegro Montserrat Morocco Mozambique Myanmar Namibia Nauru Nepal Netherlands Antilles New Caledonia New Zealand Nicaragua Niger Nigeria Niue Norfolk Island North Korea North Macedonia Northern Mariana Islands Norway Oman Pakistan Palau Palestinian Territory Panama Papua New Guinea Paraguay Peru Philippines Pitcairn Poland Portugal Puerto Rico Qatar Reunion Romania Russian Federation Rwanda Saint Helena Saint Kitts and Nevis Saint Lucia Saint Pierre and Miquelon Saint Vincent and the Grenadines Samoa San Marino Sao Tome and Principe Saudi Arabia Senegal Serbia Seychelles Sierra Leone Singapore Slovakia Slovenia Solomon Islands Somalia South Africa South Georgia and the South Sandwich Is South Korea South Sudan Spain Sri Lanka Sudan Suriname Svalbard and Jan Mayen Swaziland Sweden Switzerland Syria Taiwan Tajikistan Tanzania Thailand The Gambia The Netherlands Timor-Leste Togo Tokelau Tonga Trinidad and Tobago Tunisia Turkey Turkmenistan Turks and Caicos Islands Tuvalu UK USA Uganda Ukraine United Arab Emirates United States Virgin Islands Uruguay Uzbekistan Vanuatu Venezuela Vietnam Wallis and Futuna West Bank and Gaza Strip Western Sahara Yemen Zambia Zimbabwe Please select your country/region. You must enter a comment. Competing Interests Please disclose any competing interests that might be construed to influence your judgment of the article's or peer review report's validity or importance. Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Please state your competing interests The comment has been saved. An error has occurred. Please try again. Cancel Post var lTitle = "A high dose of total recombinant FSH suppresses...".replace("'", ''); var linkedInUrl = "http://www.linkedin.com/shareArticle?url=https://f1000research.com/articles/8-93/v1" + "&title=" + encodeURIComponent(lTitle) + "&summary=" + encodeURIComponent('Read the article by '); var deliciousUrl = "https://del.icio.us/post?url=https://f1000research.com/articles/8-93/v1&title=" + encodeURIComponent(lTitle); var redditUrl = "http://reddit.com/submit?url=https://f1000research.com/articles/8-93/v1" + "&title=" + encodeURIComponent(lTitle); linkedInUrl += encodeURIComponent('Wiweko B et al.'); var offsetTop = /chrome/i.test( navigator.userAgent ) ? 4 : -10; var addthis_config = { ui_offset_top: offsetTop, services_compact : "facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com", services_expanded : "facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com", services_custom : [ { name: "LinkedIn", url: linkedInUrl, icon:"/img/icon/at_linkedin.svg" }, { name: "Mendeley", url: "http://www.mendeley.com/import/?url=https://f1000research.com/articles/8-93/v1/mendeley", icon:"/img/icon/at_mendeley.svg" }, { name: "Reddit", url: redditUrl, icon:"/img/icon/at_reddit.svg" }, ] }; var addthis_share = { url: "https://f1000research.com/articles/8-93", templates : { twitter : "A high dose of total recombinant FSH suppresses granulosa cell.... Wiweko B et al., published by " + "@F1000Research" + ", https://f1000research.com/articles/8-93/v1" } }; if (typeof(addthis) != "undefined"){ addthis.addEventListener('addthis.ready', checkCount); addthis.addEventListener('addthis.menu.share', checkCount); } $(".f1r-shares-twitter").attr("href", "https://twitter.com/intent/tweet?text=" + addthis_share.templates.twitter); $(".f1r-shares-facebook").attr("href", "https://www.facebook.com/sharer/sharer.php?u=" + addthis_share.url); $(".f1r-shares-linkedin").attr("href", addthis_config.services_custom[0].url); $(".f1r-shares-reddit").attr("href", addthis_config.services_custom[2].url); $(".f1r-shares-mendelay").attr("href", addthis_config.services_custom[1].url); function checkCount(){ setTimeout(function(){ $(".addthis_button_expanded").each(function(){ var count = $(this).text(); if (count !== "" && count != "0") $(this).removeClass("is-hidden"); else $(this).addClass("is-hidden"); }); }, 1000); } close How to cite this report {{reportCitation}} Cancel Copy Citation Details $(function(){R.ui.buttonDropdowns('.dropdown-for-downloads');}); $(function(){R.ui.toolbarDropdowns('.toolbar-dropdown-for-downloads');}); $.get("/articles/acj/17058/18648") new F1000.Clipboard(); new F1000.ThesaurusTermsDisplay("articles", "article", "18648"); $(document).ready(function() { $( "#frame1" ).on('load', function() { var mydiv = $(this).contents().find("div"); var h = mydiv.height(); console.log(h) }); var tooltipLivingFigure = jQuery(".interactive-living-figure-label .icon-more-info"), titleLivingFigure = tooltipLivingFigure.attr("title"); tooltipLivingFigure.simpletip({ fixed: true, position: ["-115", "30"], baseClass: 'small-tooltip', content:titleLivingFigure + " " }); tooltipLivingFigure.removeAttr("title"); $("body").on("click", ".cite-living-figure", function(e) { e.preventDefault(); var ref = $(this).attr("data-ref"); $(this).closest(".living-figure-list-container").find("#" + ref).fadeIn(200); }); $("body").on("click", ".close-cite-living-figure", function(e) { e.preventDefault(); $(this).closest(".popup-window-wrapper").fadeOut(200); }); $(document).on("mouseup", function(e) { var metricsContainer = $(".article-metrics-popover-wrapper"); if (!metricsContainer.is(e.target) && metricsContainer.has(e.target).length === 0) { $(".article-metrics-close-button").click(); } }); var articleId = $('#articleId').val(); if($("#main-article-count-box").attachArticleMetrics) { $("#main-article-count-box").attachArticleMetrics(articleId, { articleMetricsView: true }); } }); var figshareWidget = $(".new_figshare_widget"); if (figshareWidget.length > 0) { window.figshare.load("f1000", function(Widget) { // Select a tag/tags defined in your page. In this tag we will place the widget. _.map(figshareWidget, function(el){ var widget = new Widget({ articleId: $(el).attr("figshare_articleId") //height:300 // this is the height of the viewer part. [Default: 550] }); widget.initialize(); // initialize the widget widget.mount(el); // mount it in a tag that's on your page // this will save the widget on the global scope for later use from // your JS scripts. This line is optional. //window.widget = widget; }); }); } close Error Close Add Reset F1000.MICROSERVICES.AFFILIATION = ''; $(document).ready(function () { $('.js-affiliations-form').each((index, form) => { new AffiliationForm({ formId: form.id, institutionErrorSelector: '.comment-enter-institution', departmentErrorSelector: '.comment-enter-department', placeSelector: '.js-add-comment-place', stateSelector: '.js-add-comment-state', zipCodeSelector: '.js-add-comment-zipcode', countrySelector: '.js-add-comment-country', countryErrorSelector: '.comment-enter-country', }); }); }); $(document).ready(function () { var reportIds = { "51843": 0, "44419": 0, "44420": 0, "44421": 0, "43539": 0, "43540": 0, "43541": 0, "43542": 0, "47138": 0, "47139": 0, "47140": 0, "47141": 0, "47144": 0, "48173": 0, "48949": 0, "48950": 0, "46007": 0, "48951": 0, "48952": 20, "48953": 0, "48057": 0, "48058": 0, "48059": 0, "49851": 0, "49852": 0, "50749": 0, "49853": 0, "49854": 0, "48333": 0, "49871": 0, "48469": 0, "47581": 0, "47582": 0, "45407": 0, "47583": 0, "45408": 0, "47584": 0, "47585": 0, "45409": 0, "44899": 0, "44900": 0, "46180": 0, "44004": 0, "46181": 0, "46182": 0, "46183": 0, "46184": 0, "46703": 0, "54129": 0, "49393": 0, "49394": 0, "54130": 0, "54131": 0, "49395": 0, "54132": 0, "49396": 0, "49397": 0, "54133": 0, }; $(".referee-response-container,.js-referee-report").each(function(index, el) { var reportId = $(el).attr("data-reportid"), reportCount = reportIds[reportId] || 0; $(el).find(".comments-count-container,.js-referee-report-views").html(reportCount); }); var uuidInput = $("#article_uuid"), oldUUId = uuidInput.val(), newUUId = "0fab1f55-17f1-4488-9840-ec8258fcff98"; uuidInput.val(newUUId); $("a[href*='article_uuid=']").each(function(index, el) { var newHref = $(el).attr("href").replace(oldUUId, newUUId); $(el).attr("href", newHref); }); }); An innovative open access publishing platform offering rapid publication and open peer review, whilst supporting data deposition and sharing. Browse Gateways Collections How it Works Contact For Developers Cookie Notice Privacy Notice RSS Submit Your Research Follow us © 2012-2026 F1000 Research Ltd. ISSN 2046-1402 | Legal | Partner of Research4Life • CrossRef • ORCID • FAIRSharing R.templateTests.simpleTemplate = R.template(' $text $text $text $text $text '); R.templateTests.runTests(); var F1000platform = new F1000.Platform({ name: "f1000research", displayName: "F1000Research", hostName: "f1000research.com", id: "1", editorialEmail: "[email protected]", infoEmail: "[email protected]", usePmcStats: true }); $(function(){R.ui.dropdowns('.dropdown-for-authors, .dropdown-for-about, .dropdown-for-myresearch');}); // $(function(){R.ui.dropdowns('.dropdown-for-referees');}); $(document).ready(function () { if ($(".cookie-warning").is(":visible")) { $(".sticky").css("margin-bottom", "35px"); $(".devices").addClass("devices-and-cookie-warning"); } $(".cookie-warning .close-button").click(function (e) { $(".devices").removeClass("devices-and-cookie-warning"); $(".sticky").css("margin-bottom", "0"); }); $("#tweeter-feed .tweet-message").each(function (i, message) { var self = $(message); self.html(linkify(self.html())); }); $(".partner").on("mouseenter mouseleave", function() { $(this).find(".gray-scale, .colour").toggleClass("is-hidden"); }); }); Sign In Remember me Forgotten your password? Sign In Cancel Email or password not correct. Please try again Please wait... $(function(){ // Note: All the setup needs to run against a name attribute and *not* the id due the clonish // nature of facebox... $("a[id=googleSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("GOOGLE"); $("form[id=oAuthForm]").submit(); }); $("a[id=facebookSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("FACEBOOK"); $("form[id=oAuthForm]").submit(); }); $("a[id=orcidSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("ORCID"); $("form[id=oAuthForm]").submit(); }); }); If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password. The email address should be the one you originally registered with F1000. Email address not valid, please try again You registered with F1000 via Google, so we cannot reset your password. To sign in, please click here . If you still need help with your Google account password, please click here . You registered with F1000 via Facebook, so we cannot reset your password. To sign in, please click here . If you still need help with your Facebook account password, please click here . Code not correct, please try again Reset password Cancel Email us for further assistance. Server error, please try again. If your email address is registered with us, we will email you instructions to reset your password. If you think you should have received this email but it has not arrived, please check your spam filters and/or contact for further assistance. Please wait... Register $(document).ready(function () { signIn.createSignInAsRow($("#sign-in-form-gfb-popup")); $(".target-field").each(function () { var uris = $(this).val().split("/"); if (uris.pop() === "login") { $(this).val(uris.toString().replace(",","/")); } }); });