A SNP affects Wnt4 expression in endometrial stroma, with antagonistic implications for pregnancy, endometriosis and reproductive cancers

A SNP affects Wnt4 expression in endometrial stroma, with antagonistic implications for pregnancy, endometriosis and reproductive cancers | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results A SNP affects Wnt4 expression in endometrial stroma, with antagonistic implications for pregnancy, endometriosis and reproductive cancers View ORCID Profile Mihaela Pavlicev , View ORCID Profile Caitlin E. McDonough-Goldstein , Andreja Moset Zupan , Lisa Muglia , Yueh-Chiang Hu , Fansheng Kong , View ORCID Profile Nagendra Monangi , Gülay Dagdas , View ORCID Profile Nina Zupancic , View ORCID Profile Jamie Marziaz , View ORCID Profile Debora Sinner , Ge Zhang , View ORCID Profile Günter Wagner , View ORCID Profile Louis Muglia doi: https://doi.org/10.1101/2022.10.25.513653 Mihaela Pavlicev 1 Cincinnati Children’s Hospital Medical Center , Cincinnati, OH 2 Department of Evolutionary Biology, University of Vienna , Vienna, Austria Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Mihaela Pavlicev For correspondence: mihaela.pavlicev{at}univie.ac.at Caitlin E. McDonough-Goldstein 2 Department of Evolutionary Biology, University of Vienna , Vienna, Austria Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Caitlin E. McDonough-Goldstein Andreja Moset Zupan 1 Cincinnati Children’s Hospital Medical Center , Cincinnati, OH Find this author on Google Scholar Find this author on PubMed Search for this author on this site Lisa Muglia 1 Cincinnati Children’s Hospital Medical Center , Cincinnati, OH Find this author on Google Scholar Find this author on PubMed Search for this author on this site Yueh-Chiang Hu 1 Cincinnati Children’s Hospital Medical Center , Cincinnati, OH Find this author on Google Scholar Find this author on PubMed Search for this author on this site Fansheng Kong 1 Cincinnati Children’s Hospital Medical Center , Cincinnati, OH Find this author on Google Scholar Find this author on PubMed Search for this author on this site Nagendra Monangi 1 Cincinnati Children’s Hospital Medical Center , Cincinnati, OH 3 University of Cincinnati College of Medicine , Cincinnati OH USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Nagendra Monangi Gülay Dagdas 2 Department of Evolutionary Biology, University of Vienna , Vienna, Austria Find this author on Google Scholar Find this author on PubMed Search for this author on this site Nina Zupancic 3 University of Cincinnati College of Medicine , Cincinnati OH USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Nina Zupancic Jamie Marziaz 5 Department of Ecology and Evolutionary Biology, Yale University , New Haven, CT, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Jamie Marziaz Debora Sinner 1 Cincinnati Children’s Hospital Medical Center , Cincinnati, OH 3 University of Cincinnati College of Medicine , Cincinnati OH USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Debora Sinner Ge Zhang 1 Cincinnati Children’s Hospital Medical Center , Cincinnati, OH Find this author on Google Scholar Find this author on PubMed Search for this author on this site Günter Wagner 5 Department of Ecology and Evolutionary Biology, Yale University , New Haven, CT, USA 6 Yale Systems Biology Institute, Yale University , West Haven, CT, USA 7 Department of Obstetrics, Gynecology and Reproductive Sciences, Yale School of Medicine , New Haven, CT, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Günter Wagner Louis Muglia 1 Cincinnati Children’s Hospital Medical Center , Cincinnati, OH 8 Burroughs Wellcome Fund, Research Triangle Park , NC, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Louis Muglia Abstract Full Text Info/History Metrics Supplementary material Preview PDF Abstract The common human single nucleotide polymorphism rs3820282 is associated with multiple phenotypes ranging from gestational length to likelihood of endometriosis and ovarian cancer and can thus serve as a paradigm for a highly pleiotropic genetic variant. Pleiotropy makes it challenging to assign specific causal roles to particular genetic variants. Deleterious mutations in multifunctional genes may cause either the co-occurrence of multiple disorders in the same individuals (i.e., syndromes), or be repeatedly associated with a variety of disorders in a population. Moreover, the adverse effects can occur in combination with advantages in other traits, maintaining high frequencies of deleterious alleles in the population. To reveal the causal role of this specific SNP, we investigated the molecular mechanisms affected by rs3820282 in mice. We have shown previously that rs3820282 introduces a high affinity estrogen receptor 1 binding site at the Wnt4 locus. Having introduced this nucleotide substitution into the homologous site of the mouse genome by CRISPR/Cas 9 we show that this change causes a specific upregulation of Wnt4 transcription in the endometrial stromal cells during the preovulatory estrogen peak in late proestrus. Transcriptomic analysis of the whole uterus reveals broad systemic effects on uterine gene expression, including downregulation of proliferation and induction of many progesterone-regulated pro-implantation genes. The effect on proliferation is limited to the luminal epithelium, whereas other effects involve the uterine stromal compartment. We suggest that in the uterus, these changes could contribute to increased permissiveness to embryo invasion. Yet in other estrogen-responsive tissues, the same changes potentially lead to decreased resistance to invasion by cancer cells and endometriotic foci. A single molecular effect of rs3820282 on Wnt4 expression may thus underlie the various associated phenotypic effects. Introduction Genome-wide association studies (GWAS) frequently reveal associations between multiple diseases and a polymorphism at the single genomic locus, suggesting pleiotropy 1 – 4 . Disease pleiotropy may originate from either the same molecular mechanism involved in different disease processes or through broader systemic effects of the mutation - such as immune or metabolic disorders - affecting different disease phenotypes. Alternatively, different genetic variants involved in etiologically unconnected diseases could be co-inherited due to genetic linkage 3 . Beyond the mere presence of genetic correlation, recent studies have also addressed the direction of the effects of specific variants on single traits (diseases), i.e., whether they are deleterious or beneficial with respect to different phenotypes. While many pleiotropic variants have congruent fitness effects in all diseases (i.e., the same allele is deleterious in all), studies also commonly find cases of antagonistic pleiotropy 5 , where a variant augments the likelihood of one disorder, while protecting the carrier from another 6 – 9 . Antagonism in pleiotropy is particularly interesting as it may explain the high frequency of some of the apparently deleterious alleles in a population 10 , reflect a biological trade-off that can inform the disease mechanisms, and provide guidance in search of treatment strategies that should be preferred or avoided due to the associated side effects 3 . Deciphering the molecular basis of statistical associations requires determining the exact genomic location of the causal polymorphism, the target gene (most variants are in the regulatory genome), the spatial and temporal context of the mutational effect (i.e., tissue or cell type, stage of development or physiology), the molecular pathway mediating the effect, and the organismal processes mapping the genetic change onto the final phenotype. Information from multiple diseases can facilitate the analysis of the mechanistic basis of mutation effects 11 . In this paper, we present the results of a functional genetic study of one single nucleotide polymorphism (SNP) located in the first intron of Wnt4 (rs3820282) on human chromosome 1 (1p 36.12). The frequency of the alternate allele at rs3820282 (T, with reference allele being C) varies strongly across human populations, ranging from less than 1% in Africa to over 50% in SE Asia 12 . This SNP has been associated with variation in multiple human female reproductive traits. Thereby, the same allele is associated with deleterious as well as protective effects on diseases such as endometriosis 13 – 16 , breast cancer 17 , ovarian epithelial cancer 18 , length of gestation 19 , and leiomyoma 20 – 23 . Specifically, the alternate allele has been associated with higher likelihood of endometriosis, fibroids (leiomyoma), and ovarian epithelial cancer, yet it is also associated with longer gestation and is potentially protective against preterm birth. Rather than focusing on the etiology of any one disease, we focus here on the immediate molecular and cellular mechanisms through which the locus exerts its function, likely mediating different disease contexts. The disease associations of this SNP are consistently related to female reproductive biology, a context in which regulation by estrogen is central. An exceptionally well powered GWAS, in an attempt to understand the genetic basis of preterm birth, found that the alternate allele introduces a potent binding site for estrogen receptor alpha (ESR1) 19 . Moreover, this binding site overlaps with open chromatin in immortalized human endometrial stromal cell line, HESC 24 , in vitro 19 . The information on downstream consequences of mutation is less robust, although this question has been experimentally addressed previously (e.g., 17 , 25 , see discussion). Estrogen responsiveness has been directly implicated in most diseases associated with the genomic region of the rs3820282 allele. Endometriosis has been associated with the incomplete transition of the endometrium from the estrogen-dominated proliferative phase to the progesterone-dominated secretory phase of the estrous cycle, also referred to as progesterone resistance 26 , due to dysregulation in the early secretory phase of many genes mediating progesterone effects. Fine-mapping studies of the region to identify the causal SNP in the context of endometriosis have confirmed rs3820282 as a prioritized candidate 16 , 27 . Estrogen also enhances the growth of uterine leiomyoma (fibroids), a common benign tumor of the myometrial smooth muscle 28 . A recent GWAS in a large Icelandic cohort found associations of uterine fibroids with alleles at two sets of loci: loci shared with a wide range of cancers, and loci shared with various reproductive abnormalities, specifically implicating involvement of estrogen signaling, among them rs3820282 23 . Increased estrogen and androgen, as well as hyperactivity of stroma have further been proposed to contribute to the pathogenicity of ovarian cancer 29 and recent association studies linked both ovarian as well as breast cancers to the region of the focal locus 23 . This genomic region of interest is conserved across placental mammals ( Fig. 1 ), likely due to the key roles of Wnt in vertebrate development and physiology 30 . The mammalian reference genomes (including C57B/6J mouse line, used in this study as wild type, WT) carry what in the human population is the major allele. Many aspects of female reproductive biology are also conserved between mice and humans. Therefore, we expect that the molecular effect of this mutation in mice will be informative for studying its effect in humans. Download figure Open in new tab Figure 1. Alignment of the noncoding region around rs3820282 across mammalian genomes (UCSC genome browser). A) overall conservation of the Wnt4 region. B) The binding site motif for ESR1 on top summarizes the sequence variation across the functional binding sites.The position of rs3820282 is shown in yellow in A and B, and changes the human nucleotide from C to T. To determine the molecular mechanisms affected by the SNP rs3820282, we generated CRISPR/Cas9-modified transgenic (TG) mouse line, homozygous for what is the human alternate allele, and compared it to the homozygous WT mouse line of the same background. Genome-editing circumvents the effect of linkage between the neighboring SNPs, due to which causal mutations are hard to distinguish from the linked ones in the human population. This method aids in the feasibility of experimentation and allows us to avoid the heterogeneity of the genetic background between individuals, which can hinder the attribution of effects to any one polymorphism. The context-dependent effects of a polymorphism is a relevant aspect that must be addressed separately. Using this transgenic mouse line we reveal that the mutation enhances the periodic estrogen-induced uterine preparation for implantation. We propose that this effect, when appearing in other estrogen-responsive tissues, may similarly enhance the permissibility of tissues to endometriosis and metastasis. Results We used gene editing to replace the single nucleotide mouse wild type allele with the human alternate allele at the location in the mouse genome corresponding to rs3820282 in humans, using CRISPR/Cas9 (see Methods for detail). The position rs3820282 and its flanking sequences are 98% conserved between the human and mouse reference genomes ( Fig. 1 ). Live born pups were genotyped by PCR and then further confirmed by Sanger sequencing. Two out of three lines in which the overall region had been modified, had the specific one-nucleotide substitution we aimed for. While we focus on only one of the two genome-edited mouse lines in this work for the full range of analyses, both show the same relevant phenotype described below: the effect on Wnt4 expression in proestrus ( Fig. 1 , Fig. S1 ). We note that we did not observe differences in gestation length (WT: 19.3 ± 0.06 days, N = 7, KI-1: 19.2 ± 0.07 days, N = 5, KI-2: 19.2 ± 0.04 days, N = 7, P = 0.33; Wilcoxon-Mann-Whitney rank sum test) or litter size (WT: 8.4 ± 0.65 pups, N = 7, KI-1: 7.8 ± 0.58 pups, N = 5, KI-2: 8.2 ± 0.56 days, N = 7, P = 0.66) in either transgenic line ( Fig. S2 ). Transgenic allele at the rs3820282 upregulates uterine Wnt4 mRNA expression in late proestrus Given the previous finding that rs3820282 SNP is enhancing ESR1 binding 19 , we investigated which genes may be regulated by this novel binding site. We focused on the uterine tissue, as previously reported associated reproductive phenotypes involved the uterus. We first investigated the expression of two genes adjacent to the SNP, Cdc42 and Wnt4 . We analyzed how the SNP affected the uterus across multiple stages of the ovarian cycle and pregnancy, specifically proestrus, estrus, and early pregnancy (7.5 days post conception, dpc). The mouse uterus undergoes important changes in preparation for implantation even prior to mating, thus pregnancy success can be influenced both during the pregnancy, as well as pre-pregnancy, during the stages preceding fertilization and implantation. We found no effect on the Cdc42 gene adjacent to the polymorphism (proestrus: N = (11 TG, 4 WT), P = 0.34; estrus: N = (6 TG, 2 WT); Wilcoxon-Mann-Whitney rank sum test, Fig. 2 ).On the other hand, the two genotypes differed only in the uterine expression of Wnt4 during proestrus, with a 1.48 log2 fold increase in Wnt4 expression in the transgenic compared to the wild type (N = (14 TG, 8 WT), P = 0.002). No significant difference between the genotypes was observed in Wnt4 mRNA expression in either estrus (N = (6 TG, 5 WT), P = 0.08, Fig. 2 ) or early pregnancy (7.5 dpc, N = (3 TG, 3 WT), P = 0.70, Fig. S3 ). Differences in Wnt4 expression were also not observed in the ovary at either proestrus (N = (3 TG, 5 WT), P = 0.57, Fig. S4 ) or estrus (N = (5 TG, 3 WT), P = 0.79, Fig. S4 ) Download figure Open in new tab Figure 2. rs3820282 transgenic SNP influences expression of Wnt4 in the uterus (A) The mouse model of the rs3820282 transgenic (TG) SNP had significantly higher levels of Wnt4 in the proestrus phase of the ovarian cycle (p = 0.002) compared to the wildtype (WT). Although differences in expression were not significant in the estrus phase (p = 0.08). (B) Other adjacent genes to the SNP such as CDC42 did not differ between genotypes (p > 0.2). Endometrial stromal fibroblast is the cell type affected by the transgenic allele To determine the uterine cell type in which Wnt4 is upregulated in the transgenic line, we performed in situ hybridization using RNAscope 31 on proestrus uteri. We found that Wnt4 is expressed in luminal and glandular epithelium in both genotypes. In contrast, in the transgenic line Wnt4 is also strongly expressed in the stromal cells specifically underneath the luminal epithelium ( Fig. 3A ). To further solidify this finding, we isolated primary endometrial stromal fibroblasts during late proestrus from transgenic and wild type mice and measured the respective expression levels of Wnt4 by qPCR. Primary cells isolated from the transgenic line exhibited a 2.71 log2 fold upregulation of Wnt4 , relative to those of a wild type (N = (5 TG, 6 WT), P = .0004; Fig. 3B ). Stronger upregulation of Wnt4 in the primary endometrial stromal cell culture relative to the bulk uterine transcriptome is consistent with the former being enriched for the affected cell type. Download figure Open in new tab Figure 3. Changes in Wnt4 proestrus expression are concentrated in the uterine stroma. A) Using RNAscope we localized the expression of Wnt4 to the luminal epithelium of both wildtype in transgenic lines during proestrus. Expression was also identified in the stroma for the transgenic line but was not detectable for the wildtype. Luminal epithelia (LE), glandular epithelia (GE), and stroma are indicated. Two biological replicates are shown for each line. Wnt4 is stained a light brown and the nucleus is a light indigo, magnification at 40x. B) The concentration of Wnt4 expression differences in the stroma were confirmed with qPCR of primary endometrial stromal fibroblast cells. Transcriptomic differences suggest the mechanisms affected by the mutation To understand the overall uterine consequences of the mutation, we compared the uterine tissue-transcriptomes of the WT and the homozygous TG mice in proestrus, the only stage which showed changed Wnt4 expression. This approach revealed the systemic modification of the uterine transcriptome due to increased Wnt4 in the individuals carrying the transgenic alleles ( Fig. S5 ). Uterine transcriptomes showed upregulated Wnt4 expression in transgenic individuals (1.8-log2 fold higher expression in the TG strain, adj. P < 0.001), congruent with qPCR results. We detected 142 genes to have significantly changed proestrus uterine expression levels in the TG relative to WT line (adj. P < 0.05; Table S1 in Supplementary material; Fig. 4A ). Of these, five times more genes are upregulated (119) than downregulated (23), a significant enrichment for increased expression (P < 0.001, exact binomial test; Fig. 4B ). In the following, we focus on the major GO groups of genes with changed expression, and their biological roles in the uterus. Their pathogenic potential will be addressed in the discussion. Download figure Open in new tab Figure 4. SNP mediated differential expression in the transgenic proestrus uterus. A) Effect of the SNP on flanking genes, with differences in Wnt4 expression between the wildtype and transgenic lines, but not Cdc42 , were confirmed in the RNAseq analysis. B) Volcano plot showing significance and effect size distribution. Significantly differentially expressed genes (adj. P > 0.05) are in red. Wnt4 is indicated in red and genes associated with proliferation are labeled. Genes that are associated with increased proliferation were found to decrease in expression ( Mki67, Racgap1, Ankle1, Rad51, and Melk ) whereas genes that are associated with the progesterone mediated repression of proliferation increased in expression ( Errfi1, Klf9, Pik3ip1, Klf15, Fgfr2, and Cyp1b 1). C) Heatmap of significantly differentially expressed genes with an absolute log2 fold change > 0.5. Genes with functions of relevance to reproductive phenotypes were among those with the greatest increase in expression. In particular, invasibility ( Fst, Rgs2, Serpine1, and Mfge8 ), decidualization ( Zbtb16) , and glucose utilization ( Hmgcs2, Pdk4, Irs2, Igfbp2, and Galnt15 ). Downregulated genes are enriched from proliferation pathways The significantly downregulated genes showed very clear enrichment in genes related to proliferation, mitosis and DNA damage repair (e.g., Mki67, Racgap1, Tacc3, Ankle1, Rad51, Melk; Fig. 4B ). Specifically, hallmark gene set enrichment 32 was found for processes involving the cell cycle including the G2/M checkpoint, DNA damage repair, and genes associated with mitotic spindle assembly (adjusted p < 0.001; Fig. S6 ; Table S2). In addition, upstream proliferation effectors were among hallmark gene set enrichments in downregulated genes, including targets of proliferation-inducing E2F and Myc transcription factors, unfolded protein (a cellular ER stress response), and Mtorc1 complex. Immunohistochemistry with anti-MKI67 (proliferation marker) antibody showed that the protein expression of MKI67 is limited to the luminal epithelium in both genotypes, and hence the downregulation of proliferation too must be limited to the epithelium ( Fig. 5 ). Relevant to the disease phenotypes associated with the SNP, there is a significant downregulation of Spink12 , the serine protease inhibitor, known to be expressed in various epithelia and regulated by differentiation signals. A related family member Spink13 was shown to be protective against ovarian cancer invasion 33 . Also downregulated is Akr1c19 (mouse ortholog of human AKR1C1 ), the progesterone metabolizing enzyme. Download figure Open in new tab Figure 5. Proliferation marker expressed primarily in the proestrus luminal epithelium. Marker of proliferation, MKI67 is expressed in both genotypes in the proestrus luminal epithelium. Thus, the influence of decreased Mki67 gene expression in the transgenic line is most likely restricted to the epithelium. Magnification at 40x. Upregulated genes are enriched for processes involved in stromal decidualization, invasibility, suppression of epithelial proliferation and aspects of the progesterone response Upregulated genes indicate substantially more complex effects of increased Wnt4 expression than the downregulated genes ( Fig. 4C ). The enriched hallmark gene sets predict upregulation of pathways related to epithelial-mesenchymal transition, myogenesis, hypoxia, coagulation, KRAS-signaling and TNFA signaling via NFKB, among others (adj. P < 0.001; Fig. S6 ; Table S2). These pathways are involved in normal uterine processes, with upregulated genes shown to be crucial for implantation including: decidualization ( Zbtb16, Tcf23, Crebrf ), invasibility of uterus by the trophoblast ( Fst, Rgs2, Integrins), and hemostasis/vascularization (Rgs2, F5, Serpine1, Mfge8 ). In the following we briefly address the reported functions of the most upregulated genes. We observe in the transgenic line the upregulation of many genes previously associated with progesterone increase, such as occurs in both mouse (early pregnancy) and human (early secretory phase), but without observing upregulation of progesterone receptor. In particular, we identify several genes related to modulation of uterine epithelial proliferation, a consequence of progesterone increase ( Fig. 4B ). The most significantly upregulated factor involved is Errfi1 , the Errb feedback inhibitor 1. Errfi1 has been shown to inhibit the action of epidermal growth factors. Accordingly, the ablation of Errfi1 leads to uterine epithelial hyperplasia 34 . In the uterus, Errfi1 was shown to mediate progesterone activity by inhibiting the mitogenic action of Erbb2 (receptor tyrosine kinase) and opposing the estrogen-driven endometrial proliferation in the presence of progesterone 35 . Further upregulated genes, such as Krüppel-like factors Klf15 and, to a lesser extent, Klf9 mediate suppression of epithelial growth upon combined estrogen and progesterone treatment, enhancing the pro-implantation actions of progesterone 36 . Knockout of Klf9 inhibits implantation, thus we reason that its upregulation may positively affect implantation 37 – 39 . Similarly, Pik3ip1 inhibits Pki3-mediated activation of proliferation and is progesterone regulated 40 , 41 . Fgfr2 is another upregulated negative regulator of epithelial proliferation 42 . The enhancement of multiple proliferation inhibitors is consistent with the downregulation of proliferation-enhancing genes and the decrease in proliferation marker Mki67 , whose expression is limited to epithelium. Consistent with progesterone-response-like expression pattern is also the upregulation in transgenic animals of Cyp1b1 , an enzyme metabolizing estrogen. This may contribute to the local metabolism of mitogenic estrogen mediating the antagonistic effects of progesterone and estrogen on proliferation. Several upregulated genes are involved in decidualization, a uterine endometrial transformation that in mice does not normally precede fertilization (but does in humans). Among these is Zbtb16 , a transcriptional repressor involved in cell cycle control, and shown to mediate progesterone receptor-driven decidualization of human endometrial stromal cells 43 . Also upregulated are Tcf23 , a decidualization-associated transcription factor 44 , and Crebrf , a factor involved in regulation of stress response, whose expression is known to increase at implantation site 45 . Among the significantly upregulated genes known for their roles in modulating receptivity and invasibility is Folistatin ( Fst ), whose uterine-specific knockout in mouse reduces the responsiveness of the luminal epithelium to estrogen and progesterone 46 . Similarly, integrins ( Itgb3, Itga8, and associated Lim2 ) have been repeatedly implicated in embryo attachment 47 , 48 , and are also associated with wound healing and vascularization 49 , the epithelial-to-mesenchymal transition (EMT) and stromal invasibility in cancer 50 . Also upregulated in the transgenic mice are the regulators of G-protein signaling, Rgs1 and Rgs2 . These proteins have been linked to regulation of vascular tone in implantation. Rgs2 increases at the implantation sites as stromal cells start to decidualize in mouse, and its downregulation inhibits trophoblast growth in vitro 51 . Further indication of early vaso-activation is the upregulation of genes with endothelial or peri-endothelial expression ( Serpine1 52 , Mfge8 53 ). Notable as well is the increased expression of genes involved in glucose utilization ( Irs2, Igfbp2, Pdk4, Hmgcs2, Slc2A12; Fig. 4C ). Aberrant glucose metabolism has been associated with defects of decidualization and implantation, likely because glucose contributes to protein glycosylation of abundant glycoproteins in the uterus, including those of glandular secretions and also serves as critical nutritional support for developing embryo. Indeed, we found that the transgenic uteri appear to produce higher amounts of polysaccharide-rich glandular secretions ( Fig. 6 ). In accordance with this observation, we note upregulation of Galnt15 , an enzyme catalyzing protein glycosylation, in particular of mucin. Download figure Open in new tab Figure 6. Transgenic line shows higher content of polysaccharides/mucins in proestrus uterine tissue. Periodic acid - Schiff stain of proestrus uterus from wildtype and transgenic lines detects a qualitative increase in the concentration of polysaccharide and mucin contents of the secretions in the lumen, particularly of that associated with the glandular epithelium. Magnification 20x. Wnt4 signals via non-canonical pathway in the proestrus endometrium Given the Wnt4 upregulation, and the observed transcriptional sequences, we asked what Wnt signaling pathway is used. The most prominent Wnt signaling pathway is the canonical pathway involving inhibition of ß-catenin degradation and promoting its translocation into the nucleus, where it acts as transcription factor of several Wnt target genes 30 . Wnt4 is known to signal via canonical as well as several non-canonical pathways in different contexts. We used immunohistochemistry in uterine tissue to examine whether the upregulation of Wnt4 expression coincides with changes in nuclear localization of ß-catenin. We detected no nuclear localization of ß-catenin in the uteri of transgenic or wildtype mice during proestrus or estrus ( Fig. S7A & B ). Consistent with this result, there is no upregulation of the enhancer factor Lef1 or member of the ß-catenin dissociation complex Axin2 which are common targets of ß-catenin signaling 54 ( Fig. S7C ), concluding that Wnt4 likely causes described changes via one of the non-canonical pathways. An upregulation of CamkIIb ( Fig. S7D ) suggests the Ca2+/CamkII pathway may be involved, but the potential downstream mechanisms of Wnt4 activation require further attention. The uteri of genome edited mice manifest increased size during estrus Wnt4 mRNA is expressed at comparable levels in both genotypes during estrus ( Fig. 2 ). However, we do note 41% increase in the uterine cross sectional area in the transgenic animals in estrus phase (P=0.05, N= (5 TG, 4 WT), t-test with heterogeneous variance; Fig. 7 ). As Wnt4 expression is upregulated in transgenic animals in proestrus, we hypothesize that the size change observed in estrus is a downstream consequence of this upregulation. In the face of downregulated luminal epithelial proliferation, this volume increase is likely attributable to increased glandular activity or oedema. Download figure Open in new tab Figure 7. Increase in transgenic uterine size in estrus. Transgenic line showed an enlarged cross-sectional area of the uterine horn in estrus. As gene expression patterns indicated decreased proliferation, particularly in the luminal epithelium, differences in area likely correspond to increased secretion and luminal area along with possible oedema. Overall, the observed proestrus expression profile in transgenic mice suggests that the activation of Wnt4 by estrogen receptor in alternate allele genotype induces gene expression changes highly similar in spectrum to those mediated by progesterone in early pregnancy in mice and human, or in human secretory phase. In particular, we observe the downregulation of epithelial proliferation and upregulation of genes associated with stromal processes: decidualization, adhesion, extracellular matrix modification, invasibility and vascularization, as well as glandular activation. While several genes characteristic for decidualization are upregulated, the pattern doesn’t correspond to full decidualization. These changes precipitate the overall uterine volume increase in transgenic animals. DISCUSSION In this study we report a functional analysis of the SNP rs3820282 that has been associated with multiple disorders of female reproduction and reproductive tissues. We have previously shown that the human alternate allele generates a high affinity binding site for the estrogen receptor alpha 19 . The present study aimed to uncover the immediate consequences of this allele substitution. Having created a transgenic mouse line with the human alternate allele, we took advantage of the natural estrogen dynamics during the mouse ovarian cycle to unravel the spatio-temporal context of mutational effects, and their direct consequences on gene expression. We found that the mutation causes upregulation of Wnt4 in endometrial stromal cells, coinciding with the late proestrus estrogen peak. Importantly, the results demonstrate that the mutation activates uterine Wnt4 expression in response to estrogen, independently of the presence of conceptus. The numerous changes in the downstream uterine gene expression suggest effects on two general processes: the suppression of proliferation in epithelium, and the upregulation of pathways involved with embryo receptivity and the uterine susceptibility to invasion. Transgenic gene expression changes and uterine biology The mammalian uterus undergoes remarkable changes throughout the pregnant as well as nonpregnant cycle, mediated by the fluctuations in the ovarian steroid hormones estrogen and progesterone, and their respective receptors 55 , 56 . The transition from proestrus to estrus for example, is characterized by changes in transcription of a large number of genes, precipitating changes in morphology, tissue remodeling, adhesion and proliferation 57 . Stroma and epithelium react interdependently to changing hormone levels, as had been shown by the requirement of stromal Esr1 for epithelial estrogen action 58 . Uterine Wnt4 expression is estrogen-responsive in wild type mice 59 and correspondingly, there are several Esr1 binding sites in the Wnt4 promoter. The single nucleotide polymorphism rs3820282 investigated here further modulates estrogen responsiveness of Wnt4 in uterine stroma, specifically at the preovulatory estrogen peak in proestrus, thereby enhancing a non-canonical pathway in its target cells. Wnt4 subsequently acts as a downstream effector of progesterone signaling and is thus responsible for some of the effects otherwise associated with progesterone upregulation 60 . Specifically, Franco and coauthors 60 showed that conditional ablation of Wnt4 increased apoptosis during stromal cell decidualization in mice and significantly reduced embryo implantation. Importantly, they found an effect of Wnt4 upregulation on progesterone-regulated genes without upregulation of progesterone 56 receptor, suggesting that Wnt4 mediates the effect of progesterone, consistent with the present results, with the exception that here Wnt4 is regulated in response to estrogen. Implantation is a critical event, hence in species with spontaneous ovarian cyclicity several recurring uterine changes have evolved in preparation for implantation. In most mammals, some uterine changes precede the presence of the conceptus and thus occur also in the nonpregnant cycle (e.g., edema), whereas others require copulation or the presence of conceptus. In humans, the preparatory changes are more extensive and include stromal decidualization, which in almost all non-primate mammals requires the presence of conceptus. Mammalian preimplantation uterine changes include actin cytoskeleton remodeling and reorganization of focal adhesions and junctional complexes in stromal cells, loss of epithelial polarity, changes in apical membrane and increase of glycogen production in luminal epithelium and stroma, as well as changes in vascular permeability and angiogenesis 61 – 64 . As several of these processes are mediated by progesterone, the observation of enhanced pro-implantation signature downstream of Wnt4 expression is plausible. A surprising aspect is that these progesterone-induction-like changes precede the progesterone-dominated luteal phase. In mice, edema and angiogenesis increase during estrus (coinciding with increase in Wnt4 expression), while further uterine remodeling occurs in days following copulation and fertilization, as a functional corpus luteum starts secreting progesterone. The upregulation pattern in a proestrus transgenic mouse therefore suggests an advanced induction of the preimplantation processes, which in absence of the conceptus, is broadly reminiscent of the human condition of spontaneous decidualization in humans. The early expression of Wnt4 may enhance the receptivity by increasing the invasion susceptibility, i.e., invasibility of the uterus for implantation, thus explaining the positive effect of this mutation on human pregnancy outcomes 19 . Comparability to human Predicting the comparability between model organisms and humans requires understanding of the shared, and accounting for the species-specific mechanisms. The mouse and human ovarian cycle and pregnancy have diverged during evolution. While we do not have a full mechanistic understanding of these differences, we know that many aspects of receptivity are conserved across mammals 61 . This is due to a shared evolutionary origin of invasive implantation in the stem lineage of placental mammals 65 – 67 , despite the likely independent origins of mechanisms controlling subsequent gestation length 67 . The presented consequences of Wnt4 upregulation are driven by the dynamics of ovarian preovulatory estrogen peak, which is shared between mouse and human. This speaks for the relevance of the present findings for the human condition. Understanding the downstream effects of a SNP in the mouse uterus may therefore enable prediction of the spatio-temporal contexts in which this SNP exerts its effects on human pregnancy and physiology. Relation to endometriosis and reproductive cancers Our findings provide the most direct mechanistic evidence to date for a link between this particular SNP and reproductive traits. Our results imply a two-pronged effect of the mutation: suppression of proliferation in the epithelium and enhancement of pro-implantation/invasion processes in the stroma. The association of the SNP with cancer and endometriosis may involve one or both of these. We suggest that the reported correlated associations of the mutation with reproductive cancers and endometriosis may be mediated through the second prong: the enhancement of pro-implantation processes, which make stroma more permissive to invasion by embryo but also by cancer and ectopic endometriotic tissue. This suggestion is inspired by the correlation across species between endometrial permissiveness to embryo implantation and vulnerability of peripheral stroma to cancer invasion, where species with more invasive placentation are more prone to invasion by metastases 68 – 71 . Here we hypothesize that this relationship is not only a species-level phenomenon but applies within human populations; individuals with increased uterine embryo invasibility may be more prone to cancer metastasis and endometriosis. Supporting the increased likelihood of cancer invasion in the transgenic line, is the set of the stromal dysregulated genes which match the expression pattern associated in the literature with stromal support of cancer invasion. The processes involved are matrix remodeling by proteases and cell-matrix adhesion (increased integrins and periostin), vaso-activation (increased Fst , Rgs 72 , Serpine1 52 ), energy provisioning (increased Slc2a12 74 ), and promotion of invasion (decreased Spink12 73 , Pdgfra 74 ). Among the known pathways that influence tissue invasibility is also Wnt signaling 75 . Thus, differences in tumor microenvironmental expression, not only in the cancer cells themselves, may explain the association with cancer invasion. Awareness of the importance for cancer invasion of supportive stromal microenvironment has increased in recent research 76 – 78 . While the dysregulation of Wnt4 is temporally restricted by the estrogen peak, it is not necessarily spatially restricted to the uterus. It is plausible that the underlying processes are shared with other tissues expressing ESR1 receptors, even if the downstream effector genes may differ. The periodically elevated estrogen in the estrous cycle could thereby affect either the cancer cells themselves or the stroma exposed to and interacting with cancer cells. Such menstrual phase-dependent cancer invasibility has previously been suggested with respect to the propensity towards post-resection metastasis in breast cancer 79 . These effects have been suggested to be due to cycle-phase-dependent fluctuation in angiogenic factors (e.g., VEGF) and factors promoting epithelial-to-mesenchymal transition, downstream of estrogen 80 . The results of the present study suggest that vulnerability to this effect may be genetically enhanced by the alternate allele at the locus rs3820282. Estrogen responsiveness and Wnt4 activation are common characteristics of many cancers, even if the mechanisms downstream of Wnt4 are variable 81 – 84 . For example, a recent study has described the co-option of WNT4 under the control of ESR1 in the invasive lobular breast carcinoma, with downstream positive effects on tumor cell proliferation, mTOR signaling and mitochondrial function 17 , 85 – the effects we do not observe in the transgenic mouse uterus, which may be due to the absence of cancer cells. The epithelial prong of proliferation suppression in our mouse model contradicts the expectation from endometriosis. Endometriosis has been associated with the failure of progesterone receptor to induce genes counteracting estrogen-driven cell proliferation in the secretory phase, i.e., the progesterone resistance 26 . The strongest dysregulation of uterine gene expression in endometriosis was detected in the early secretory phase, whereby a significant Wnt4 dysregulation is rarely reported (but see Liang et al. 89 , for Wnt4 decrease). Interestingly, endometriosis-associated gene dysregulation in early secretory phase matches dysregulation in the transgenic mouse endometrium in the present study in terms of affected gene-set, above all the progesterone-regulated genes (e.g., Errfi1, Bcl6, Cited2, Irs2, Tgfb2, Gpx3, Tk1 26 ). However, these genes are dysregulated in opposite directions. This is an intriguing result, as the support for the causal role of the locus rs3820282 in endometriosis is strong 16 , 27 . Several factors could explain the mismatch between the effect in mouse proestrus, and its predicted effect on endometriosis: the species context (human vs. mouse), or the differing proportions of stromal and epithelial cells between mouse endometrium and endometriotic lesions. Alternatively, the associations with endometriosis and cancer may primarily stem from the effects of the SNP other than those on epithelial proliferation such as enhancement of pro-implantation/invasion- a hypothesis we propose. Wnt4 has previously been proposed as the plausible causal candidate for endometriosis because of its genomic proximity to rs3820282 and its role in the development of the female genital tract 86 , which could precipitate a tendency towards reproductive defects 22 , 87 . However, functional genetic follow-up on rs3820282 in the context of endometriosis did not confirm this effect. Luong and colleagues 27 and Powell et al. 25 tested the genes flanking rs3820282, and found that the alternate allele was associated with downregulation of LINC00339 (RNA gene absent from the mouse locus) in whole blood and endometrium, and upregulation of CDC42 in whole blood. WNT4 was not detected in whole blood samples (Brisbane genetics study 88 ) and also no effect of the rs3820282 genotype on WNT4 expression in endometrium was detected. Chromosome conformation capture (3C) in Ishikawa endometrial cell line found looping of the regulatory region with the SNP to CDC42 and LINC00339 25 . There are several plausible sources for the discrepancy between these results and our current findings. First, while authors accounted for sample variation due to different stages of the menstrual cycle, only 16 of 132 samples were collected in the early secretory phase, somewhat close to the stage in which we show the effect. Second, 3C approach would not reveal the regulation of WNT4 as the SNP is in the WNT4 intron itself. Finally, the Ishikawa cell line is derived from adenocarcinoma and thus has an uncertain cellular identity. These cells have been reported not to express WNT4 89 – rendering this line unsimilar to endometrial cells. Thus, the role of WNT4 as a mediator of the locus’ effect could not be excluded by this study. Conclusion We suggest that antagonistic pleiotropy associated with rs3820282 derives from a common mechanistic effect, namely an increased tissue support for invasion, occurring in different contexts. In the context of embryo implantation, the mutation enhances a normal process. In the context of reproductive cancers and endometriosis, it may not directly affect the origin or proliferation of cancer cells, but it does decrease the host tissue’s ability to resist the invasion, or even provide a supportive context. The idea of an evolutionary trade-off between the mammalian invasive implantation and the vulnerability to cancer metastasis is gaining support in recent research 69 . What may be common to both processes is the shared active role of the stromal microenvironment in regulation of invasion, either the embryo or cancer cells. The current study adds to the mechanistic understanding of this phenomenon by pointing out that such permissiveness to cancer may not be persistent but is limited to specific phases in the ovarian cycle, which modify not only the uterine, but potentially multiple estrogen responsive tissues. This differs from the idea of pre-metastatic niches in that the permissiveness of tissues to cancer invasion is not induced by the cancer cells themselves but is rather a side-effect of evolved uterine permissiveness and thus occurs, without consequences, also in the absence of cancer (or embryo). This enables a potentially different approach to restricting metastasis of estrogen-responsive cancers - by addressing its spatio-temporally local active support rather than modifying a ubiquitous growth process. METHODS Animal husbandry Animals were kept under 12:12 light:dark cycle and bred within genotype in house. Offspring were weaned at three weeks and reared separately by sex, housed no more than four animals per cage and fed standard mouse chow diet ad libitum. Animals were euthanized by asphyxiation (CCHMC) and cervical dislocation (UoV), consistent with animal care protocols at CCHMC and the UoV, immediately prior to tissue harvest. All procedures were approved by the relevant animal care and protection boards (CCHMC: IACUC2016-0053; UoV: Austrian Ministry for Science and Education). Generating transgenic mice The aim of gene editing was to replace the mouse allele at the location in the mouse genome corresponding to rs3820282 in humans, with the human allele. The position rs3820282 and its flanking sequences are 98% conserved between the human and mouse genome ( Fig. 1 ). For gene editing, we selected the sgRNAs that bracket the corresponding site in mice based on the on- and off-target scores from the web tool CRISPOR 90 . The selected sgRNA is constructed in a modified pX458 vector 91 , 92 that carries an optimized sgRNA scaffold 93 and a high-fidelity Cas9 (eSpCas9 1.1)-2A-GFP expression cassette 94 . Individual sgRNA editing activity is validated in mouse mK4 cells, using a T7E1 assay (NEB), and compared to the activity of Tet2 sgRNA that has been shown to modify the mouse genome efficiently 95 . Validated sgRNAs are in vitro synthesized using MEGAshorscript T7 kit (Life Technologies) as previously described 96 . Injection was made into the cytoplasm of one-cell-stage embryos of the C57BL/6 genetic background using the method described previously 96 . Injected embryos are immediately transferred into the oviductal ampulla of pseudopregnant CD-1 females. Live born pups are genotyped by PCR and then further confirmed by Sanger sequencing. Genotyping DNA for genotyping was isolated from tail clips and a PCR was run using the following primers: fwd: GCCTCAGAGGAATTGCGAGC and rev: GGATAGCCAACAGTGTAGCTGG. We used a high-fidelity polymerase Regular Phusion (NEB (M0530)) with high annealing temperature, and GC buffer. PCR cycling was as follows: 98C hold until load samples- Hot Start 98°C 2’ 98°C 15” 65°C 20” 72°C 30” 30 cycles steps 2-4 72°C 5’ 15°C until emptied The products were digested with restriction enzyme Tsp 451 (NEB R0583), which cuts if the alternate T allele is present or with Msc1 (NEB R0534), which cuts if the C allele is present, Only clean bands were purified with QIAquick PCR purification kit (Qiagen) and sent for Sanger sequencing. Gestation phenotype To assess the effect on gestational length, the pregnancies of homozygous females bred to the males of the same genotype were observed. The midnight preceding the morning of plug detection was counted as beginning of pregnancy, and the females were monitored to determine the start of parturition as appearance of the first pup. The litter size was assessed after the labor ceased and checked on the next day. Tissue Collection Animals were bred and tissue collected and harvested at two institutions (University of Vienna, UoV, and Cincinnati Children’s Hospital Medical Center, CCHMC). Analyses were repeated with samples from each institution independently, and the results have been consistent. Proestrus and estrus Adult non-mated female mice (aged 2-8 months) were monitored by daily vaginal swabs to determine the stage of estrous cycle 97 . Animals of each genotype at the locus of interest were harvested in proestrus and estrus, respectively. Uterine horns and ovaries were collected from each individual, one of each was placed in 4% PFA for histological and immunohistochemical assessment, the second was flash-frozen and/or stored in RNAlater for RNA extraction. Decidualization To assess gene expression during decidualization in vivo, we mated females of known genotype (TG or WT) with males of the same genotype and separated them upon detecting the copulatory plug in the morning examination, counting noon of the detection day as 0.5 day post copulation (dpc). We harvested only the pregnant uteri at 7.5 dpc and preserved the tissue by flash freezing in liquid nitrogen for later RNA extraction and qPCR. Primary cell isolation and culture We isolated primary mouse uterine stromal fibroblast cells using a standard protocol 98 , with the difference that uteri were harvested from mice in proestrus, as established by daily vaginal swabs 97 . In brief, uterine horns were harvested and digested with pancreatin and trypsin. The detached epithelial sheets were removed from the solution and the remaining tissue underwent two consecutive rounds of digestion in collagenase (30 min each), washing and filtering of the cell-containing media through 40 μm nylon mesh, spinning and seeding in ESF medium. Mouse ESF culture growth medium consists of equal parts of Dulbecco’s Modified Eagle Medium and Nutrient Mixture F12 (DMEM/F12) with phenol red, L-glutamine and 4-(2-Hydroxyethyl) piperazine-1-ethanesulfonic acid, N-(2-Hydroxyethyl)piperazine-N′-(2-ethanesulfonic acid) (HEPES), 10% FBS, 0.5 μg/mL amphotericin B, and 100 μg/mL gentamicin. Cells were grown to confluence in 6-well plates. Before the extraction, the growth medium was removed, and the cells were rinsed with PBS. Histology Sample preparation Fresh tissues were fixed in 4% PFA overnight at room temperature. They were then washed with PBS and transferred to gradually increasing concentration of ethanol (30-50-70%). Finally, tissues were then processed and embedded in paraffin blocks. For histological examination, slides were cut at 5 μm thickness and stained by hematoxylin-eosin staining using standard protocols. Immunohistochemistry Paraffin slides were incubated at 60°C overnight, washed in 3 changes of Xylene to remove paraffin, and rehydrated in gradually decreased Ethanol (100-95-70%) and PBS. Antigen retrieval was conducted using citrate buffer (pH 6.0), followed by H 2 O 2 to remove endogenous peroxidase activity, and blocking serum to avoid non-specific binding. In all cases, non-conjugated primary antibody was made visible with a secondary antibody with fluorescent fluorophore. The following rabbit-raised anti-mouse primary antibodies were used. Anti-Mki67(Abcam; ab16667), concentration 5μg/ml and anti-beta catenin (Abcam; ab16051), concentration 1μg/ml. In both cases we used a goat-raised, anti-rabbit, fluorophore-conjugated secondary antibody (Abcam; ab150077), concentration of 2 μg/ml. RNA scope ( in situ ) Commercial RNA scope kit for mouse Wnt4 RNA was purchased from Advanced Cell Diagnostics, Inc. (ACD). In situ hybridization was performed on paraffin-embedded tissue, following the manufacturer’s instructions. Profiling gene expression RNA isolation From frozen uterine horn or ovary approximately 20 mg of tissue was lysed with Precellys Evolution homogenizer at 6500 rpm 2 × 20s with a stainless-steel bead and 0.04M ditiotheritol. RNA was isolated using the RNeasy mini kit (Qiagen) according to the manufacturer’s instructions. RNA was subsequently stored at −80°C. From confluent primary cells, RNA was isolated using the mirVANA kit (Thermo Fisher Scientific), according to the manufacturer’s instructions. RNA was subsequently stored at −80°C. qPCR RNA expression profiles across estrous cycle of genes adjacent to the SNP (Cdc42 and Wnt4) were established by qPCR and compared between the genotypes. RNA was treated with TURBO DNase (Thermo Fisher) to remove any genomic DNA and converted to cDNA with High-Capacity cDNA reverse transcription kit (Thermo Fisher) following standard protocols. qPCR was performed with TaqMan primer probes (Thermo Fisher) with VIC dye for the GapDH internal control and multiplexed with FAM for Wnt4 . Proestrus and Estrus samples were run on an AriaMx qPCR with Brilliant III Ultra-Fast master mix (Agilent). 7.5dpc and decidual cell lines were analyzed with TaqMan Gene Expression master mix (Thermo Fisher) on a Mastercycler realplex (Eppendorf). Relative gene expression (2 −ΔCt ) was calculated with the respective associated qPCR analysis software. Statistical analyses and visualization of qPCR results were done using R version 4.1.1 99 . Statistical significance was evaluated by Wilcoxon-Mann-Whitney rank sum test. Only samples with values differing by more than 10 SD were removed. Transcriptome analysis (RNA Seq) RNA from four TG and three WT proestrus uteri was collected as described above. Library preparation and sequencing was conducted by the CCHMC sequencing facility on an Illumina NovaSeq 6000 to the depth of 30 million paired reads of 100bp length. Reads were aligned to the mouse GRCm38 genome 100 with STAR using settings -- outFilterMultimapNmax 1 -- quantMode GeneCounts 101 . Gene expression was analyzed with DEseq2 102 and an adjusted p value >0.05 was used to identify differentially expressed genes, shrunken log2FC values were used to account for lowly expressed genes 103 (Table S1). Relationships among samples were investigated with variance stabilizing transformed data and batch effects removed with limma 32 using a principal components analysis as well as hierarchical clustering of Pearson correlation between samples. Gene set enrichment 104 was analyzed with clusterProfiler 105 using the Hallmark collection from the Molecular Signature Database 32 , using ranked shrunken log2FC (Table S2). Data was analyzed with R version 4.1.1 99 . All raw data has been deposited to European Genome-Phenome Archive (available at publication). Contributions MP, GPW, LM developed the idea and planed the research, LM, AMZ, CEM-G and MP performed the experiments and the analyses, Y-CH helped with generating transgenic lines, NM and GD helped with the genotyping, LM, GD, FK and JM were instrumental in maintaining the colony and collecting the tissue, NZ helped with organizing the samples and validation, DS contributed to localization of the mutational effect, GZ crucially contributed to interpretation of genomic signal, MP and CEM-G wrote the draft. All authors have reviewed and discussed results, interpretation and formulation. Supplemental Figures Download figure Open in new tab Figure S1. SNP influences expression of Wnt4 in the uterus in the replicate transgenic line. In the additional mouse line generated, the transgenic allele resulted in similar mRNA gene expression changes measured by qPCR compared to the primary line used in experiments ( Fig. 2 ). A) Significant increase in Wnt4 expression changes were also found in the replicate transgenic line (KI-2). This difference in expression persisted into the estrus stage in this line. B) As in the other transgenic line, there was no significant difference in Cdc42 expression. As this line did not breed as robustly it was not used for subsequent experiments. Nevertheless, this demonstrates the reproducible effects of the SNP on Wnt4 expression. Download figure Open in new tab Figure S2. No differences in gestation length or litter size in transgenic lines. A) Gestation length and B) litter size was similar across all genotypes. Download figure Open in new tab Figure S3. No difference in Wnt4 expression in the transgenic 7.5 dpc uterus. mRNA expression, measured by qPCR in bulk uterine tissue from 7.5 dpc pregnant animals, does not indicate significant upregulation of Wnt4 in transgenic animals. Download figure Open in new tab Figure S4. SNP does not influence expression of Wnt4 in the proestrus and estrus ovary. mRNA expression, measured by qPCR in bulk ovarian tissue from estrus and proestrus, does not indicate significant upregulation of Wnt4 expression in the ovary of transgenic animals. Download figure Open in new tab Figure S5. Reproducibility of transcriptome. SNP transgenic genotype corresponds to gene expression differences among samples following batch correction and normalization. A) The first principal component explained 68% variation and generally separated samples based on genotype in batch corrected variance stabilized gene counts. B) Pearson correlation between all samples was greater than 95% with hierarchical clustering distinguishing samples based on genotype. Download figure Open in new tab Fig S6. Distinct patterns of functional enrichment for differentially expressed genes. A) Genes with decreased expression in the transgenic line (i.e., higher expression in the wildtype) were enriched for functions associated with mitosis and cell cycle progression including E2F targets, G2M checkpoint, and Mitotic spindle. B) Genes with significantly increased expression in the transgenic line were enriched for a variety of functions including epithelial mesenchymal transition, hypoxia, myogenesis, UV response down (DN). All significantly enriched gene sets can be found in Table S2. Download figure Open in new tab Figure S7. Support for non-canonical Wnt4 signaling (A) Immunohistochemistry using ß-catenin antibody shows no translocation of ß-catenin into the nucleus in wild type or transgenics, in proestrus or estrus. Lack of ß-catenin translocation indicates that the canonical Wnt4 pathway is not activated. (B) Supporting the absence of canonical Wnt4 pathways, enhancer factor Lef1 expression is at the limits of detection with insufficient expression to evaluate expression changes and high expression of Axin2 , a member of the ß-catenin dissociation complex, with no evidence of increased expression associated with ß-catenin activation. (C) One of the non-canonical signaling pathways is via increased intracellular calcium which can result in phosphorylation of CamkII. Genes for the four alternative CamkII subunits were detected, with increased expression of CamkIIb in the transgenic line. Supplemental data Table S1 RNAseq Data (Analyzed data) Batch corrected and normalized expression values along with DEseq2 analysis of differential expression. (Filtered raw data) Count data filtered for genes expressed (at least 1 count) in each sample. Table S2 Hallmark gene set enrichment All Hallmark gene set functional categories enriched within differentially expressed genes and associated statistical analyses. Acknowledgement The work was funded by the March of Dimes Ohio Collaborative Project to L. Muglia (#22-FY14-470) and Austrian Science Fund to MP (FWF #P33540). We particularly acknowledge the help in histology by Gale Macke of Cincinnati Children’s Hospital and the research support by Elisabeth Rauscher at the University of Vienna. References 1. ↵ Sivakumaran , S. et al. Abundant pleiotropy in human complex diseases and traits . Am J Hum Genet 89 , 607 – 18 ( 2011 ). OpenUrl CrossRef PubMed 2. Pickrell , J.K. et al. Detection and interpretation of shared genetic influences on 42 human traits . Nat Genet 48 , 709 – 17 ( 2016 ). OpenUrl CrossRef PubMed 3. ↵ Gratten , J. & Visscher , P.M. Genetic pleiotropy in complex traits and diseases: implications for genomic medicine . Genome Med 8 , 78 ( 2016 ). OpenUrl 4. ↵ Chesmore , K. , Bartlett , J. & Williams , S.M. The ubiquity of pleiotropy in human disease . Hum Genet 137 , 39 – 44 ( 2018 ). OpenUrl CrossRef 5. ↵ Williams , G.C. Pleiotropy, natural selection, and the evolution of senescence . Int J Evol 11 , 398 – 411 ( 1957 ). OpenUrl 6. ↵ Byars , S.G. & Voskarides , K. Antagonistic Pleiotropy in Human Disease . J Mol Evol 88 , 12 – 25 ( 2020 ). OpenUrl 7. Hashimoto , M. et al. Evolvability and Neurodegenerative Disease: Antagonistic Pleiotropy Phenomena Derived from Amyloid Aggregates . J Parkinsons Dis 8 , 405 – 408 ( 2018 ). OpenUrl 8. Stearns , S.C. & Medzhitov , R. Evolutionary medicine , xix , 306 pages ( Sinauer Associates, Inc., Publishers , Sunderland, Massachusetts , 2016 ). OpenUrl FREE Full Text 9. ↵ Albin , R.L. Antagonistic pleiotropy, mutation accumulation, and human genetic disease . Genetica 91 , 279 – 86 ( 1993 ). OpenUrl PubMed 10. ↵ Carter , A.J. & Nguyen , A.Q. Antagonistic pleiotropy as a widespread mechanism for the maintenance of polymorphic disease alleles . BMC Med Genet 12 , 160 ( 2011 ). OpenUrl CrossRef PubMed 11. ↵ Wu , Y.H. et al. Identification of Pleiotropic Cancer Susceptibility Variants from Genome-Wide Association Studies Reveals Functional Characteristics . Cancer Epidemiol Biomarkers Prev 27 , 75 – 85 ( 2018 ). OpenUrl Abstract / FREE Full Text 12. ↵ Consortium , T.G.P. A global reference for human genetic variation . Nature 526 , 68 – 74 ( 2015 ). OpenUrl CrossRef PubMed 13. ↵ Uno , S. et al. A genome-wide association study identifies genetic variants in the CDKN2BAS locus associated with endometriosis in Japanese . Nat Genet 42 , 707 – 10 ( 2010 ). OpenUrl CrossRef PubMed Web of Science 14. Nyholt , D.R. et al. Genome-wide association meta-analysis identifies new endometriosis risk loci . Nat Genet 44 , 1355 – 9 ( 2012 ). OpenUrl CrossRef PubMed 15. Pagliardini , L. et al. An Italian association study and meta-analysis with previous GWAS confirm WNT4, CDKN2BAS and FN1 as the first identified susceptibility loci for endometriosis . J Med Genet 50 , 43 – 6 ( 2013 ). OpenUrl Abstract / FREE Full Text 16. ↵ Mafra , F. , Catto , M. , Bianco , B. , Barbosa , C.P. & Christofolini , D. Association of WNT4 polymorphisms with endometriosis in infertile patients . J Assist Reprod Genet 32 , 1359 – 64 ( 2015 ). OpenUrl CrossRef PubMed 17. ↵ Sikora , M.J. et al. WNT4 mediates estrogen receptor signaling and endocrine resistance in invasive lobular carcinoma cell lines . Breast Cancer Res 18 , 92 ( 2016 ). OpenUrl 18. ↵ Kuchenbaecker , K.B. et al. Identification of six new susceptibility loci for invasive epithelial ovarian cancer . Nat Genet 47 , 164 – 71 ( 2015 ). OpenUrl CrossRef PubMed 19. ↵ Zhang , G. et al. Genetic Associations with Gestational Duration and Spontaneous Preterm Birth . N Engl J Med 377 , 1156 – 1167 ( 2017 ). OpenUrl CrossRef PubMed 20. ↵ Sakaue , S. et al. A cross-population atlas of genetic associations for 220 human phenotypes . Nat Genet 53 , 1415 – 1424 ( 2021 ). OpenUrl CrossRef PubMed 21. Ishigaki , K. et al. Large-scale genome-wide association study in a Japanese population identifies novel susceptibility loci across different diseases . Nat Genet 52 , 669 – 679 ( 2020 ). OpenUrl CrossRef PubMed 22. ↵ Valimaki , N. et al. Genetic predisposition to uterine leiomyoma is determined by loci for genitourinary development and genome stability . Elife 7 ( 2018 ). 23. ↵ Rafnar , T. et al. Variants associating with uterine leiomyoma highlight genetic background shared by various cancers and hormone-related traits . Nat Commun 9 , 3636 ( 2018 ). OpenUrl CrossRef 24. ↵ Krikun , G. et al. A novel immortalized human endometrial stromal cell line with normal progestational response . Endocrinology 145 , 2291 – 6 ( 2004 ). OpenUrl CrossRef PubMed Web of Science 25. ↵ Powell , J.E. et al. Endometriosis risk alleles at 1p36.12 act through inverse regulation of CDC42 and LINC00339 . Hum Mol Genet 25 , 5046 – 5058 ( 2016 ). OpenUrl PubMed 26. ↵ Burney , R.O. et al. Gene expression analysis of endometrium reveals progesterone resistance and candidate susceptibility genes in women with endometriosis . Endocrinology 148 , 3814 – 26 ( 2007 ). OpenUrl CrossRef PubMed Web of Science 27. ↵ Luong , H.T. et al. Fine mapping of variants associated with endometriosis in the WNT4 region on chromosome 1p36 . Int J Mol Epidemiol Genet 4 , 193 – 206 ( 2013 ). OpenUrl PubMed 28. ↵ Reis , F.M. , Bloise , E. & Ortiga-Carvalho , T.M. Hormones and pathogenesis of uterine fibroids . Best Pract Res Clin Obstet Gynaecol 34 , 13 – 24 ( 2016 ). OpenUrl 29. ↵ Davidson , B. , Trope , C.G. & Reich , R. The role of the tumor stroma in ovarian cancer . Front Oncol 4 , 104 ( 2014 ). OpenUrl PubMed 30. ↵ Logan , C.Y. & Nusse , R. The Wnt signaling pathway in development and disease . Annu Rev Cell Dev Biol 20 , 781 – 810 ( 2004 ). OpenUrl CrossRef PubMed Web of Science 31. ↵ Wang , F. et al. RNAscope: a novel in situ RNA analysis platform for formalin-fixed, paraffin-embedded tissues . J Mol Diagn 14 , 22 – 9 ( 2012 ). OpenUrl CrossRef PubMed Web of Science 32. ↵ Liberzon , A. et al. The Molecular Signatures Database (MSigDB) hallmark gene set collection . Cell Syst 1 , 417 – 425 ( 2015 ). OpenUrl 33. ↵ Cai , S. et al. Downregulation of SPINK13 Promotes Metastasis by Regulating uPA in Ovarian Cancer Cells . Cell Physiol Biochem 45 , 1061 – 1071 ( 2018 ). OpenUrl CrossRef PubMed 34. ↵ Ferby , I. et al. Mig6 is a negative regulator of EGF receptor-mediated skin morphogenesis and tumor formation . Nat Med 12 , 568 – 73 ( 2006 ). OpenUrl CrossRef PubMed Web of Science 35. ↵ Yoo , J.Y. et al. Loss of MIG-6 results in endometrial progesterone resistance via ERBB2 . Nat Commun 13 , 1101 ( 2022 ). OpenUrl 36. ↵ Ray , S. & Pollard , J.W. KLF15 negatively regulates estrogen-induced epithelial cell proliferation by inhibition of DNA replication licensing . Proc Natl Acad Sci U S A 109 , E1334 – 43 ( 2012 ). OpenUrl Abstract / FREE Full Text 37. ↵ Simmen , R.C. et al. Subfertility, uterine hypoplasia, and partial progesterone resistance in mice lacking the Kruppel-like factor 9/basic transcription element-binding protein-1 (Bteb1) gene . J Biol Chem 279 , 29286 – 94 ( 2004 ). OpenUrl Abstract / FREE Full Text 38. Velarde , M.C. , Geng , Y. , Eason , R.R. , Simmen , F.A. & Simmen , R.C. Null mutation of Kruppel-like factor9/basic transcription element binding protein-1 alters peri-implantation uterine development in mice . Biol Reprod 73 , 472 – 81 ( 2005 ). OpenUrl CrossRef PubMed Web of Science 39. ↵ Pabona , J.M. , Velarde , M.C. , Zeng , Z. , Simmen , F.A. & Simmen , R.C. Nuclear receptor co-regulator Kruppel-like factor 9 and prohibitin 2 expression in estrogen-induced epithelial cell proliferation in the mouse uterus . J Endocrinol 200 , 63 – 73 ( 2009 ). OpenUrl Abstract / FREE Full Text 40. ↵ He , X. et al. PIK3IP1, a negative regulator of PI3K, suppresses the development of hepatocellular carcinoma . Cancer Res 68 , 5591 – 8 ( 2008 ). OpenUrl Abstract / FREE Full Text 41. ↵ Teasley , H.E. , Chang , H.J. , Kim , T.H. , Ku , B.J. & Jeong , J.W. Expression of PIK3IP1 in the murine uterus during early pregnancy . Biochem Biophys Res Commun 495 , 2553 – 2558 ( 2018 ). OpenUrl 42. ↵ Filant , J. , DeMayo , F.J. , Pru , J.K. , Lydon , J.P. & Spencer , T.E. Fibroblast growth factor receptor two (FGFR2) regulates uterine epithelial integrity and fertility in mice . Biol Reprod 90 , 7 ( 2014 ). OpenUrl CrossRef PubMed 43. ↵ Kommagani , R. et al. The Promyelocytic Leukemia Zinc Finger Transcription Factor Is Critical for Human Endometrial Stromal Cell Decidualization . PLoS Genet 12 , e1005937 ( 2016 ). OpenUrl CrossRef 44. ↵ Kommagani , R. et al. A murine uterine transcriptome, responsive to steroid receptor coactivator-2, reveals transcription factor 23 as essential for decidualization of human endometrial stromal cells . Biol Reprod 90 , 75 ( 2014 ). OpenUrl CrossRef PubMed 45. ↵ Yang , Y. et al. Expression pattern implicates a potential role for luman recruitment factor in the process of implantation in uteri and development of preimplantation embryos in mice . J Reprod Dev 59 , 245 – 51 ( 2013 ). OpenUrl CrossRef PubMed 46. ↵ Fullerton , P.T. , Jr. . , Monsivais , D. , Kommagani , R. & Matzuk , M.M. Follistatin is critical for mouse uterine receptivity and decidualization . Proc Natl Acad Sci U S A 114 , E4772 – E4781 ( 2017 ). OpenUrl Abstract / FREE Full Text 47. ↵ Lessey , B.A. , Castelbaum , A.J. , Sawin , S.W. & Sun , J. Integrins as markers of uterine receptivity in women with primary unexplained infertility . Fertil Steril 63 , 535 – 42 ( 1995 ). OpenUrl CrossRef PubMed Web of Science 48. ↵ Lin , S.Y. et al. Female infertility and disrupted angiogenesis are actions of specific follistatin isoforms . Mol Endocrinol 22 , 415 – 29 ( 2008 ). OpenUrl CrossRef PubMed Web of Science 49. ↵ Yan , Q. et al. Calpain7 impairs embryo implantation by downregulating beta3-integrin expression via degradation of HOXA10 . Cell Death Dis 9 , 291 ( 2018 ). OpenUrl CrossRef 50. ↵ Frank , J.W. et al. Loss of ITGB3 in ovine conceptuses decreases conceptus expression of NOS3 and SPP1: implications for the developing placental vasculature . Biol Reprod 104 , 657 – 668 ( 2021 ). OpenUrl 51. ↵ Ryu , J. et al. Highly Expressed Integrin-alpha8 Induces Epithelial to Mesenchymal Transition-Like Features in Multiple Myeloma with Early Relapse . Mol Cells 39 , 898 – 908 ( 2016 ). OpenUrl 52. ↵ Chen , S. et al. SERPINE1 Overexpression Promotes Malignant Progression and Poor Prognosis of Gastric Cancer . J Oncol 2022 , 2647825 ( 2022 ). OpenUrl 53. ↵ Uchiyama , A. et al. MFG-E8 regulates angiogenesis in cutaneous wound healing . Am J Pathol 184 , 1981 – 90 ( 2014 ). OpenUrl CrossRef PubMed 54. ↵ Zhang , Q. et al. Roles and action mechanisms of WNT4 in cell differentiation and human diseases: a review . Cell Death Discov 7 , 287 ( 2021 ). OpenUrl 55. ↵ Jiang , M. et al. Uterine RGS2 expression is regulated by exogenous estrogen and progesterone in ovariectomized mice, and downregulation of RGS2 expression in artificial decidualized ESCs inhibits trophoblast spreading in vitro . Mol Reprod Dev 86 , 88 – 99 ( 2019 ). OpenUrl 56. ↵ Bergman , M.D. et al. Up-regulation of the uterine estrogen receptor and its messenger ribonucleic acid during the mouse estrous cycle: the role of estradiol . Endocrinology 130 , 1923 – 30 ( 1992 ). OpenUrl CrossRef PubMed Web of Science 57. ↵ Winuthayanon , W. , Hewitt , S.C. , Orvis , G.D. , Behringer , R.R. & Korach , K.S. Uterine epithelial estrogen receptor alpha is dispensable for proliferation but essential for complete biological and biochemical responses . Proc Natl Acad Sci U S A 107 , 19272 – 7 ( 2010 ). OpenUrl Abstract / FREE Full Text 58. ↵ Mote , P.A. et al. Overlapping and distinct expression of progesterone receptors A and B in mouse uterus and mammary gland during the estrous cycle . Endocrinology 147 , 5503 – 12 ( 2006 ). OpenUrl CrossRef PubMed Web of Science 59. ↵ Yip , K.S. , Suvorov , A. , Connerney , J. , Lodato , N.J. & Waxman , D.J. Changes in mouse uterine transcriptome in estrus and proestrus . Biol Reprod 89 , 13 ( 2013 ). OpenUrl CrossRef PubMed 60. ↵ Franco , H.L. et al. WNT4 is a key regulator of normal postnatal uterine development and progesterone signaling during embryo implantation and decidualization in the mouse . FASEB J 25 , 1176 – 87 ( 2011 ). OpenUrl CrossRef PubMed Web of Science 61. ↵ Murphy , C.R. Uterine receptivity and the plasma membrane transformation . Cell Res 14 , 259 – 67 ( 2004 ). OpenUrl CrossRef PubMed Web of Science 62. Murphy , C.R. The cytoskeleton of uterine epithelial cells: a new player in uterine receptivity and the plasma membrane transformation . Hum Reprod Update 1 , 567 – 80 ( 1995 ). OpenUrl CrossRef PubMed Web of Science 63. Kalam , S.N. , Dowland , S. , Lindsay , L. & Murphy , C.R. Microtubules are reorganised and fragmented for uterine receptivity . Cell Tissue Res 374 , 667 – 677 ( 2018 ). OpenUrl 64. ↵ Matsumoto , H. & Sato , E. Uterine angiogenesis during implantation and decidualization in mice . Reprod Med Biol 5 , 81 – 86 ( 2006 ). OpenUrl 65. ↵ Wagner , G.P. , Kin , K. , Muglia , L. & Pavlicev , M. Evolution of mammalian pregnancy and the origin of the decidual stromal cell . Int J Dev Biol 58 , 117 – 26 ( 2014 ). OpenUrl CrossRef PubMed 66. Griffith , O.W. et al. Embryo implantation evolved from an ancestral inflammatory attachment reaction . Proc Natl Acad Sci U S A 114 , E6566 – E6575 ( 2017 ). OpenUrl Abstract / FREE Full Text 67. ↵ Chavan , A.R. , Griffith , O.W. & Wagner , G.P. The inflammation paradox in the evolution of mammalian pregnancy: turning a foe into a friend . Curr Opin Genet Dev 47 , 24 – 32 ( 2017 ). OpenUrl CrossRef 68. ↵ D’Souza , A.W. & Wagner , G.P. Malignant cancer and invasive placentation: A case for positive pleiotropy between endometrial and malignancy phenotypes . Evol Med Public Health 2014 , 136 – 45 ( 2014 ). OpenUrl CrossRef PubMed 69. ↵ Kshitiz et al. Evolution of placental invasion and cancer metastasis are causally linked . Nat Ecol Evol 3 , 1743 – 1753 ( 2019 ). OpenUrl 70. Wagner , G.P. , Kshitiz , Dighe , A. & Levchenko , A. The Coevolution of Placentation and Cancer . Annu Rev Anim Biosci 10 , 259 – 279 ( 2022 ). OpenUrl 71. ↵ Suhail , Y. , Afzal , J. & Kshitiz . Evolved resistance to placental invasion secondarily confers increased survival in melanoma patients . J Clin Med 10 ( 2021 ). 72. ↵ Linder , A. , Hagberg Thulin , M. , Damber , J.E. & Welen , K. Analysis of regulator of G-protein signalling 2 (RGS2) expression and function during prostate cancer progression . Sci Rep 8 , 17259 ( 2018 ). OpenUrl 73. ↵ Purcell , S.H. et al. Improved insulin sensitivity by GLUT12 overexpression in mice . Diabetes 60 , 1478 – 82 ( 2011 ). OpenUrl Abstract / FREE Full Text 74. ↵ Cheng , Y. , Ma , D. , Zhang , Y. , Li , Z. & Geng , L. Cervical squamous cancer mRNA profiles reveal the key genes of metastasis and invasion . Eur J Gynaecol Oncol 36 , 309 – 17 ( 2015 ). OpenUrl PubMed 75. ↵ Patel , S. , Alam , A. , Pant , R. & Chattopadhyay , S. Wnt Signaling and Its Significance Within the Tumor Microenvironment: Novel Therapeutic Insights . Front Immunol 10 , 2872 ( 2019 ). OpenUrl CrossRef 76. ↵ Ilkhani , K. et al. The Engaged Role of Tumor Microenvironment in Cancer Metabolism: Focusing on Cancer-Associated Fibroblast and Exosome Mediators . Anticancer Agents Med Chem 21 , 254 – 266 ( 2021 ). OpenUrl 77. Sahai , E. et al. A framework for advancing our understanding of cancer-associated fibroblasts . Nat Rev Cancer 20 , 174 – 186 ( 2020 ). OpenUrl CrossRef PubMed 78. ↵ Kadel , D. et al. Current perspectives of cancer-associated fibroblast in therapeutic resistance: potential mechanism and future strategy . Cell Biol Toxicol 35 , 407 – 421 ( 2019 ). OpenUrl 79. ↵ Vantyghem , S.A. , Postenka , C.O. & Chambers , A.F. Estrous cycle influences organ-specific metastasis of B16F10 melanoma cells . Cancer Res 63 , 4763 – 5 ( 2003 ). OpenUrl Abstract / FREE Full Text 80. ↵ Bernhardt , S.M. et al. Timing of breast cancer surgery during the menstrual cycle-is there an optimal time of the month? Oncol Lett 20 , 2045 – 2057 ( 2020 ). OpenUrl 81. ↵ Liang , J. & Shang , Y. Estrogen and cancer . Annu Rev Physiol 75 , 225 – 40 ( 2013 ). OpenUrl CrossRef PubMed Web of Science 82. Li , W. , Zhang , Y. , Zhang , M. , Huang , G. & Zhang , Q. Wnt4 is overexpressed in human pituitary adenomas and is associated with tumor invasion . J Clin Neurosci 21 , 137 – 41 ( 2014 ). OpenUrl 83. Huang , Z. , Yang , M. , Li , Y. , Yang , F. & Feng , Y. Exosomes Derived from Hypoxic Colorectal Cancer Cells Transfer Wnt4 to Normoxic Cells to Elicit a Prometastatic Phenotype . Int J Biol Sci 14 , 2094 – 2102 ( 2018 ). OpenUrl 84. ↵ Wang , N. et al. PRMT5/Wnt4 axis promotes lymph-node metastasis and proliferation of laryngeal carcinoma . Cell Death Dis 11 , 864 ( 2020 ). OpenUrl 85. ↵ Shackleford , M.T. et al. Estrogen Regulation of mTOR Signaling and Mitochondrial Function in Invasive Lobular Carcinoma Cell Lines Requires WNT4 . Cancers (Basel) 12 ( 2020 ). 86. ↵ Kobayashi , A. & Behringer , R.R. Developmental genetics of the female reproductive tract in mammals . Nat Rev Genet 4 , 969 – 80 ( 2003 ). OpenUrl CrossRef PubMed Web of Science 87. ↵ Olafsdottir , T. et al. Genome-wide association identifies seven loci for pelvic organ prolapse in Iceland and the UK Biobank . Commun Biol 3 , 129 ( 2020 ). OpenUrl 88. ↵ Powell , J.E. et al. The Brisbane Systems Genetics Study: genetical genomics meets complex trait genetics . PLoS One 7 , e35430 ( 2012 ). OpenUrl CrossRef PubMed 89. ↵ Bui , T.D. , Zhang , L. , Rees , M.C. , Bicknell , R. & Harris , A.L. Expression and hormone regulation of Wnt2, 3, 4, 5a, 7a, 7b and 10b in normal human endometrium and endometrial carcinoma . Br J Cancer 75 , 1131 – 6 ( 1997 ). OpenUrl CrossRef PubMed Web of Science 90. ↵ Haeussler , M. et al. Evaluation of off-target and on-target scoring algorithms and integration into the guide RNA selection tool CRISPOR . Genome Biol 17 , 148 ( 2016 ). OpenUrl CrossRef PubMed 91. ↵ Ran , F.A. et al. Genome engineering using the CRISPR-Cas9 system . Nat Protoc 8 , 2281 – 2308 ( 2013 ). OpenUrl CrossRef PubMed 92. ↵ Ran , F.A. et al. Double nicking by RNA-guided CRISPR Cas9 for enhanced genome editing specificity . Cell 154 , 1380 – 9 ( 2013 ). OpenUrl CrossRef PubMed Web of Science 93. ↵ Chen , C. , Fenk , L.A. & de Bono , M. Efficient genome editing in Caenorhabditis elegans by CRISPR-targeted homologous recombination . Nucleic Acids Res 41 , e193 ( 2013 ). OpenUrl CrossRef PubMed 94. ↵ Slaymaker , I.M. et al. Rationally engineered Cas9 nucleases with improved specificity . Science 351 , 84 – 8 ( 2016 ). OpenUrl Abstract / FREE Full Text 95. ↵ Wang , H. et al. One-step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering . Cell 153 , 910 – 8 ( 2013 ). OpenUrl CrossRef PubMed Web of Science 96. ↵ Yang , H. , Wang , H. & Jaenisch , R. Generating genetically modified mice using CRISPR/Cas-mediated genome engineering . Nat Protoc 9 , 1956 – 68 ( 2014 ). OpenUrl CrossRef PubMed 97. ↵ Byers , S.L. , Wiles , M.V. , Dunn , S.L. & Taft , R.A. Mouse estrous cycle identification tool and images . PLoS One 7 , e35538 ( 2012 ). OpenUrl CrossRef PubMed 98. ↵ De Clercq , K. , Hennes , A. & Vriens , J. Isolation of mouse epithelial and stromal cells for in vitro decidualization . J Vis Exp , e55168 ( 2017 ). 99. ↵ R, T. A language and environment for statistical computing . R Foundation for Statistical Computing . ( Vienna , 2021 ). 100. ↵ Aken , B.L. et al. The Ensembl gene annotation system . Database (Oxford) 2016 ( 2016 ). 101. ↵ Dobin , A. et al. STAR: ultrafast universal RNA-seq aligner . Bioinformatics 29 , 15 – 21 ( 2013 ). OpenUrl CrossRef PubMed Web of Science 102. ↵ Love , M.I. , Huber , W. & Anders , S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2 . Genome Biol 15 , 550 ( 2014 ). OpenUrl CrossRef PubMed 103. ↵ Zhu , A. , Ibrahim , J.G. & Love , M.I. Heavy-tailed prior distributions for sequence count data: removing the noise and preserving large differences . Bioinformatics 35 , 2084 – 2092 ( 2019 ). OpenUrl CrossRef PubMed 104. ↵ Subramanian , A. et al. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles . Proc Natl Acad Sci U S A 102 , 15545 – 50 ( 2005 ). OpenUrl Abstract / FREE Full Text 105. ↵ Yu , G. , Wang , L.G. , Han , Y. & He , Q.Y. clusterProfiler: an R package for comparing biological themes among gene clusters . OMICS 16 , 284 – 7 ( 2012 ). OpenUrl CrossRef PubMed Web of Science Back to top Previous Next Posted October 26, 2022. Download PDF Supplementary Material Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following A SNP affects Wnt4 expression in endometrial stroma, with antagonistic implications for pregnancy, endometriosis and reproductive cancers Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share A SNP affects Wnt4 expression in endometrial stroma, with antagonistic implications for pregnancy, endometriosis and reproductive cancers Mihaela Pavlicev , Caitlin E. McDonough-Goldstein , Andreja Moset Zupan , Lisa Muglia , Yueh-Chiang Hu , Fansheng Kong , Nagendra Monangi , Gülay Dagdas , Nina Zupancic , Jamie Marziaz , Debora Sinner , Ge Zhang , Günter Wagner , Louis Muglia bioRxiv 2022.10.25.513653; doi: https://doi.org/10.1101/2022.10.25.513653 Share This Article: Copy Citation Tools A SNP affects Wnt4 expression in endometrial stroma, with antagonistic implications for pregnancy, endometriosis and reproductive cancers Mihaela Pavlicev , Caitlin E. McDonough-Goldstein , Andreja Moset Zupan , Lisa Muglia , Yueh-Chiang Hu , Fansheng Kong , Nagendra Monangi , Gülay Dagdas , Nina Zupancic , Jamie Marziaz , Debora Sinner , Ge Zhang , Günter Wagner , Louis Muglia bioRxiv 2022.10.25.513653; doi: https://doi.org/10.1101/2022.10.25.513653 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Genetics Subject Areas All Articles Animal Behavior and Cognition (7778) Biochemistry (18142) Bioengineering (14315) Bioinformatics (42946) Biophysics (21896) Cancer Biology (18960) Cell Biology (25957) Clinical Trials (138) Developmental Biology (13560) Ecology (20323) Epidemiology (2067) Evolutionary Biology (24786) Genetics (15814) Genomics (22913) Immunology (18132) Microbiology (41203) Molecular Biology (17432) Neuroscience (90515) Paleontology (679) Pathology (2898) Pharmacology and Toxicology (4932) Physiology (7851) Plant Biology (15392) Scientific Communication and Education (2063) Synthetic Biology (4391) Systems Biology (9951) Zoology (2311) (function(){function c(){var b=a.contentDocument||a.contentWindow.document;if(b){var d=b.createElement('script');d.innerHTML="window.__CF$cv$params={r:'a187fcd8ce2973d8',t:'MTc4MzYwNzAxOA=='};var a=document.createElement('script');a.src='/cdn-cgi/challenge-platform/scripts/jsd/main.js';document.getElementsByTagName('head')[0].appendChild(a);";b.getElementsByTagName('head')[0].appendChild(d)}}if(document.body){var a=document.createElement('iframe');a.height=1;a.width=1;a.style.position='absolute';a.style.top=0;a.style.left=0;a.style.border='none';a.style.visibility='hidden';document.body.appendChild(a);if('loading'!==document.readyState)c();else if(window.addEventListener)document.addEventListener('DOMContentLoaded',c);else{var e=document.onreadystatechange||function(){};document.onreadystatechange=function(b){e(b);'loading'!==document.readyState&&(document.onreadystatechange=e,c())}}}})();