Mechanism of Action of Yikun Yitong Ping-Containing Serum on Mast Cells and its Possible Involvement in Endometriosis-Related Dysmenorrhea

In: Natural Product Communications · 2024 · vol. 19(2) · doi:10.1177/1934578x241229929 · W4392244765
article OA: gold CC0
AI-generated summary by gemini-2.5-flash-lite, 2026-07-08

Yikun Yitong Ping-containing serum inhibited ER-α, ER-β, NGF, and P75 expression in RBL2H3 cells, suggesting it may alleviate endometriosis-related dysmenorrhea by downregulating mast cell ER expression.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

AI-generated deep summary by qwen3.7-flash, 2026-08-17 · read from full text

This study investigated the mechanism by which Yikun Yitong Ping (YKYTP), a traditional Chinese medicine, alleviates endometriosis-related dysmenorrhea using rat basophilic leukemia cells as a mast cell model. Treatment with YKYTP-containing serum significantly downregulated the expression of estrogen receptors alpha and beta, as well as nerve growth factor and its receptor, in cells stimulated with estradiol. The authors conclude that YKYTP likely mitigates pain by inhibiting estrogen receptor expression in mast cells, thereby reducing neuroinflammation. This paper is centrally about endometriosis — specifically exploring the pharmacological mechanism of a herbal formulation used to treat associated dysmenorrhea.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Background Previously, we showed that Yikun Yitong Ping (YKYTP) can effectively and safely relieve endometriosis-related dysmenorrhea; however, the underlying mechanism remained unclear. This study aimed to assess the effects of YKYTP-containing serum on rat basophilic leukemia cell line, as mast cells (MCs) analog, and investigate the mechanisms by which YKYTP alleviates endometriosis-related dysmenorrhea. Method In this study, YKYTP drug-containing serum was used to treat rat basophilic leukemia cell line (RBL2H3). The effect of YKYTP-containing serum on the expression of ER-α, ER-β, NGF, and NGFRp75 in RBL2H3 cells was evaluated using enzyme-linked immunosorbent assay, quantitative real-time polymerase reaction, and Western blotting. Results Different concentrations (5%-40%) of YKYTP-containing serum reduced ER expression in RBL2H3 cells, and the optimum concentration was 40%. Compared to the blank group, the expression of ER and NGF significantly increased in the E2 group ( P < .01). After co-administration with YKYTP-containing serum, the expression of ER-α, ER-β, NGF, and P75 significantly decreased ( P < .01). Conclusion YKYTP-containing serum can efficiently inhibit the expression of ER-α, ER-β, NGF, and P75 in RBL2H3 cells. YKYTP may alleviate endometriosis-related dysmenorrhea by downregulating ER expression in MCs.
Full text 32,623 characters · extracted from oa-pdf · 8 sections · click to expand

Abstract

Background: Previously, we showed that Yikun Yitong Ping (YKYTP) can effectively and safely relieve endometriosis-related dys- menorrhea; however, the underlying mechanism remained unclear. This study aimed to assess the effects of YKYTP-containing serum on rat basophilic leukemia cell line, as mast cells (MCs) analog, and investigate the mechanisms by which YKYTP alleviates endometriosis-related dysmenorrhea. Method: In this study, YKYTP drug-containing serum was used to treat rat basophilic leu- kemia cell line (RBL2H3). The effect of YKYTP-containing serum on the expression of ER- α,E R -β, NGF, and NGFRp75 in RBL2H3 cells was evaluated using enzyme-linked immunosorbent assay, quantitative real-time polymerase reaction, and Western blotting. Results: Different concentrations (5%-40%) of YKYTP-containing serum reduced ER expression in RBL2H3 cells, and the optimum concentration was 40%. Compared to the blank group, the expression of ER and NGF signi ficantly increased in the E2 group ( P < .01). After co-administration with YKYTP-containing serum, the expression of ER- α, ER- β, NGF, and P75 signi ficantly decreased ( P < .01). Conclusion: YKYTP-containing serum can ef ficiently inhibit the expression of ER- α, ER- β, NGF, and P75 in RBL2H3 cells. YKYTP may alleviate endometriosis-related dysmenorrhea by downregulating ER expression in MCs.

Keywords

Chinese medicine, endometriosis, estrogen receptor, mast cells, nerve growth factor Received: October 5th, 2023; Accepted: January 16th, 2024.

Introduction

Endometriosis is de fined as the presence of functioning endo- metrium outside of the uterine cavity with an unclear pathogen- esis.1,2 It presents with dysmenorrhea, dyspareunia, pelvic discomfort, and infertility 1,2 and mainly affects women of reproductive age, with a prevalence of about 10%. 3 Recurrence and side effects restrict the ef ficacy of current treat- ments of endometriosis, such as surgical resection and hormone therapy. 4–6 In China, people with endometriosis bene fit from traditional Chinese medicine (TCM) for treating dysmenorrhea brought on by endometriosis, enhancing fertility, and reducing recurrence. 7–9 Prof. Xurun San, a TCM expert, developed an herbal drug, namely Yikun Yitong Ping (YKYTP), which effec- tively and safely treated endometriosis-related dysmenorrhea in our previous study. 10 However, the mechanism by which YKYTP ameliorates endometriosis-associated dysmenorrhea remained unclear. Although the exact causes of endometriosis-related dysme- norrhea have not been uncovered, estrogen-dependent neuroin- flammation has been implicated in dysmenorrhea caused by endometriosis.4,11 Based on some reports, endometriosis is a systemic illness caused by immunological and endocrine pertur- bation.12,13 Mast cells (MCs) are important components of the immune system and play a key role in allergic response. 12 Some researchers hypothesized that the number and degranulation rate of MCs increase in endometriotic lesions. 2,14,15 Interestingly, recent studies reported that estrogen activates MC in endometriosis and showed that treatment with estrogen (E2) promotes the recruitment of degranulation of MCs. 16–20 Lin et al21 reported that estrogen receptors (ERs) are expressed on MCs. Further studies have demonstrated that activated MCs can release nerve growth factor (NGF), which can promote Department of Gynecology of Traditional Chinese Medicine, China-Japan Friendship Hospital, Beijing, China Corresponding Author: Hong Liu, Department of Gynecology of Traditional Chinese Medicine, China- Japan Friendship Hospital, Ying Hua Yuan East Street, Chao Yang District, Beijing, China. Email: [email protected] Creative Commons Non Commercial CC BY-NC: This article is distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 Licens e (https://creativecommons.org/licenses/by-nc/4.0/) which permits non-commercial use, reproduction and distribution of the work without furth er permission provided the original work is attributed as speci fied on the SAGE and Open Access page (https://us.sagepub.com/en-us/nam/open-access-at-sage). Original Research Article Natural Product Communications Volume 19(2): 1 –9 © The Author(s) 2024 Article reuse guidelines: sagepub.com/journals-permissions DOI: 10.1177/1934578X241229929 journals.sagepub.com/home/npx nerve growth and induce peripheral sensitization in endometriosis-related dysmenorrhea. 2,12,22 These findings sug- gested that high levels of local estrogen may be a key factor for recruiting and activating MCs. In our previous animal studies, we found that NGF expression is higher in rats with adenomyo- sis compared to control rats. We also observed that treatment with YKYTP decreased the expression levels of NGF . 23 Therefore, we hypothesized that YKYTP can reduce the expression levels of NGF in MCs by blocking ER in these cells. In the current study, we measured the expression levels of estrogen receptor- α (ER- α), estrogen receptor- β (ER- β), NGF, and NGFRp75 in a rat basophilic leukemia cell line (RBL2H3) after treatment with E2, fulvestrant (an estrogen inhibitor), and YKYT to explore the mecha- nism by which YKYTP mitigates endometriosis-associated dysmenorrhea.

Methods

Reagents and Antibodies β-Estradiol 17-acetate (HY) and fulvestrant (HY-13636) were purchased from Haoyuan Chemexpress (Shanghai, China). Rat estradiol receptor (MM-0273R2) was obtained from Mianmian Biology (Jiangsu, China). TRIzol Reagent (CW0580S), HiFiScript cDNA (CW2569 M), UltraSYBR Mixture (CW0957 M), Ultrapure RNA (CW0581 M), and BCA Protein Assay Kit (CW0014S) were all purchased from CoWin Biosciences (Jiangsu, China). Cell Culture and Treatment Rat basophilic leukemia cell line (RBL2H3), as the counterpart of mucosal MC, was purchased from the Chinese Academy of Sciences (Beijing, China). At 37 °C with 5% CO 2, cells were grown in Dulbecco ’s modi fied Eagle ’s medium provided by KeyGEN Biotech in China. In addition, 10% fetal bovine serum and 1% antibiotic solution (100 U/mL penicillin and 0.1 mg/mL streptomycin) were added to the culture media. For each experiment, cells in the logarithmic phase of growth were employed. Preparation of YKYTP The Pharmacy Division of the China-Japan Friendship Hospital (Beijing, China) provided all medicinal herbs for YKYTP decoction, and Professor Runsan Xu of the hospital provided identi fication. Table 1 comprises their Chinese names, English names, Latin names, family, proportions in the drug, countries of origin, and daily adult dosages (g). The combination of the components was cooked in 8 volumes of water (v/w) for 60 min, followed by 2 extraction steps to prepare YKYTP . The clinical preparation process w a st h es a m e .Y K Y T Pw a se x t r a c t e da n dk e p ti na−20 °C freezer until usage. Animals and Drugs Twenty male Sprague-Dawley (SD) rats, aged 4 to 5 weeks and weighing between 240 and 300 g, were obtained from Beijing Vital River Laboratory Animal Technology Co., Ltd (China). The Animal Ethics Committee of China-Japan Friendship Hospital approved the protocol of this study (No: 190205). Animals had free access to water and food and were kept in a pathogen-free (SPF) environment (22-24 °C, 50%-70% humidity, and a 12:12 h light:dark cycle). The health status of rats was checked once a day while they were housed, and no abnormalities were found. After 1 week of adapting to the new diet, 20 rats were randomly divided into 2 groups: a saline-treated control group and a YKYTP-containing serum-treated group. The drug (100 mL/g of body weight) was given twice daily for 3 con- secutive days, equivalent to a human dosage based on body surface area. At the end of the experiment, euthanasia was accom- plished using pentobarbital sodium and cervical dislocation to lessen the pain and distress of animals. The rats were weighed and then given a lethal dose of pentobarbital sodium (45 mg/kg, Sigma, USA) intraperitoneally 1 h after the last dose of YKYTP . Subsequently, blood samples were collected from the aorta with stri ct sterility. After centrifug- ing blood samples for 5 min at 2000 r/min, serum samples were extracted. Serum samples from the same group were Table 1. The Composition of Yikun Yitong Ping (YKYTP). 23 Chinese name (voucher number) English name/Latin name Daily adult dose (g) Family Part used Origin Huangqi (1803110) Milkvetch Root/Radix astragali membranacei 30 Papilionoideae Root Gansu Shuizhi (901102002) Leech/Whitmania pigra 10 Hirudo Worm Jiangsu Jixinzi (180912) Garden Balsam Seed/Impatiens balsamina L 10 Impatiens Seed Hebei Zelan (1910067) Eupatorium/Aconitum gymnandrum Maxim 10 Ranunculus Grass Anhui Huangbai (HEA161) Cork tree/Cortex phellodendri 10 Ruta Bark Sichuan Heshouwu (DD7201) Tuber Fleece flower Root/Polygonum multiflorum 25 Polygonaceae Root Zhejiang Sanqifen (200281553) pseudo-ginseng powder/Radix pseudoginseng 3 Acanthopanax Root Yunnan 2 Natural Product Communications m i x e da n di n a c t i v a t e di n5 6° Cw a t e rf o r3 0m i nt op r e v e n t viral and other interferences. The samples were stored at −20 °C until assay. Grouping and Intervention RBL2H3 cells were divided into 5 different groups. Group 1 served as the control group; group 2 received estradiol (500 pmol/L); group 3 received fulvestrant (10-5 mol/L), an estradiol inhibitor; group 4 received both estradiol and fulvestrant (E2 + F group); and group 5 received estradiol and 40% drug-containing serum (E2 + YKYTP group). After 24 h of culture, cells from each group were analyzed. Enzyme-Linked Immunosorbent Assay The cells were seeded in plates before treatment. After 24 h, 1.5 mL of growth media was collected from each well, and rat ER level was analyzed using enzyme-linked immunosorbent assay (ELISA). After collecting the supernatant at each time point, we measured protein levels using an ELISA kit (MeiMian, JS, China) and according to manufacturer ’s instructions. The operator simultaneously analyzed samples and calibration standards to generate a standard curve of optical density based on ER concentration. Finally, we calcu- lated ER concentration for each sample based on the stan- dard curve. Quantitative Real-Time Polymerase Chain Reaction The mRNA expression of the ER was measured using real- time polymerase chain reaction (RT-PCR). TRIzol reagent was used to extract total RNA following manufacturer ’s instructions (CW0580S, CWBIO, JS, China). Then, an Ultrapure RNA kit (CW0581M, CWBIO, JS, China) was used for reverse transcription following manufacturer ’s instructions. According to the package recommendations, Step Plus real-time PCR was used to conduct quantitative measurements of various gene levels. Biotechnology Company designed the primers (Shanghai, China). Table 2 displays the primer sequences in detail. Western Blotting After extraction, cells were boiledin the RIPA lysis buffer (Puli Gene Technology Company, Beijing, China). Supernatants were obtained during centrifugation. The SDS-PAGE was used to extract, resolve, and transfer the tota l proteins to PDVF membranes. Membranes werefirst pre-incubated with primary antibodies at 4 ° C overnight, washed with TBST buffer, and then re-incubated with the appropriate secondary antibody at room temperature for 1 h. Chemi DocTM XRS+ w a su s e dt oc l e a na n da n a l y z et h em e m - branes (Bole Life Medical Products Company, Shanghai, China). Statistical Analysis GraphPad Prism 7.0 was used for analysis, and the results are presented as the mean ± standard error. Differences between Table 2. Primer Sequences Used in Real-Time PCR. Primer ID Primer sequences Primer length (bp) Production length(bp) ERα F TGATGAAAGGCGGGATACGA 20 223 ERα R GGTTCAGCATCCAATAAGGCA 21 NGF F CACCTCTTCGGACACTCTGG 20 294 NGF R CCGTGGCTGTGGTCTTATC 20 ERβ F CGTTCTGGACAGGGATGAGG 20 251 ERβ R TCTTCGCAATCACCCAGACC 20 ERβ F1 ATCATCGCTCCTCTATGC 18 101 ERβ R1 GCTTCCTCTTCAGTGTCT 18 ERβ F2 TCCCGGCAGCACCAGTAA 18 301 ERβ R2 CCCAGATGCATAATCGCTGC 20 ERβ F3 TGCCAATCATCGCTCCTC 18 125 ERβ R3 GCACAACTGCTCCCACTAAG 18 ERβ F4 CTTTAGCGACCCATTGCC 24 381 ERβ R4 CCATTCCTACTTCATAACACTTGC 20 P75 F TGGCTACTACCAGGACGAGG 20 248 P75 R GACCAGGGATCTCTTCGCATT 21 P75 F1 ACGACCAGCAGACCCATACG 20 61 P75 R1 AGGTTGCCATCACCCTTGAG 20 P75 F2 CTGGGTTACCAGCCTGAACATA 22 249 P75 R2 GCTGGCTAGAACATCAGTCGTC 22 P75 F3 CACGACCAGCAGACCCATA 19 123 P75 R3 GGTATCCCCGTTGAGCAGT 19 β-actin F GCCATGTACGTAGCCATCCA 20 375 β-actin R GAACCGCTCATTGCCGATAG 20 Yang et al 3 groups were analyzed using 1-way analysis of variance. The cut-off for signi ficance was set at P < .05. Post-hoc Tukey ’s test was used for between-group comparisons. Each experi- ment was conducted at least 3 times.

Results

Decreased Expression of ER in RBL2H3 Cells After Exposure to YKYTP-Containing Serum We cultured RBL2H3 cells and subjected them to various dosages of YKYTP to determine whether the concentration of drug- containing serum was correlated with ER expression. ELISA revealed that the drug-containing serum altered ER expression in RBL2H3 cells. Various concentrations of drug-containing serum decreased E2 expression. The minimum expression level of ER was observed after treatment with 40% drug-containing serum (Figure 1A). Although 40% drug-containing serum down- regulated the expression level of ER within 10, 30, and 60 min, the minimum level of ER was observed after 10 min (Figure 1B). ELISA Exhibited the Effects of YKYTP Drug-Containing Serum on ER Expression in RBL2H3 Cells The protein expression levels of ER in RBL2H3 were detected by ELISA (Figure 2). The expression of ER in RBL2H3 cells was signi ficantly increased after treatment with E2, suggesting the role of E2 in RBL2H3 cells. In contrast, ER expression sig- nificantly decreased in the anti-E2 (fulvestrant) group compared with the control group. ER expression levels considerably decreased in the E2 + YKYTP group compared to the E2 group, whereas there was no discernible difference in ER levels between the E2 + YKYTP and E2 + anti-E2 groups. The results of ELISA revealed that YKYTP suppressed ER levels in RBL2H3 cells. RT-PCR Showed That YKYTP-Containing Serum Reduced the mRNA Levels of ER in RBL2H3 Cells We measured the mRNA level of ER by RT-PCR to verify the mechanisms by which YKYTP affects RBL2H3 cells. ELISA was used to measure ER expression level in RBL2H3 cells (Figure 3). Treatment with E2 dramatically enhanced ER expression in RBL2H3 cells, indicating that E2 affects these cells. However, ER expression levels were considerably lower in the fulvestrant group than in the control group. ER expres- sion was considerably lower in the E2 + YKYTP group than in the E2 group. However, ER expression was not signi ficantly different between the E2 + YKYTP group and the E2 + anti-E2 group ( P > .05). Figure 1. ER level in various concentrations of YKYTP-containing serum. ELISA showed that the expression levels of ER decreased in RBL2H3 cells after 10, 30, and 60 min of treatment with various concentrations of drug-containing serum. The most effective concentration of drug-containing serum was 40%, and the minimum level of ER expression was observed after 10 min. 4 Natural Product Communications RT-PCR Indicated That YKYTP-Containing Serum Suppressed the Expression of NGF NGF is released by MC degranulation; thus, we examined the mRNA levels of NGF to investigate the effect of YKYTP on RBL2H3 cell degranulation. RT-PCR exhibited that NGF mRNA levels were signi ficantly higher in the E2 group than in the control group; however, the mRNA levels of NGF consider- ably reduced after adding YKYTP ( P < .01). These findings suggest that YKYTP can inhibit E2-induced degranulation of RBL2H3 cells. Western Blotting Exhibited That YKYTP-Containing Serum Downregulated ER- α, ER-β, NGF, and P75 Proteins Using Western blotting, we assessed the protein levels of ER- α, ER-β, NGF, and P75 to delve into the mechanism by which YKYTP controls ER and RBL2H3 cell degranulation. Following E2 therapy, a dramatic increase was observed in the expression levels of ER- α,E R - β, NGF, and P75 (Figure 4). The protein levels of ER- α, ER- β, NGF, and P75 dramatically reduced when YKYTP was introduced. There was no statistically signi ficant difference between the E2 + anti-E2 group and the E2 + YKYTP group concerning the expression levels of ER- α, ER- β, NGF, and P75 ( P > .05). Based on these findings, YKYTP may regulate ER- α and ER-β expression to suppress the release of NGF and P75 via MC degranulation.

Discussion

Here, we showed that YKYTP-containing serum can suppress ER expression in RBL2H3 cells, which means YKYTP can prevent MC degranulation by inhibiting ER. NGF and P75 both were upregulated in RBL2H3 cells following treatment with E2 while downregulated after adding YKYTP , suggesting that YKYTP may suppress ER-mediated NGF and P75 release by MCs. Chronic pelvic discomfort, dysmenorrhea, and infertility are hallmarks of endometriosis, a prevalent gynecological disease that undermines patients ’ quality of life, physical and emotional health, and productivity. 24 Our previous clin- ical investigation validated the ef ficacy and safety of YKYTP in the management of dysmenorrhea caused by endometri- osis 10; however, the mechanism by which YKYTP mitigates endometriosis-related dysm enorrhea remained unclear. Estrogen-dependent neuroin flammation has been implicated in the pathogenesis of endometriosis-related Figure 2. ER expression in 5 different groups of RBL2H3 cells. (A) RBL2HS cell growth in different groups. (B) The protein expression levels of ER by RBL2H3 cells were detected by ELISA. The expression levels of ER increased by E2 ( P < .01), while decreased by YKYTP ( P < .01). Yang et al 5 dysmenorrhea.3,25,26 Previous findings suggested that E2 may increase NGF and P75 levels in peritoneal endometriosis by increasing in flammation-nerve interactions. 11 As a key player in neuropathic pain, NGF is involved in various processes, including pain sensation, brain plasticity, immune cell aggrega- tion, and in flammatory factor release. 12,13,27,28 Previous studies indicated that increased E2 levels play a critical role in MC degra- nulation and recruitment and induce the release of NGF . 20,29 Increased expression of NGF and platelet-derived growth factor in endometriotic lesions may also induce the ingrowth of nerve fibers into endometriotic tissue, which causes pain and local tenderness.18,29–32 Researchers have shown that NGF and P75 are overexpressed in patients with endometriosis compared to those without endometriosis, suggesting that these factors are involved in disease pathogenesis. 33–35 We previously observed that YKYTP can suppress NGF and P75 expression in the rat model of adenomyosis.23 In this study, we set out to investigate whether YKYTP regulates ER expression in MCs and neurons. We employed a rat basophilic leukemia cell line, which is widely used for in-vitro studies of MCs, to assess our hypothesis (RBL2H3). The results of RT-PCR, Western blotting, and ELISA showed that treatment with estradiol (E2) increased the expression of ER and NGF, suggesting that E2 can induce RBL2H3 cells to release NGF by regulating the expres- sion of ER. Our findings were consistent with those reported by Zhu et al . 8 Based on these findings, E2 was identi fied as a key mediator involved in in flammation-nerve crosstalk in endometriosis-associated dysmenorrhea. Consistent with ELISA, Western blotting indicated markedly reduced protein levels of ER- α, ER-β, NGF, and P75 in the E2 + YKYTP group compared to the E2 group. In addition, com- pared to the E2 group, the E2 + YKYTP group had consider- ably decreased mRNA levels of ER and NGF . Our data showed that YKYTP can mitigate endometriosis-induced dysmenor- rhea by reducing ER levels and preventing ER-mediated NGF release by MCs. There was no difference in the expression Figure 3. mRNA levels of ER and NGF in different groups. RT-PCR indicated that the mRNA levels of ER and NGF significantly increased after treatment with E2 ( P < .01), and decreased after treatment with YKYTP ( P < .01). Figure 4. ER, NGF, and P75 protein expression in different groups. Western blotting revealed that the protein levels of ER- α, ER-β, NGF, and P75 signi ficantly increased after treatment with E2 ( P < .001) and decreased after treatment with YKYTP ( P < .001). 6 Natural Product Communications levels of ER and NGF between the E2 + YKYTP group and the E2 + F group. Compared to estrogen inhibitors, the ef ficacy and safety of YKYTP have been veri fied in clinical settings. We conclude that E2 mediates in flammation-nerve crosstalk in endometriosis-associated dysmenorrhea by stimulating MC degranulation and NGF release. We also observed that YKYTP-containing serum decreased ER expression in RBL2H3 cells, thereby inhibiting their activation and reducing NGF release (Figure 5). YKYTP may alleviate endometriosis- related dysmenorrhea via downregulating ER expression in MCs. Our findings can advance the use of TCM in the treatment of endometriosis. However, RBL2H3 cells were used in this study, they do not behave the same as MCs in patients with endo- metriosis. Therefore, future studies should employ rat models of endometriosis and primary MCs from the peritoneal fluid of patients with endometriosis to unravel the mechanisms by which YKYTP improves endometriosis-related dysmenorrhea. According to these data, we showed that YKYTP-containing serum can suppress ER expression in RBL2H3 cells, suggesting that YKYTP can prevent MC degranulation by inhibiting ER. NGF and P75 both were upregulated in RBL2H3 cells follow- ing treatment with E2 while downregulated after adding YKYTP , suggesting that YKYTP may suppress ER-mediated NGF and P75 release by MCs. Therefore, we can assume that YKYTP inhibits ER on the surface of RBL2H3 cells to inhibit MC degranulation. We conclude that E2 mediates in flammation-nerve crosstalk in endometriosis-associated dysmenorrhea by stimulating MC degranulation and NGF release. We also observed that YKYTP-containing serum decreased ER expression in RBL2H3 cells, thereby inhibiting their activation and reducing NGF release (Figure 5). YKYTP may alleviate endometriosis- related dysmenorrhea by downregulating ER expression in MCs. Our findings can advance the use of TCM in the treat- ment of endometriosis. While providing insights into the effects of YKYTP on the RBL2H3 cell line, we acknowledge several limitations. We used RBL2H3 cells to explore the possible mechanisms by which YKYT affects MCs. However, RBL2H3 cells possess the characteristics of MCs rather than being MCs in the true sense. They do not behave the same as MCs in patients with endometriosis. In addition, we only indirectly proved the effect of YKYTP on MC degranulation through ER, NGF, and P75. Therefore, in future experiments, we will further verify the mechanism by which YKYTP affects MCs through animal experiments and measure changes in the number of MCs in the human peritoneal cavity. Besides, YKYT is a compound preparation for clin- ical application with various medicinal constituents. In the future, we will investigate which speci fic constituent of YKYTP plays a speci fic role in endometriosis. Our findings might not be completely generalizable to endometriosis- related dysmenorrhea in humans due to the complexity of human MC responses. Additionally, focusing solely on a speci fic cell line limits the comprehensive understanding of YKYTP ’s active components. Future studies are needed to address these limitations, aiming to deepen our understanding and promote the clinical application of YKYTP .

Conclusion

This study provides a deeper insight into the treatment of endometriosis-associated dysmenorrhea with YKYTP and helps find drug targets for pain inhibition. Endometriosis-related dysme- norrhea is treatable, and YKYTP can be prescribed as an alterna- tive treatment in clinical settings. Still, more studies are needed to fully uncover the underlying mechanisms behind the clinical findings. Data Availability Data will be provided by the corresponding author upon a reasonable request. Figure 5. The mechanism by which YKYTP relieves endometriosis-associated dysmenorrhea. YKYTP reduced the expression levels of NGF and P75 in MCs by blocking estrogen receptors on Mast Cells. Yang et al 7 Declaration of Con flicting Interests The author(s) declared no potential con flicts of interest with respect to the research, authorship, and/or publication of this article. Ethics Approval The Animal Ethics Committee of China-Japan Friendship Hospital approved the protocol of this study (No: 190205). Funding The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by the Beijing Administration of Traditional Chinese Medicine (grant number 100108-1-02). ORCID iD Hong Liu https:/ /orcid.org/0000-0002-3075-5039 Statement of Human and Animal Rights All of the experimental procedures involving animals were conducted in accordance with the Institutional Animal Care guidelines of Nantong University, China, and approved by the Animal Ethics Committee of China-Japan Friendship Hospital, China.

References

1. Eskenazi B, Warner ML. Epidemiology of endometriosis.Obstet Gynecol Clin North Am. 1997;24(2):235–258. doi:10.1016/s0889-8545(05) 70302-8 2. Lampiasi N. Interactions between macrophages and mast cells in the female reproductive system. Int J Mol Sci. 2022;23(10):5414. doi:10.3390/ijms23105414 3. Koninckx PR, Fernandes R, Ussia A, et al. Pathogenesis based diagnosis and treatment of endometriosis. Front Endocrinol. 2021;12:745548. doi:10.3389/fendo.2021.745548 4. Vannuccini S, Clemenza S, Rossi M, Petraglia F. Hormonal treatments for endometriosis: the endocrine background.Rev Endocr Metab Disord. 2022;23(3):333–355. doi:10.1007/s11154-021-09666-w 5. Amro B, Ramirez Aristondo ME, Alsuwaidi S, et al. New understand- ing of diagnosis, treatment and prevention of endometriosis. Int J Environ Res Public Health. 2022;19(11):6725. doi:10.3390/ ijerph19116725 6. Kalaitzopoulos DR, Samartzis N, Kolovos GN, et al. Treatment of endometriosis: a review with comparison of 8 guidelines. BMC Womens Health. 2021;21(1):397. doi:10.1186/s12905-021-01545-5 7. Lin Y, Hou R, Zhang T, Chung JPW, Wang CC, Zhao R. Ef ficacy and safety of Chinese herbal medicine for endometriosis associ- ated pain. Am J Chin Med. 2022;50(4):1095–1111. doi:10.1142/ s0192415(22500446) 8. Gao Q, Shen L, Jiang B, et al. Salvia miltiorrhiza-containing Chinese herbal medicine combined with GnRH agonist for post- operative treatment of endometriosis: a systematic review and meta-analysis. Front Pharmacol. 2022;13:831850. doi:10.3389/ fphar.2022.831850 9. Dong P, Ling L, Hu L. Systematic review and meta-analysis of tra- ditional Chinese medicine compound in treating infertility caused by endometriosis. Ann Palliat Med. Dec 2021;10(12):12631–12642. doi:10.21037/apm-21-3425 10. fang Wq Y. The protective effect and safety evaluation of “YiKun YiTong Ping”in the treatment of dysmenorrhea caused by adeno- myosis. J China-Japan Friendship Hosp . 2017;31(4):214 –217. 11. Greaves E, Temp J, Esnal-Zu fiurre A, Mechsner S, Horne AW, Saunders PT. Estradiol is a critical mediator of macrophage-nerve cross talk in peritoneal endometriosis. Am J Pathol. Aug 2015;185(8):2286–2297. doi:10.1016/j.ajpath.2015.04.012 12. Velho RV, Taube E, Sehouli J, Mechsner S. Neurogenic in flamma- tion in the context of endometriosis-what do we know? Int J Mol Sci. 2021;22(23):13102. doi:10.3390/ijms222313102 13. Reis FM, Petraglia F, Taylor RN. Endometriosis: hormone regula- tion and clinical consequences of chemotaxis and apoptosis. Hum Reprod Update. 2013;19(4):406–418. doi:10.1093/humupd/dmt010 14. Godin SK, Wagner J, Huang P, Bree D. The role of peripheral nerve signaling in endometriosis. F ASEB Bioadv. 2021;3(10):802 –813. doi:10.1096/fba.2021-00063 15. Umezawa M, Sakata C, Tanaka N, et al. Pathological study for the effects of in utero and postnatal exposure to diesel exhaust on a rat endometriosis model. J Toxicol Sci. 2011;36(4):493 –498. doi:10. 2131/jts.36.493 16. Miller JE, Lingegowda H, Symons LK, et al. IL-33 activates group 2 innate lymphoid cell expansion and modulates endometriosis. JCI Insight. 2021;6(23):e149699. doi:10.1172/jci.insight.149699 17. Ono Y, Yoshino O, Hiraoka T, et al. IL-33 Exacerbates endo- metriotic lesions via polarizing peritoneal macrophages to M2 subtype. Reprod Sci (Thousand Oaks, Calif) . 2020;27(3):869 –876. doi:10.1007/s43032-019-00090-9 18. Li T, Wang J, Guo X, et al. Possible involvement of crosstalk between endometrial cells and mast cells in the development of endometriosis via CCL8/CCR1. Biomed Pharmacother. 2020;129:110476. doi:10.1016/j.biopha.2020.110476 19. Guo X, Xu X, Li T, et al. NLRP3 in flammasome activation of mast cells by estrogen via the nuclear-initiated signaling pathway contributes to the development of endometriosis. Front Immunol. 2021;12:749979. doi:10.3389/ fimmu.2021.749979 20. Zhu TH, Ding SJ, Li TT, Zhu LB, Huang XF, Zhang XM. Estrogen is an important mediator of mast cell activation in ovarian endometriomas. Reproduction (Cambridge, England) . 2018;155(1):73–83. doi:10.1530/rep-17-0457 21. Lin K, Zhu L, Zhang X, Lin J. Role of mast cells in estrogen- mediated experimental endometriosis in rats. Zhejiang Da Xue Xue Bao Yi Xue Ban . 2015;44(3):269 –277. 22. Kleij HP , Bienenstock J. Significance of conversation between mast cells and nerves. Allergy Asthma Clin Immunol . 2005;1(2):65-80. doi: 10.1186/1710-1492-1-2-65 23. Fang Wq Y. Impact of yikun yitong ping keli on endometrium nerve growth factor expression in adenomyosis model mice. J Tradit Chin Med. 2018;1(1):66–68. 24. Sorrentino F MDEP, Falagario M, et al. Endometriosis and adverse pregnancy outcome. Minerva Obstet Gynecol . 2022;74(1):31 –44. doi:10.23736/s2724-606x.20.04718-8 8 Natural Product Communications 25. Hu L, Zhang J, Lu Y, Fu B, Hu W. Estrogen receptor beta pro- motes endometriosis progression by upregulating CD47 expres- sion in ectopic endometrial stromal cells. J Reprod Immunol. 2022;151:103513. doi:10.1016/j.jri.2022.103513 26. McCallion A, Nasirzadeh Y, Lingegowda H, et al. Estrogen mediates inflammatory role of mast cells in endometriosis pathophysiology. Front Immunol. 2022;13:961599. doi:10.3389/fimmu.2022.961599 27. Levi-Montalcini R. The nerve growth factor 35 years later. Science (New Y ork, NY). 1987;237(4819):1154–1162. doi:10.1126/science. 3306916 28. Sarkar S, Pal R, Mahata S, et al. Evaluation of numerical rating scale and neuropathic pain symptom inventorypain scores in advanced ovarian carcinoma patients undergoing surgery and first-line chemotherapy. Skeletal Radiol.1996;25(1):193–1196. doi:10.1007/s002560050062 29. Liang Y, Xie H, Wu J, Liu D, Yao S. Villainous role of estrogen in macrophage-nerve interaction in endometriosis. Reprod Biol Endocrinol. 2018;16(1):122. 30. Tokushige N, Markham R, Russell P, Fraser IS. Nerve fibres in peritoneal endometriosis. Hum Reprod (Oxford, England) . 2006;21(11):3001–3007. doi:10.1093/humrep/del260 31. Kasheh Farahani Z, Taherianfard M, Naderi MM, Ferrero H. Assessing pain behavioral responses and neurotrophic factors in the dorsal root ganglion, serum and peritoneal fluid in rat models of endometriosis. J Family Reprod Health. 2021;14(4):259– 268. doi:10.18502/jfrh.v14i4.5210 32. Peng B, Zhan H, Alotaibi F, Alkusayer GM, Bedaiwy MA, Yong PJ. Nerve growth factor is associated with sexual pain in women with endometriosis. Reprod Sci (Thousand Oaks, Calif) . 2018;25(4):540 – 549. doi:10.1177/1933719117716778 33. Ahn JH, Choi JM, Kang ES, et al. The anti-endometriotic effect of cyperi rhizoma extract, inhibiting cell adhesion and the expression of pain-related factors through Akt and NF-kB pathways. Medicina (Kaunas) 2022;58(3):335. doi:10.3390/medicina58030335 34. Farahani ZK, Taherianfard M, Naderi MM, Ferrero H. Possible therapeutic effect of royal jelly on endometriotic lesion size, pain sensitivity, and neurotrophic factors in a rat model of endometri- osis. Physiol Rep. 2021;9(22):e15117. doi:10.14814/phy2.15117 35. Tokushige N, Markham R, Russell P, Fraser IS. High density of small nerve fibres in the functional layer of the endometrium in women with endometriosis. Hum Reprod (Oxford, England) . 2006;21(3):782–787. doi:10.1093/humrep/dei368 Yang et al 9

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: oa-pdf

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Condition tags

endometriosisdysmenorrhea

Citation neighborhood

Papers in the corpus that this work cites (lower rings, blue) and that cite this one (upper rings, green). Dot size scales with the paper's in-corpus citation count — bigger dot = more influential within the endo/adeno field. Click a dot to open that paper. [ expand to 2 hops ] — adds papers reached through this work's immediate citers/citees. Heavier; up to 60 extra dots.

References (32)

Source provenance

openalex
last seen: 2026-06-10T17:14:06.276822+00:00
License: CC0 · commercial use OK