{"paper_id":"041916df-a968-424e-a888-e1c0aa8a8b3e","body_text":"Mechanism of Action of Yikun Yitong Ping-\nContaining Serum on Mast Cells and its Possible\nInvolvement in Endometriosis-Related\nDysmenorrhea\nFang Yang, Yonghui Yu and Hong Liu\nAbstract\nBackground: Previously, we showed that Yikun Yitong Ping (YKYTP) can effectively and safely relieve endometriosis-related dys-\nmenorrhea; however, the underlying mechanism remained unclear. This study aimed to assess the effects of YKYTP-containing\nserum on rat basophilic leukemia cell line, as mast cells (MCs) analog, and investigate the mechanisms by which YKYTP alleviates\nendometriosis-related dysmenorrhea. Method: In this study, YKYTP drug-containing serum was used to treat rat basophilic leu-\nkemia cell line (RBL2H3). The effect of YKYTP-containing serum on the expression of ER- α,E R -β, NGF, and NGFRp75 in\nRBL2H3 cells was evaluated using enzyme-linked immunosorbent assay, quantitative real-time polymerase reaction, and Western\nblotting. Results: Different concentrations (5%-40%) of YKYTP-containing serum reduced ER expression in RBL2H3 cells,\nand the optimum concentration was 40%. Compared to the blank group, the expression of ER and NGF signi ficantly increased\nin the E2 group ( P < .01). After co-administration with YKYTP-containing serum, the expression of ER- α, ER- β, NGF, and\nP75 signi ficantly decreased ( P < .01). Conclusion: YKYTP-containing serum can ef ficiently inhibit the expression of ER- α, ER-\nβ, NGF, and P75 in RBL2H3 cells. YKYTP may alleviate endometriosis-related dysmenorrhea by downregulating ER expression\nin MCs.\nKeywords\nChinese medicine, endometriosis, estrogen receptor, mast cells, nerve growth factor\nReceived: October 5th, 2023; Accepted: January 16th, 2024.\nIntroduction\nEndometriosis is de fined as the presence of functioning endo-\nmetrium outside of the uterine cavity with an unclear pathogen-\nesis.1,2 It presents with dysmenorrhea, dyspareunia, pelvic\ndiscomfort, and infertility 1,2 and mainly affects women of\nreproductive age, with a prevalence of about 10%. 3\nRecurrence and side effects restrict the ef ficacy of current treat-\nments of endometriosis, such as surgical resection and hormone\ntherapy.\n4–6 In China, people with endometriosis bene fit from\ntraditional Chinese medicine (TCM) for treating dysmenorrhea\nbrought on by endometriosis, enhancing fertility, and reducing\nrecurrence.\n7–9 Prof. Xurun San, a TCM expert, developed an\nherbal drug, namely Yikun Yitong Ping (YKYTP), which effec-\ntively and safely treated endometriosis-related dysmenorrhea in\nour previous study.\n10 However, the mechanism by which\nYKYTP ameliorates endometriosis-associated dysmenorrhea\nremained unclear.\nAlthough the exact causes of endometriosis-related dysme-\nnorrhea have not been uncovered, estrogen-dependent neuroin-\nflammation has been implicated in dysmenorrhea caused by\nendometriosis.4,11 Based on some reports, endometriosis is a\nsystemic illness caused by immunological and endocrine pertur-\nbation.12,13 Mast cells (MCs) are important components of the\nimmune system and play a key role in allergic response. 12 Some\nresearchers hypothesized that the number and degranulation\nrate of MCs increase in endometriotic lesions. 2,14,15\nInterestingly, recent studies reported that estrogen activates\nMC in endometriosis and showed that treatment with estrogen\n(E2) promotes the recruitment of degranulation of MCs. 16–20\nLin et al21 reported that estrogen receptors (ERs) are expressed\non MCs. Further studies have demonstrated that activated MCs\ncan release nerve growth factor (NGF), which can promote\nDepartment of Gynecology of Traditional Chinese Medicine, China-Japan\nFriendship Hospital, Beijing, China\nCorresponding Author:\nHong Liu, Department of Gynecology of Traditional Chinese Medicine, China-\nJapan Friendship Hospital, Ying Hua Yuan East Street, Chao Yang District,\nBeijing, China.\nEmail: liuhong_19720222@sina.com\nCreative Commons Non Commercial CC BY-NC: This article is distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 Licens e\n(https://creativecommons.org/licenses/by-nc/4.0/) which permits non-commercial use, reproduction and distribution of the work without furth er permission\nprovided the original work is attributed as speci fied on the SAGE and Open Access page (https://us.sagepub.com/en-us/nam/open-access-at-sage).\nOriginal Research Article\nNatural Product Communications\nVolume 19(2): 1 –9\n© The Author(s) 2024\nArticle reuse guidelines:\nsagepub.com/journals-permissions\nDOI: 10.1177/1934578X241229929\njournals.sagepub.com/home/npx\n\n\nnerve growth and induce peripheral sensitization in\nendometriosis-related dysmenorrhea. 2,12,22 These findings sug-\ngested that high levels of local estrogen may be a key factor for\nrecruiting and activating MCs. In our previous animal studies,\nwe found that NGF expression is higher in rats with adenomyo-\nsis compared to control rats. We also observed that treatment\nwith YKYTP decreased the expression levels of NGF .\n23\nTherefore, we hypothesized that YKYTP can reduce the\nexpression levels of NGF in MCs by blocking ER in these cells.\nIn the current study, we measured the expression levels\nof estrogen receptor- α (ER- α), estrogen receptor- β\n(ER- β), NGF, and NGFRp75 in a rat basophilic leukemia\ncell line (RBL2H3) after treatment with E2, fulvestrant\n(an estrogen inhibitor), and YKYT to explore the mecha-\nnism by which YKYTP mitigates endometriosis-associated\ndysmenorrhea.\nMethods\nReagents and Antibodies\nβ-Estradiol 17-acetate (HY) and fulvestrant (HY-13636) were\npurchased from Haoyuan Chemexpress (Shanghai, China).\nRat estradiol receptor (MM-0273R2) was obtained from\nMianmian Biology (Jiangsu, China). TRIzol Reagent\n(CW0580S), HiFiScript cDNA (CW2569 M), UltraSYBR\nMixture (CW0957 M), Ultrapure RNA (CW0581 M), and\nBCA Protein Assay Kit (CW0014S) were all purchased from\nCoWin Biosciences (Jiangsu, China).\nCell Culture and Treatment\nRat basophilic leukemia cell line (RBL2H3), as the counterpart\nof mucosal MC, was purchased from the Chinese Academy of\nSciences (Beijing, China). At 37 °C with 5% CO\n2, cells were\ngrown in Dulbecco ’s modi fied Eagle ’s medium provided by\nKeyGEN Biotech in China. In addition, 10% fetal bovine\nserum and 1% antibiotic solution (100 U/mL penicillin and\n0.1 mg/mL streptomycin) were added to the culture media.\nFor each experiment, cells in the logarithmic phase of growth\nwere employed.\nPreparation of YKYTP\nThe Pharmacy Division of the China-Japan Friendship\nHospital (Beijing, China) provided all medicinal herbs for\nYKYTP decoction, and Professor Runsan Xu of the hospital\nprovided identi fication. Table 1 comprises their Chinese\nnames, English names, Latin names, family, proportions in\nthe drug, countries of origin, and daily adult dosages (g).\nThe combination of the components was cooked in 8\nvolumes of water (v/w) for 60 min, followed by 2 extraction\nsteps to prepare YKYTP . The clinical preparation process\nw a st h es a m e .Y K Y T Pw a se x t r a c t e da n dk e p ti na−20 °C\nfreezer until usage.\nAnimals and Drugs\nTwenty male Sprague-Dawley (SD) rats, aged 4 to 5 weeks\nand weighing between 240 and 300 g, were obtained from\nBeijing Vital River Laboratory Animal Technology Co., Ltd\n(China). The Animal Ethics Committee of China-Japan\nFriendship Hospital approved the protocol of this study\n(No: 190205).\nAnimals had free access to water and food and were kept\nin a pathogen-free (SPF) environment (22-24 °C, 50%-70%\nhumidity, and a 12:12 h light:dark cycle). The health status\nof rats was checked once a day while they were housed,\nand no abnormalities were found. After 1 week of adapting\nto the new diet, 20 rats were randomly divided into 2\ngroups: a saline-treated control group and a\nYKYTP-containing serum-treated group. The drug\n(100 mL/g of body weight) was given twice daily for 3 con-\nsecutive days, equivalent to a human dosage based on body\nsurface area.\nAt the end of the experiment, euthanasia was accom-\nplished using pentobarbital sodium and cervical dislocation\nto lessen the pain and distress of animals. The rats were\nweighed and then given a lethal dose of pentobarbital\nsodium (45 mg/kg, Sigma, USA) intraperitoneally 1 h after\nthe last dose of YKYTP . Subsequently, blood samples were\ncollected from the aorta with stri ct sterility. After centrifug-\ning blood samples for 5 min at 2000 r/min, serum samples\nwere extracted. Serum samples from the same group were\nTable 1. The Composition of Yikun Yitong Ping (YKYTP). 23\nChinese name (voucher\nnumber) English name/Latin name Daily adult dose (g) Family Part used Origin\nHuangqi (1803110) Milkvetch Root/Radix astragali membranacei 30 Papilionoideae Root Gansu\nShuizhi (901102002) Leech/Whitmania pigra 10 Hirudo Worm Jiangsu\nJixinzi (180912) Garden Balsam Seed/Impatiens balsamina L 10 Impatiens Seed Hebei\nZelan (1910067) Eupatorium/Aconitum gymnandrum Maxim 10 Ranunculus Grass Anhui\nHuangbai (HEA161) Cork tree/Cortex phellodendri 10 Ruta Bark Sichuan\nHeshouwu (DD7201) Tuber Fleece flower Root/Polygonum\nmultiflorum\n25 Polygonaceae Root Zhejiang\nSanqifen (200281553) pseudo-ginseng powder/Radix pseudoginseng 3 Acanthopanax Root Yunnan\n2 Natural Product Communications\n\nm i x e da n di n a c t i v a t e di n5 6° Cw a t e rf o r3 0m i nt op r e v e n t\nviral and other interferences. The samples were stored at\n−20 °C until assay.\nGrouping and Intervention\nRBL2H3 cells were divided into 5 different groups. Group 1\nserved as the control group; group 2 received estradiol\n(500 pmol/L); group 3 received fulvestrant (10-5 mol/L),\nan estradiol inhibitor; group 4 received both estradiol\nand fulvestrant (E2 + F group); and group 5 received\nestradiol and 40% drug-containing serum (E2 + YKYTP\ngroup). After 24 h of culture, cells from each group were\nanalyzed.\nEnzyme-Linked Immunosorbent Assay\nThe cells were seeded in plates before treatment. After 24 h,\n1.5 mL of growth media was collected from each well, and rat\nER level was analyzed using enzyme-linked immunosorbent\nassay (ELISA). After collecting the supernatant at each time\npoint, we measured protein levels using an ELISA kit\n(MeiMian, JS, China) and according to manufacturer ’s\ninstructions. The operator simultaneously analyzed samples\nand calibration standards to generate a standard curve of\noptical density based on ER concentration. Finally, we calcu-\nlated ER concentration for each sample based on the stan-\ndard curve.\nQuantitative Real-Time Polymerase Chain Reaction\nThe mRNA expression of the ER was measured using real-\ntime polymerase chain reaction (RT-PCR). TRIzol reagent\nwas used to extract total RNA following manufacturer ’s\ninstructions (CW0580S, CWBIO, JS, China). Then, an\nUltrapure RNA kit (CW0581M, CWBIO, JS, China) was\nused for reverse transcription following manufacturer ’s\ninstructions. According to the package recommendations,\nStep Plus real-time PCR was used to conduct quantitative\nmeasurements of various gene levels. Biotechnology\nCompany designed the primers (Shanghai, China). Table 2\ndisplays the primer sequences in detail.\nWestern Blotting\nAfter extraction, cells were boiledin the RIPA lysis buffer (Puli Gene\nTechnology Company, Beijing, China). Supernatants were obtained\nduring centrifugation. The SDS-PAGE was used to extract,\nresolve, and transfer the tota l proteins to PDVF membranes.\nMembranes werefirst pre-incubated with primary antibodies at 4 °\nC overnight, washed with TBST buffer, and then re-incubated\nwith the appropriate secondary antibody at room temperature for\n1 h. Chemi DocTM XRS+ w a su s e dt oc l e a na n da n a l y z et h em e m -\nbranes (Bole Life Medical Products Company, Shanghai, China).\nStatistical Analysis\nGraphPad Prism 7.0 was used for analysis, and the results are\npresented as the mean ± standard error. Differences between\nTable 2. Primer Sequences Used in Real-Time PCR.\nPrimer ID Primer sequences Primer length （bp） Production length（bp）\nERα F TGATGAAAGGCGGGATACGA 20 223\nERα R GGTTCAGCATCCAATAAGGCA 21\nNGF F CACCTCTTCGGACACTCTGG 20 294\nNGF R CCGTGGCTGTGGTCTTATC 20\nERβ F CGTTCTGGACAGGGATGAGG 20 251\nERβ R TCTTCGCAATCACCCAGACC 20\nERβ F1 ATCATCGCTCCTCTATGC 18 101\nERβ R1 GCTTCCTCTTCAGTGTCT 18\nERβ F2 TCCCGGCAGCACCAGTAA 18 301\nERβ R2 CCCAGATGCATAATCGCTGC 20\nERβ F3 TGCCAATCATCGCTCCTC 18 125\nERβ R3 GCACAACTGCTCCCACTAAG 18\nERβ F4 CTTTAGCGACCCATTGCC 24 381\nERβ R4 CCATTCCTACTTCATAACACTTGC 20\nP75 F TGGCTACTACCAGGACGAGG 20 248\nP75 R GACCAGGGATCTCTTCGCATT 21\nP75 F1 ACGACCAGCAGACCCATACG 20 61\nP75 R1 AGGTTGCCATCACCCTTGAG 20\nP75 F2 CTGGGTTACCAGCCTGAACATA 22 249\nP75 R2 GCTGGCTAGAACATCAGTCGTC 22\nP75 F3 CACGACCAGCAGACCCATA 19 123\nP75 R3 GGTATCCCCGTTGAGCAGT 19\nβ-actin F GCCATGTACGTAGCCATCCA 20 375\nβ-actin R GAACCGCTCATTGCCGATAG 20\nYang et al 3\n\ngroups were analyzed using 1-way analysis of variance. The\ncut-off for signi ficance was set at P < .05. Post-hoc Tukey ’s\ntest was used for between-group comparisons. Each experi-\nment was conducted at least 3 times.\nResults\nDecreased Expression of ER in RBL2H3 Cells After\nExposure to YKYTP-Containing Serum\nWe cultured RBL2H3 cells and subjected them to various dosages\nof YKYTP to determine whether the concentration of drug-\ncontaining serum was correlated with ER expression. ELISA\nrevealed that the drug-containing serum altered ER expression\nin RBL2H3 cells. Various concentrations of drug-containing\nserum decreased E2 expression. The minimum expression level\nof ER was observed after treatment with 40% drug-containing\nserum (Figure 1A). Although 40% drug-containing serum down-\nregulated the expression level of ER within 10, 30, and 60 min, the\nminimum level of ER was observed after 10 min (Figure 1B).\nELISA Exhibited the Effects of YKYTP Drug-Containing\nSerum on ER Expression in RBL2H3 Cells\nThe protein expression levels of ER in RBL2H3 were detected\nby ELISA (Figure 2). The expression of ER in RBL2H3 cells\nwas signi ficantly increased after treatment with E2, suggesting\nthe role of E2 in RBL2H3 cells. In contrast, ER expression sig-\nnificantly decreased in the anti-E2 (fulvestrant) group compared\nwith the control group. ER expression levels considerably\ndecreased in the E2 + YKYTP group compared to the E2\ngroup, whereas there was no discernible difference in ER\nlevels between the E2 + YKYTP and E2 + anti-E2 groups.\nThe results of ELISA revealed that YKYTP suppressed ER\nlevels in RBL2H3 cells.\nRT-PCR Showed That YKYTP-Containing Serum Reduced\nthe mRNA Levels of ER in RBL2H3 Cells\nWe measured the mRNA level of ER by RT-PCR to verify the\nmechanisms by which YKYTP affects RBL2H3 cells. ELISA\nwas used to measure ER expression level in RBL2H3 cells\n(Figure 3). Treatment with E2 dramatically enhanced ER\nexpression in RBL2H3 cells, indicating that E2 affects these\ncells. However, ER expression levels were considerably lower\nin the fulvestrant group than in the control group. ER expres-\nsion was considerably lower in the E2 + YKYTP group than\nin the E2 group. However, ER expression was not signi ficantly\ndifferent between the E2 + YKYTP group and the E2 +\nanti-E2 group ( P > .05).\nFigure 1. ER level in various concentrations of YKYTP-containing serum. ELISA showed that the expression levels of ER decreased in RBL2H3\ncells after 10, 30, and 60 min of treatment with various concentrations of drug-containing serum. The most effective concentration of\ndrug-containing serum was 40%, and the minimum level of ER expression was observed after 10 min.\n4 Natural Product Communications\n\nRT-PCR Indicated That YKYTP-Containing Serum\nSuppressed the Expression of NGF\nNGF is released by MC degranulation; thus, we examined the\nmRNA levels of NGF to investigate the effect of YKYTP on\nRBL2H3 cell degranulation. RT-PCR exhibited that NGF\nmRNA levels were signi ficantly higher in the E2 group than in\nthe control group; however, the mRNA levels of NGF consider-\nably reduced after adding YKYTP ( P < .01). These findings\nsuggest that YKYTP can inhibit E2-induced degranulation of\nRBL2H3 cells.\nWestern Blotting Exhibited That YKYTP-Containing\nSerum Downregulated ER- α, ER-β, NGF, and P75\nProteins\nUsing Western blotting, we assessed the protein levels of ER- α,\nER-β, NGF, and P75 to delve into the mechanism by which\nYKYTP controls ER and RBL2H3 cell degranulation.\nFollowing E2 therapy, a dramatic increase was observed in\nthe expression levels of ER- α,E R - β, NGF, and P75\n(Figure 4). The protein levels of ER- α, ER- β, NGF, and P75\ndramatically reduced when YKYTP was introduced. There\nwas no statistically signi ficant difference between the E2 +\nanti-E2 group and the E2 + YKYTP group concerning the\nexpression levels of ER- α, ER- β, NGF, and P75 ( P > .05).\nBased on these findings, YKYTP may regulate ER- α and\nER-β expression to suppress the release of NGF and P75 via\nMC degranulation.\nDiscussion\nHere, we showed that YKYTP-containing serum can suppress ER\nexpression in RBL2H3 cells, which means YKYTP can prevent\nMC degranulation by inhibiting ER. NGF and P75 both were\nupregulated in RBL2H3 cells following treatment with E2 while\ndownregulated after adding YKYTP , suggesting that YKYTP\nmay suppress ER-mediated NGF and P75 release by MCs.\nChronic pelvic discomfort, dysmenorrhea, and infertility\nare hallmarks of endometriosis, a prevalent gynecological\ndisease that undermines patients ’ quality of life, physical\nand emotional health, and productivity.\n24 Our previous clin-\nical investigation validated the ef ficacy and safety of YKYTP\nin the management of dysmenorrhea caused by endometri-\nosis\n10; however, the mechanism by which YKYTP mitigates\nendometriosis-related dysm enorrhea remained unclear.\nEstrogen-dependent neuroin flammation has been\nimplicated in the pathogenesis of endometriosis-related\nFigure 2. ER expression in 5 different groups of RBL2H3 cells. (A) RBL2HS cell growth in different groups. (B) The protein expression levels of\nER by RBL2H3 cells were detected by ELISA. The expression levels of ER increased by E2 ( P < .01), while decreased by YKYTP ( P < .01).\nYang et al 5\n\ndysmenorrhea.3,25,26 Previous findings suggested that E2 may\nincrease NGF and P75 levels in peritoneal endometriosis by\nincreasing in flammation-nerve interactions.\n11 As a key player\nin neuropathic pain, NGF is involved in various processes,\nincluding pain sensation, brain plasticity, immune cell aggrega-\ntion, and in flammatory factor release.\n12,13,27,28 Previous studies\nindicated that increased E2 levels play a critical role in MC degra-\nnulation and recruitment and induce the release of NGF . 20,29\nIncreased expression of NGF and platelet-derived growth\nfactor in endometriotic lesions may also induce the ingrowth of\nnerve fibers into endometriotic tissue, which causes pain and\nlocal tenderness.18,29–32 Researchers have shown that NGF and\nP75 are overexpressed in patients with endometriosis compared\nto those without endometriosis, suggesting that these factors are\ninvolved in disease pathogenesis.\n33–35 We previously observed\nthat YKYTP can suppress NGF and P75 expression in the rat\nmodel of adenomyosis.23 In this study, we set out to investigate\nwhether YKYTP regulates ER expression in MCs and neurons.\nWe employed a rat basophilic leukemia cell line, which is\nwidely used for in-vitro studies of MCs, to assess our hypothesis\n(RBL2H3). The results of RT-PCR, Western blotting, and\nELISA showed that treatment with estradiol (E2) increased\nthe expression of ER and NGF, suggesting that E2 can\ninduce RBL2H3 cells to release NGF by regulating the expres-\nsion of ER. Our findings were consistent with those reported by\nZhu et al .\n8 Based on these findings, E2 was identi fied as a key\nmediator involved in in flammation-nerve crosstalk in\nendometriosis-associated dysmenorrhea.\nConsistent with ELISA, Western blotting indicated markedly\nreduced protein levels of ER- α, ER-β, NGF, and P75 in the E2\n+ YKYTP group compared to the E2 group. In addition, com-\npared to the E2 group, the E2 + YKYTP group had consider-\nably decreased mRNA levels of ER and NGF . Our data showed\nthat YKYTP can mitigate endometriosis-induced dysmenor-\nrhea by reducing ER levels and preventing ER-mediated\nNGF release by MCs. There was no difference in the expression\nFigure 3. mRNA levels of ER and NGF in different groups. RT-PCR indicated that the mRNA levels of ER and NGF significantly increased after\ntreatment with E2 ( P < .01), and decreased after treatment with YKYTP ( P < .01).\nFigure 4. ER, NGF, and P75 protein expression in different groups. Western blotting revealed that the protein levels of ER- α, ER-β, NGF, and\nP75 signi ficantly increased after treatment with E2 ( P < .001) and decreased after treatment with YKYTP ( P < .001).\n6 Natural Product Communications\n\nlevels of ER and NGF between the E2 + YKYTP group and\nthe E2 + F group. Compared to estrogen inhibitors, the ef ficacy\nand safety of YKYTP have been veri fied in clinical settings.\nWe conclude that E2 mediates in flammation-nerve crosstalk\nin endometriosis-associated dysmenorrhea by stimulating MC\ndegranulation and NGF release. We also observed that\nYKYTP-containing serum decreased ER expression in\nRBL2H3 cells, thereby inhibiting their activation and reducing\nNGF release (Figure 5). YKYTP may alleviate endometriosis-\nrelated dysmenorrhea via downregulating ER expression in\nMCs. Our findings can advance the use of TCM in the treatment\nof endometriosis. However, RBL2H3 cells were used in this\nstudy, they do not behave the same as MCs in patients with endo-\nmetriosis. Therefore, future studies should employ rat models of\nendometriosis and primary MCs from the peritoneal fluid of\npatients with endometriosis to unravel the mechanisms by\nwhich YKYTP improves endometriosis-related dysmenorrhea.\nAccording to these data, we showed that YKYTP-containing\nserum can suppress ER expression in RBL2H3 cells, suggesting\nthat YKYTP can prevent MC degranulation by inhibiting ER.\nNGF and P75 both were upregulated in RBL2H3 cells follow-\ning treatment with E2 while downregulated after adding\nYKYTP , suggesting that YKYTP may suppress ER-mediated\nNGF and P75 release by MCs. Therefore, we can assume\nthat YKYTP inhibits ER on the surface of RBL2H3 cells to\ninhibit MC degranulation.\nWe conclude that E2 mediates in flammation-nerve crosstalk\nin endometriosis-associated dysmenorrhea by stimulating MC\ndegranulation and NGF release. We also observed that\nYKYTP-containing serum decreased ER expression in\nRBL2H3 cells, thereby inhibiting their activation and reducing\nNGF release (Figure 5). YKYTP may alleviate endometriosis-\nrelated dysmenorrhea by downregulating ER expression in\nMCs. Our findings can advance the use of TCM in the treat-\nment of endometriosis.\nWhile providing insights into the effects of YKYTP on\nthe RBL2H3 cell line, we acknowledge several limitations.\nWe used RBL2H3 cells to explore the possible mechanisms\nby which YKYT affects MCs. However, RBL2H3 cells\npossess the characteristics of MCs rather than being MCs\nin the true sense. They do not behave the same as MCs in\npatients with endometriosis. In addition, we only indirectly\nproved the effect of YKYTP on MC degranulation through\nER, NGF, and P75. Therefore, in future experiments, we\nwill further verify the mechanism by which YKYTP\naffects MCs through animal experiments and measure\nchanges in the number of MCs in the human peritoneal\ncavity. Besides, YKYT is a compound preparation for clin-\nical application with various medicinal constituents. In the\nfuture, we will investigate which speci fic constituent of\nYKYTP plays a speci fic role in endometriosis. Our findings\nmight not be completely generalizable to endometriosis-\nrelated dysmenorrhea in humans due to the complexity of\nhuman MC responses. Additionally, focusing solely on a\nspeci fic cell line limits the comprehensive understanding\nof YKYTP ’s active components. Future studies are\nneeded to address these limitations, aiming to deepen our\nunderstanding and promote the clinical application of\nYKYTP .\nConclusion\nThis study provides a deeper insight into the treatment of\nendometriosis-associated dysmenorrhea with YKYTP and helps\nfind drug targets for pain inhibition. Endometriosis-related dysme-\nnorrhea is treatable, and YKYTP can be prescribed as an alterna-\ntive treatment in clinical settings. Still, more studies are needed to\nfully uncover the underlying mechanisms behind the clinical\nfindings.\nData Availability\nData will be provided by the corresponding author upon a reasonable\nrequest.\nFigure 5. The mechanism by which YKYTP relieves endometriosis-associated dysmenorrhea. YKYTP reduced the expression levels of NGF and\nP75 in MCs by blocking estrogen receptors on Mast Cells.\nYang et al 7\n\nDeclaration of Con flicting Interests\nThe author(s) declared no potential con flicts of interest with respect to\nthe research, authorship, and/or publication of this article.\nEthics Approval\nThe Animal Ethics Committee of China-Japan Friendship Hospital\napproved the protocol of this study (No: 190205).\nFunding\nThe author(s) disclosed receipt of the following financial support for\nthe research, authorship, and/or publication of this article: This\nwork was supported by the Beijing Administration of Traditional\nChinese Medicine (grant number 100108-1-02).\nORCID iD\nHong Liu https:/ /orcid.org/0000-0002-3075-5039\nStatement of Human and Animal Rights\nAll of the experimental procedures involving animals were conducted\nin accordance with the Institutional Animal Care guidelines of Nantong\nUniversity, China, and approved by the Animal Ethics Committee of\nChina-Japan Friendship Hospital, China.\nReferences\n1. Eskenazi B, Warner ML. Epidemiology of endometriosis.Obstet Gynecol\nClin North Am. 1997;24(2):235–258. doi:10.1016/s0889-8545(05)\n70302-8\n2. Lampiasi N. Interactions between macrophages and mast cells in\nthe female reproductive system. Int J Mol Sci. 2022;23(10):5414.\ndoi:10.3390/ijms23105414\n3. Koninckx PR, Fernandes R, Ussia A, et al. Pathogenesis based\ndiagnosis and treatment of endometriosis. Front Endocrinol.\n2021;12:745548. doi:10.3389/fendo.2021.745548\n4. Vannuccini S, Clemenza S, Rossi M, Petraglia F. Hormonal treatments\nfor endometriosis: the endocrine background.Rev Endocr Metab Disord.\n2022;23(3):333–355. doi:10.1007/s11154-021-09666-w\n5. Amro B, Ramirez Aristondo ME, Alsuwaidi S, et al. New understand-\ning of diagnosis, treatment and prevention of endometriosis. Int J\nEnviron Res Public Health. 2022;19(11):6725. doi:10.3390/\nijerph19116725\n6. Kalaitzopoulos DR, Samartzis N, Kolovos GN, et al. Treatment of\nendometriosis: a review with comparison of 8 guidelines. BMC\nWomens Health. 2021;21(1):397. doi:10.1186/s12905-021-01545-5\n7. Lin Y, Hou R, Zhang T, Chung JPW, Wang CC, Zhao R. Ef ficacy\nand safety of Chinese herbal medicine for endometriosis associ-\nated pain. Am J Chin Med. 2022;50(4):1095–1111. doi:10.1142/\ns0192415(22500446)\n8. Gao Q, Shen L, Jiang B, et al. Salvia miltiorrhiza-containing\nChinese herbal medicine combined with GnRH agonist for post-\noperative treatment of endometriosis: a systematic review and\nmeta-analysis. Front Pharmacol. 2022;13:831850. doi:10.3389/\nfphar.2022.831850\n9. Dong P, Ling L, Hu L. Systematic review and meta-analysis of tra-\nditional Chinese medicine compound in treating infertility caused\nby endometriosis. Ann Palliat Med. Dec 2021;10(12):12631–12642.\ndoi:10.21037/apm-21-3425\n10. fang Wq Y. The protective effect and safety evaluation of “YiKun\nYiTong Ping”in the treatment of dysmenorrhea caused by adeno-\nmyosis. J China-Japan Friendship Hosp . 2017;31(4):214 –217.\n11. Greaves E, Temp J, Esnal-Zu fiurre A, Mechsner S, Horne AW,\nSaunders PT. Estradiol is a critical mediator of macrophage-nerve\ncross talk in peritoneal endometriosis. Am J Pathol. Aug\n2015;185(8):2286–2297. doi:10.1016/j.ajpath.2015.04.012\n12. Velho RV, Taube E, Sehouli J, Mechsner S. Neurogenic in flamma-\ntion in the context of endometriosis-what do we know? Int J Mol\nSci. 2021;22(23):13102. doi:10.3390/ijms222313102\n13. Reis FM, Petraglia F, Taylor RN. Endometriosis: hormone regula-\ntion and clinical consequences of chemotaxis and apoptosis. Hum\nReprod Update. 2013;19(4):406–418. doi:10.1093/humupd/dmt010\n14. Godin SK, Wagner J, Huang P, Bree D. The role of peripheral nerve\nsignaling in endometriosis. F ASEB Bioadv. 2021;3(10):802 –813.\ndoi:10.1096/fba.2021-00063\n15. Umezawa M, Sakata C, Tanaka N, et al. Pathological study for the\neffects of in utero and postnatal exposure to diesel exhaust on a rat\nendometriosis model. J Toxicol Sci. 2011;36(4):493\n–498. doi:10.\n2131/jts.36.493\n16. Miller JE, Lingegowda H, Symons LK, et al. IL-33 activates group\n2 innate lymphoid cell expansion and modulates endometriosis.\nJCI Insight. 2021;6(23):e149699. doi:10.1172/jci.insight.149699\n17. Ono Y, Yoshino O, Hiraoka T, et al. IL-33 Exacerbates endo-\nmetriotic lesions via polarizing peritoneal macrophages to M2\nsubtype. Reprod Sci (Thousand Oaks, Calif) . 2020;27(3):869 –876.\ndoi:10.1007/s43032-019-00090-9\n18. Li T, Wang J, Guo X, et al. Possible involvement of crosstalk\nbetween endometrial cells and mast cells in the development of\nendometriosis via CCL8/CCR1. Biomed Pharmacother.\n2020;129:110476. doi:10.1016/j.biopha.2020.110476\n19. Guo X, Xu X, Li T, et al. NLRP3 in flammasome activation of\nmast cells by estrogen via the nuclear-initiated signaling pathway\ncontributes to the development of endometriosis. Front Immunol.\n2021;12:749979. doi:10.3389/ fimmu.2021.749979\n20. Zhu TH, Ding SJ, Li TT, Zhu LB, Huang XF, Zhang XM.\nEstrogen is an important mediator of mast cell activation in\novarian endometriomas. Reproduction (Cambridge, England) .\n2018;155(1):73–83. doi:10.1530/rep-17-0457\n21. Lin K, Zhu L, Zhang X, Lin J. Role of mast cells in estrogen-\nmediated experimental endometriosis in rats. Zhejiang Da Xue\nXue Bao Yi Xue Ban . 2015;44(3):269 –277.\n22. Kleij HP , Bienenstock J. Significance of conversation between mast\ncells and nerves. Allergy Asthma Clin Immunol . 2005;1(2):65-80. doi:\n10.1186/1710-1492-1-2-65\n23. Fang Wq Y. Impact of yikun yitong ping keli on endometrium\nnerve growth factor expression in adenomyosis model mice. J\nTradit Chin Med. 2018;1(1):66–68.\n24. Sorrentino F MDEP, Falagario M, et al. Endometriosis and adverse\npregnancy outcome. Minerva Obstet Gynecol . 2022;74(1):31 –44.\ndoi:10.23736/s2724-606x.20.04718-8\n8 Natural Product Communications\n\n25. Hu L, Zhang J, Lu Y, Fu B, Hu W. Estrogen receptor beta pro-\nmotes endometriosis progression by upregulating CD47 expres-\nsion in ectopic endometrial stromal cells. J Reprod Immunol.\n2022;151:103513. doi:10.1016/j.jri.2022.103513\n26. McCallion A, Nasirzadeh Y, Lingegowda H, et al. Estrogen mediates\ninflammatory role of mast cells in endometriosis pathophysiology.\nFront Immunol. 2022;13:961599. doi:10.3389/fimmu.2022.961599\n27. Levi-Montalcini R. The nerve growth factor 35 years later. Science\n(New Y ork, NY). 1987;237(4819):1154–1162. doi:10.1126/science.\n3306916\n28. Sarkar S, Pal R, Mahata S, et al. Evaluation of numerical rating scale and\nneuropathic pain symptom inventorypain scores in advanced ovarian\ncarcinoma patients undergoing surgery and first-line chemotherapy.\nSkeletal Radiol.1996;25(1):193–1196. doi:10.1007/s002560050062\n29. Liang Y, Xie H, Wu J, Liu D, Yao S. Villainous role of estrogen in\nmacrophage-nerve interaction in endometriosis. Reprod Biol\nEndocrinol. 2018;16(1):122.\n30. Tokushige N, Markham R, Russell P, Fraser IS. Nerve fibres in\nperitoneal endometriosis. Hum Reprod (Oxford, England) .\n2006;21(11):3001–3007. doi:10.1093/humrep/del260\n31. Kasheh Farahani Z, Taherianfard M, Naderi MM, Ferrero H.\nAssessing pain behavioral responses and neurotrophic factors in\nthe dorsal root ganglion, serum and peritoneal fluid in rat\nmodels of endometriosis. J Family Reprod Health. 2021;14(4):259–\n268. doi:10.18502/jfrh.v14i4.5210\n32. Peng B, Zhan H, Alotaibi F, Alkusayer GM, Bedaiwy MA, Yong PJ.\nNerve growth factor is associated with sexual pain in women with\nendometriosis. Reprod Sci (Thousand Oaks, Calif) . 2018;25(4):540 –\n549. doi:10.1177/1933719117716778\n33. Ahn JH, Choi JM, Kang ES, et al. The anti-endometriotic effect of\ncyperi rhizoma extract, inhibiting cell adhesion and the expression\nof pain-related factors through Akt and NF-kB pathways. Medicina\n(Kaunas) 2022;58(3):335. doi:10.3390/medicina58030335\n34. Farahani ZK, Taherianfard M, Naderi MM, Ferrero H. Possible\ntherapeutic effect of royal jelly on endometriotic lesion size, pain\nsensitivity, and neurotrophic factors in a rat model of endometri-\nosis. Physiol Rep. 2021;9(22):e15117. doi:10.14814/phy2.15117\n35. Tokushige N, Markham R, Russell P, Fraser IS. High density of\nsmall nerve fibres in the functional layer of the endometrium in\nwomen with endometriosis. Hum Reprod (Oxford, England) .\n2006;21(3):782–787. doi:10.1093/humrep/dei368\nYang et al 9","source_license":"CC0","license_restricted":false}