Higher Follicular Fluid Progesterone Down-regulated HPGD and COX2 in Granulosa Cells via Suppressing NF-кB Signaling in Endometriosis

In: Research Square · 2021 · doi:10.21203/rs.3.rs-882586/v1 · W3200878029
preprint OA: green CC0
AI-generated summary by gemini-2.5-flash-lite+body, 2026-06-13

Elevated follicular fluid progesterone in endometriosis down-regulates HPGD and COX2 in granulosa cells by suppressing NF-κB signaling.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

AI-generated deep summary by claude@2026-06, 2026-06-10 · read from full text

This preprint investigated how elevated progesterone in follicular/peritoneal fluid affects granulosa cells and ovulation-associated pathways in patients with endometriosis, using matched pairs from 50 ovarian endometriosis patients and 50 controls undergoing IVF/ICSI plus in vitro experiments in KGN granulosa tumor-like cells. It found that endometriosis patients had higher progesterone levels in serum and in follicular/peritoneal fluid, along with reduced granulosa cell expression of HPGD and COX-2 and suppressed NF-κB signaling (including decreased IL1R1 and IRAK3), while in vitro progesterone dose-dependently down-regulated HPGD and COX-2 and reduced NF-κB activity markers (lower pIκBα/IκBα ratio and reduced p65 nuclear translocation), with ChIP identifying a potential p65 binding site in the HPGD promoter; TNF-α showed opposite effects. A key limitation is that mechanistic conclusions rely heavily on a cell line model (KGN) rather than primary granulosa cells, and the study is presented as an unreviewed preprint. This paper is centrally about endometriosis—specifically, it links endometriosis-associated elevated follicular progesterone to down-regulation of HPGD and COX-2 via suppressed NF-κB signaling in granulosa cells and its proposed connection to LUFS/infertility.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Abstract Background: Luteinized unruptured follicular follicle syndrome (LUFS) is a special type of ovulatory dysfunction and a common cause of infertility. It is estimated that its prevalence is 13% ~ 73% in endometriosis patients. Increasing evidences prove that LUFS is one of the reasons for endometriosis-related infertility. Any alteration in FF components and GCs in endometriosis may influence the developing oocyte and ovulation. This study aimed to explore the effect of local elevated progesterone in follicular fluid (FF) on ovulation in endometriosis patients.Methods: A Prospective study with matched pairs design was conducted at a reproductive medicine center between July 2017 and January 2018 in patients undergoing in vitro fertilization (IVF) or intracytoplasmic sperm injection treatment (ICSI), while granulosa tumor-like cell line KGN (Bena culture collection, China) was used as in vitro cell model. Alterations in follicular and peritoneal fluid (PF) components identified with metabolomics analyses; Differentially expressed genes in GCs identified with transcriptome analysis; Polymerase chain reaction (PCR), western blot, enzyme-linked immunosorbent assay (ELISA) and immunofluorescence were used to determine the expression of progesterone, NF-кB related genes, HPGD and COX-2; NF-кB binding identified with chromatin immunoprecipitation (ChIP).Results: Patients with endometriosis exhibited a significantly higher basal serum progesterone level, higher serum level of progesterone on trigger day and higher progesterone expression level in FF and PF. GCs from endometriosis patients revealed decreased expression of HPGD, COX-2 and suppressed NF-кB signaling, as manifested by decreased expressions of IL1R1 and IRAK3. Similarly, progesterone treatment in vitro down-regulated HPGD and COX2 expression and suppressed NF-кB signaling in KGN cells in a dose dependent manner, as manifested by decreased expressions of IL1R1, IRAK3, reduced pIкBα/IкBα ratio and nucleus translocation of p65. TNF-α, by contrast, increased expression of IL1R1, IRAK3, pIкBα, p65 and HPGD in KGN cells. Furthermore, one potential p65 binding site was identified in the promoter region of HPGD by chromatin immunoprecipitation.Conclusion: Endometriosis showed repression of NF-кB pathways and down-regulation of HPGD and COX2, which play important roles in the process of ovulation by participating in the metabolism of prostaglandin E2 (PGE2), in granulosa cells (GCs) due to elevated progesterone in FF.
Full text 126,039 characters · extracted from preprint-html · click to expand
Higher Follicular Fluid Progesterone Down-regulated HPGD and COX2 in Granulosa Cells via Suppressing NF-кB Signaling in Endometriosis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Higher Follicular Fluid Progesterone Down-regulated HPGD and COX2 in Granulosa Cells via Suppressing NF-кB Signaling in Endometriosis Jing-Yi Li, Jian-Peng Chen, Yu-Li Qian, Jun-Yan Ma, Fei-Da Ni, and 12 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-882586/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background: Luteinized unruptured follicular follicle syndrome (LUFS) is a special type of ovulatory dysfunction and a common cause of infertility. It is estimated that its prevalence is 13% ~ 73% in endometriosis patients. Increasing evidences prove that LUFS is one of the reasons for endometriosis-related infertility. Any alteration in FF components and GCs in endometriosis may influence the developing oocyte and ovulation. This study aimed to explore the effect of local elevated progesterone in follicular fluid (FF) on ovulation in endometriosis patients. Methods: A Prospective study with matched pairs design was conducted at a reproductive medicine center between July 2017 and January 2018 in patients undergoing in vitro fertilization (IVF) or intracytoplasmic sperm injection treatment (ICSI), while granulosa tumor-like cell line KGN (Bena culture collection, China) was used as in vitro cell model. Alterations in follicular and peritoneal fluid (PF) components identified with metabolomics analyses; Differentially expressed genes in GCs identified with transcriptome analysis; Polymerase chain reaction (PCR), western blot, enzyme-linked immunosorbent assay (ELISA) and immunofluorescence were used to determine the expression of progesterone, NF-кB related genes, HPGD and COX-2 ; NF-кB binding identified with chromatin immunoprecipitation (ChIP). Results: Patients with endometriosis exhibited a significantly higher basal serum progesterone level, higher serum level of progesterone on trigger day and higher progesterone expression level in FF and PF. GCs from endometriosis patients revealed decreased expression of HPGD , COX-2 and suppressed NF-кB signaling, as manifested by decreased expressions of IL1R1 and IRAK3 . Similarly, progesterone treatment in vitro down-regulated HPGD and COX2 expression and suppressed NF-кB signaling in KGN cells in a dose dependent manner, as manifested by decreased expressions of IL1R1, IRAK3, reduced pIкBα/IкBα ratio and nucleus translocation of p65. TNF-α, by contrast, increased expression of IL1R1, IRAK3, pIкBα, p65 and HPGD in KGN cells. Furthermore, one potential p65 binding site was identified in the promoter region of HPGD by chromatin immunoprecipitation. Conclusion: Endometriosis showed repression of NF-кB pathways and down-regulation of HPGD and COX2 , which play important roles in the process of ovulation by participating in the metabolism of prostaglandin E2 (PGE2), in granulosa cells (GCs) due to elevated progesterone in FF. Endocrinology & Metabolism endometriosis progesterone follicular fluid granulosa cell LUFS PGE2 Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Endometriosis is a chronic gynecologic disorder affecting approximately 10% of women at reproductive age and 40–50% of infertile women [ 1 , 2 ]. It is a complex syndrome manifested by chronic pelvic pain and infertility. The etiology of endometriosis is unknown. However, it is now generally accepted that the main causes are the repeated retrograde travel and survival of shed endometrial tissues in the lower abdominal cavity. Endometriosis-associated pelvic pain is currently managed by suppression of ovulatory menses and estrogen production, cyclooxygenase inhibitors, and surgical removal of pelvic lesions; whereas in vitro fertilization (IVF) is frequently used to overcome infertility. LUFS is a syndrome of failed ovulation in which the follicle does not rupture, despite of the secondary ovulatory changes, such as peak luteinizing hormone (LH), rising progesterone (P), or endometrial secretion transformation [ 3 ]. LUFS is a special type of ovulatory menstruation and a common cause of infertility. The incidence of LUFS is 11–23% in natural menstrual cycle [ 4 ], and is higher in controlled ovarian stimulation cycle; when combined with endometriosis, the incidence of LUFS is 13–73% [ 5 ]. It seems that LUFS is one of the reasons for endometriosis-related infertility. However, the mechanism by which endometriosis causes LUFS is still to be investigated. FF, which consists of a variety of substances, including hormones, immune cells, cytokines, enzymes, anticoagulants, electrolytes, reactive oxygen species, lipids, cholesterol and antioxidants, plays an important role in the growth and development of the follicle [ 6 – 8 ]. Any alteration in FF components may influence the developing oocyte [ 6 ]. The metabolic profile of FF in patients with endometriosis could reflect the metabolic changes in the systemic circulation or alternatively reflect the local inflammation due to endometriosis lesions in the ovary or peritoneal cavity [ 9 ]. GCs have also been proved to play an important role in follicular development [ 10 ]. In patients with endometriosis, abnormalities in GCs might impair oocyte maturation and lead to poor oocyte quality [ 11 ]. Interestingly, as the most neighboring cells to FF, granulosa cells and theca cells of the follicle cooperate with resident and infiltrating immune cells to produce paracrine mediators of ovulation [ 12 , 13 ], many of which are also common in inflammatory responses. While whether and how alteration in FF components affects ovulation in endometriosis by interacting with GCs remain unclear. In the present study, we analyzed the alteration in components of FF from patients with endometriosis compared with control by metabolic spectrum, aiming to find intrafollicular cytokines, steroids, or other small molecule chemicals that might account for the ovulatory dysfunction in endometriosis patients. The differentially expressed genes in corresponding GCs of endometriosis patients were also explored via RNA sequencing. Furthermore, we aimed to identify the mechanism involved in the impairment of ovulation in patients with endometriosis and provide potential therapeutic targets for their ovulation dysfunction. Materials And Methods Ethics approval This study was approved by the medical ethics committee of the Women’s Hospital of Zhejiang University School of Medicine (Ethics Lot number 20170021). We confirm that human study in our experiments was performed in accordance with relevant guidelines and regulations. Study population A total of 100 patients, who underwent IVF or intracytoplasmic sperm injection treatment in the reproductive medical center of the Women’s Hospital of Zhejiang University School of Medicine during July 2017 and January 2018 were enrolled in this study. Of the 100 subjects, there were 50 with ovarian endometriosis and 50 in the control group. Patients with ovarian endometriosis were confirmed by laparoscopy in our hospital. Inclusion criteria included regular menstrual cycle (23-35 days), unilateral endometrioma (≥5 cm) and normal ovarian reserve (serum anti-Mullerian hormone level of > 1 ng/mL, antral follicular count > 4 and basal serum follicle-stimulating hormone level of <10 IU/L). Patients aged over 35 years, treated by steroid hormones, with pelvic inflammatory disease, endocrine diseases, unexplained infertility, with immune disease, or chromosomal abnormalities were excluded. Tubal blockage or male-factor infertility as two isolated causes comprised the control group. Follicular Fluid and GC Isolation During surgery, FF was collected using a new aspiration needle when the first and largest follicle of the ovary was punctured and with a flushed needle for the first follicle of the other ovary. Only FF samples free of blood contamination upon both visual and microscopic examination and that contained mature (MII) oocytes were analyzed. Samples were centrifuged at 2900 rpm for 10 minutes to remove cell debris before being stored. GCs samples was collected on the oocyte retrieval day according to the protocol [14]. Firstly, GCs were centrifuged at 340 × g for 5 minutes. Then they were gathered from the pellet with Ficoll solution (Lymphoprep; Axis-Shield, Norway) by density gradient centrifugation at 340 × g for 15 minutes. After that, GCs were resuspended in red blood cell lysis buffer (Beyotime, China) for purification and washed with phosphate-buffered saline solution (PBS; Gibco, USA). Both the FF and the GCs were stored at -80℃ until analysis. Hormone and PGE2 Measurements Serum hormone levels on days 2–5 of the menstrual cycle and trigger day of IVF, including FSH, LH, estradiol (E 2 ), P and testosterone (T) levels in serum, as well as the level of P and PGE2 in FF were measured using ELISA kit following the manufacturer’s protocol (Beckman Coulter UniCel DxI 800, USA). Cell culture and treatment Granulosa tumor-like cell line KGN (Bena culture collection, China) was used as in vitro cell model [15]. Cells were cultured in RPMI medium (Hyclone, Logan, UT, USA) containing 10% fetal bovine serum (FBS, Biological Industries, Kibbutz Beit-Haemek, Israel), which were incubated at 37 ℃ and 5% CO 2 in air. After 48 h of cell culture, the cells were pre-incubated in the serum-free medium for 12 h. Then the cells were cultured in serum-containing medium with progesterone dissolved with DMSO (1 × 10 -6 , 1 × 10 -5 , 1 × 10 -4 , 1 × 10 -3 , 1 × 10 -2 nmol/L; sigma, USA) for 48 h or TNF-α (0–50 ng/mL; Sino Biological, China) for 10 h. Control cultures were exposed to medium added with the same volume of DMSO. Another group of cells were cultured in serum-containing medium with progesterone (1 × 10 -4 nmol/L) for 0, 5, 15, 30, 60, 120 minutes respectively to explore the effects of progesterone on NF-кB signaling in vitro . Quantitative Real-time PCR Analysis The q-PCR analysis was carried out using SDS 2.3 software in 7900HT Fast Real-Time PCR System (Applied Biosystems, USA) according to the standard protocol (see in detail in supplementary methods). Western blot analysis Proteins were extracted from human GCs or KGN cells, and lysed by RIPA lysis buffer (Cell Signaling Technology, USA) according to the manufacturer's protocol [16]. Western blot analysis were conducted according to the standard protocol (see in detail in supplementary methods). Immunofluorescence The cells pre-treated with progesterone (1 × 10 -4 nmol/L) for 0, 5, 15, 30, 60, 120 minutes respectively and immunofluorescence analysis were conducted according to the standard protocol (see in detail in supplementary methods). Chromatin Immunoprecipitation In vivo crosslinking of proteins was performed by incubating KGN cells pretreated with TNF-α with 1% formaldehyde for 15 minutes at room temperature. After neutralization with glycine, cell lysates were vortexed with glass beads in lysis buffer containing 100 mM HEPES-KOH pH 7.5, 1% Triton X-100, 0.1% sodium deoxycholate, 1 mM EDTA, 140 mM NaCl, 2X cOmplete ULTRA Tablets (protease inhibitors, Roche, Switzerland), 1 mM phenylmethylsulphonyl fluoride, 50 mM NaF and 0.2 mM Na 3 VO 4 . Samples were then sonicated using a Covaris-S2 sonicator (Covaris, USA) to shear chromatin DNA into fragments of 100 to 500 bp. Immunoprecipitation of P65 bound to chromatin was performed using protein G Sepharose beads that were coupled to a rabbit monoclonal anti-p65 antibody (8242S, 1:100, Cell Signaling Technology, USA). Bead washes and elution, reverse cross-linking, and DNA precipitation were performed according to the Pierce Agarose ChIP Kit manual. Rabbit IgG was used as negative control. PCR was carried out later using different sets of primers spanning the HPGD promoter to verify the binding. The primer succeeded to detect a band in our ChIP-PCR assay is HPGD -F (-1333): 5'-TTATGGGGTGGGAGGGAGAC-3', HPGD -R (-1189): 5'- TTCTGTCACCTCAGCATGCA -3'. Transcriptome analysis Total RNA was extracted from cell by Trizol reagent (Invitrogen, USA). The RNA quality was checked by Bioanalyzer 2200 (Aligent, USA) and kept at -80℃. RNA with RIN >8.0 was used for rRNA depletion. The cDNA libraries of each pooled RNA sample for single-end sequencing were prepared using Ion Total RNA-Seq Kit v2.0 (Life Technologies, USA) according to the manufacturer’s instructions. The cDNA libraries were processed for the Proton Sequencing process according to the commercially available protocols. Clean reads obtained from the raw reads by removing the adaptor sequences, reads with >5% ambiguous bases (noted as N) and low-quality reads containing more than 20 percent of bases with qualities of <13 were aligned to the human reference genome sequence GRCh38 (ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/000/001/405/GCA_000001405.15_GRCh38) using the MapSplice program (v2.1.6) [17]. Alternative Splicing Detector (ASD, available on http://www.novelbio.com/asd/ASD.html) was used as the tool to detect the differentially alternative splicing cases based on the bam file after mapping according to the P threshold ( P <0.05) [18]. HTseq was used to count gene and RPKM method was used to normalize gene expression level [19]. DEseq algorithm was used to identify the differentially expressed genes under the criteria that fold change > 1.5 and FDR < 0.05 [20]. Gene ontology (GO) analysis was performed to facilitate elucidating the biological implications of unique genes in the significant or representative profiles of the differentially expressed genes in the experiment [21]. GO annotations were integrated from NCBI (http://www.ncbi.nlm.nih.gov/), UniProt (http://www.uniprot.org/) and the Gene Ontology (http://www.geneontology.org/). Pathway analysis was used to find out the significant pathway of the differential genes according to KEGG database. Fisher’s exact test were applied to identify the significant GO categories and pathways, and the false discovery rate (FDR) was used to correct the P -values. [22]. Statistical analysis The results are presented as mean ± SEM. Quantitative variables were analyzed using Student's t-test for comparison between two groups. Statistical analysis was performed with Statistical Package for Social Sciences version 22.0 (SPSS 22.0). P < 0.05 was considered statistically significant. Results Clinical Characteristics of all Participants A total of 50 patients with ovarian endometriosis and 50 controls were recruited in the present study. The baseline characteristics between endometriosis group and control group were comparable ( P > 0.05), including age, body mass index (BMI), duration of infertility, mature, premature, abortion, existence, antral follicle count (AFC), total gonadotrophin dosage and retrieval oocytes (Table 1 ). Table 1 Clinical Characteristics of all Participants. Control Endometriosis P Number (n) 35 35 Age (y, mean ± SD) 29.229 ± 2.680 29.314 ± 2.752 0.8954 Body mass index (kg/m², mean ± SD) 21.375 ± 2.039 20.660 ± 2.441 0.1875 Duration of infertility (y, mean ± SD) 3.886 ± 2.374 3.400 ± 2.376 0.3952 Mature (n, mean ± SD) 0.057 ± 0.236 0.086 ± 0.284 0.6483 Premature (n) 0 0 Abortion (n, mean ± SD) 0.343 ± 0.684 0.200 ± 0.531 0.3324 Existence (n, mean ± SD) 0.057 ± 0.236 0.086 ± 0.284 0.6483 AFC (n, mean ± SD) 8.429 ± 3.791 7.943 ± 5.252 0.6587 Total Gn dogase (IU, mean ± SD) 2143.786 ± 778.794 1969.693 ± 876.802 0.3829 Basal FSH (IU/L, mean ± SD) 6.605 ± 1.725 7.453 ± 2.540 0.1931 Basal LH (IU/L, mean ± SD) 5.328 ± 2.284 5.210 ± 3.128 0.8578 Basal E2 (pmol/L, mean ± SD) 96.327 ± 26.497 109.410 ± 36.801 0.0924 Basal P (nmol/L, mean ± SD) 1.767 ± 0.428 2.124 ± 0.712* 0.0135 Basal T (nmol/L, mean ± SD) 0.549 ± 0.408 0.483 ± 0.458 0.5266 LH on trigger day (IU/L, mean ± SD) 2.444 ± 1.946 2.613 ± 2.495 0.7531 E2 on trigger day (nmol/L, mean ± SD) 11.051 ± 6.070 12.348 ± 11.762 0.5641 P on trigger day (nmol/L, mean ± SD) 2.643 ± 1.196 3.285 ± 1.395* 0.0472 Retrieval oocytes (n, mean ± SD) 12.029 ± 6.560 11.229 ± 8.117 0.6516 Values were given as mean ± standard deviations. p values were obtained using unpaired one tail t-test. P < .05 was considered statistically significant (n = 50). AMH: anti-mullerian hormone; AFC: antral follicle count; E2: estradiol; FSH: follicle-stimulating hormone; LH: luteinizing hormone; P: progesterone; T: testosterone. * P < .05. Elevated circulating progesterone in serum, PF and FF of endometriosis patients To gain a better understanding of component changes in local endometriosis circulating, metabolomics analyses was conducted in PF and FF from both endometriosis group (n = 15) and control group (n = 15). Interestingly, we found that the only overlapping metabolic alteration between PF and FF from endometriosis patients is the higher expression levels of progesterone (1.105 ± 0.019 vs 0.852 ± 0.025, P = 0.048) (Fig. 1 A). To confirm metabolomics observations, the levels of reproductive hormone including FSH, LH, E2, T and P were further measured in both serum and FF from patients in endometriosis group and control group (n = 35). We found no differences in serum levels of FSH, LH, E2 and T on D2-5 (the second to the fifth day of menstrual cycle) and trigger day between the two groups ( P > 0.05, respectively) (Table 1 ). However, compared with controls, higher levels of basal serum P (2.124 ± 0.020 nmol/L vs 1.767 ± 0.012 nmol/L, P = 0.014) (Fig. 1 B) and higher serum levels of P on trigger day (3.285 ± 1.395 nmol/L vs 2.643 ± 1.196 nmol/L, P = 0.047) (Fig. 1 C) were observed in endometriosis group, as well as significantly higher levels of P in FF (47.766 ± 9.612 nmol/L vs 39.519 ± 8.197 nmol/L, P = 0.008) (Fig. 1 D). Decreased expression of HPGD and COX-2 in GCs of endometriosis patients To explore the effects of elevated P in FF on oocyte development and ovulation in endometriosis, we compared the genome-wide expression profiles of GCs from patients in both endometriosis group and control group (n = 6) via RNA sequencing. According to the sequence data, we identified 98 downregulated and 77 upregulated genes in GCs of endometriosis patients compared with controls (Supplementary table 1, Fig. 2 A). HPGD , which play an important role in the expression of PGE2, is one of those down-regulated genes with statistical significance. RT q-PCR and Western-blot were carried out on a larger size of GCs samples from endometriosis patients (n = 20) and controls (n = 20) to confirm the differences in HPGD expression levels (Fig. 2 B). COX-2, another key enzyme in the synthesis of PGE2, was also confirmed to be down-regulated in GCs samples from endometriosis patients (Fig. 2 C). PGE2 concentrations were further confirmed by ELISA in FF from both groups (n = 35) to explore the effects of decreased HPGD and COX2 on PGE2 levels. The results showed that PGE2 concentrations in FF from EMT group were higher than that in control group (400.663 ± 68.061 ng/L vs 330.791 ± 58.755 ng/L, P < 0.001) (Fig. 2 D). Repressed NF- к B signaling activity in GCs of endometriosis patients As shown by gene ontology (GO) analysis, many down-regulated genes in GCs from endometriosis group were involved in NF-кB associated pathways including IL-1 mediated signaling, cytokine mediated signaling and Myd88-dependent toll-like receptor signaling pathways (Fig. 3 A). The involved genes include IL1R1 (-0.645 fold, P = 0.028), a receptor for IL-1, acting as an important pro-inflammatory cytokine in the NF-кB pathway; MAP3K1 (-0.738 fold, P = 0.100), involved in one of the upstream pathways of NF-кB pathway ERK/MAPK signaling pathway, and IRAK3 (-0.674 fold, P = 0.030), an important NF-кB signaling molecule (Supplementary Table 1). Similarly, RT q-PCR and Western blot were carried out on a larger size of GC samples from endometriosis patients (n = 20) and controls (n = 20) to confirm the differential expression of these molecules (Fig. 3 B, 3 C). Furthermore, decreased activation of IкBα and p65, two other important NF-кB signaling molecules were also confirmed in GCs from endometriosis patients via Western blot (Fig. 3 C). Effects of progesterone on HPGD and COX-2 expression and NF-кB signaling in GCs in vitro Given the suppressed NF-кB signaling and downregulated HPGD and COX-2 expression in GCs from endometriosis patients, we further explored whether these alterations were due to elevated P in FF. KGN cells were treated with P at different concentrations (1 × 10 − 6 , 1 × 10 − 5 , 1 × 10 − 4 , 1 × 10 − 3 , 1 × 10 − 2 nmol/L) in vitro . RT q-PCR and western blot revealed decreased expressions of ILIR1 and IRAK3, as well as HPGD and COX-2 (Fig. 4 A, 4 B, 4 C) by P treatment in a dose dependent manner, which was most obvious at a concentration of 1 × 10 − 4 nmol/L in KGN cells. The time-dependent effects of progesterone treatment (1 × 10 − 4 nmol/L) on NF-кB signaling in KGN cells was further investigated. Given that nuclear translocation of p65 is also a key step for NF-кB signaling transduction, the expression and localization of p65 were identified by Western blot on both cytoplasmic and nuclear protein and immunofluorescence in KGN cells respectively. The ratio of pIкBα/ IкBα in whole cell lysates were also determined by Western blot. The results revealed decreased NF-кB signaling activity by progesterone treatment in vitro in a time-dependent manner, which reached a plateau after 30 minutes of treatment, as manifested by the decreased ratio of pIкBα/ IкBα and reduced nucleus translocation of p65 (Fig. 4 D, 4 E, 4 F). Direct regulatory effects of NF-кB signaling on HPGD expression KGN cells were exposed to TNF-α (50 ng/mL) to explore whether the activation of NF-кB signaling can up-regulate the expression of HPGD . The results showed that TNF-α not only obviously enhanced the transduction of NF-кB signaling by up-regulating pIкBα, p65, IL1R1 and IRAK3, but also up-regulated the expression of HPGD as expected (Fig. 5 A, 5 B). ChIP-PCR was conducted on KGN cells to explore whether there were binding elements for p65, an important downstream transcriptional factor, located at the promoter region of HPGD . We used PROMO (a virtual laboratory for the identification of putative transcription factor binding sites (TFBS) in DNA sequences from a species or groups of species of interest) and LASAGNA-Search 2.0 (Integrated Transcription Factor Binding Site Search and Visualization in a Browser) to search for the potential p65 binding sites in the promotor region of HPGD . After verified by ChIP-PCR, one potential p65 binding site was identified in the HPGD promoter (starting at 1261 bp upstream of the transcription start site, 5’-AGGAAAATTTCCAA − 3’) (Fig. 5 C, 5 D). Discussion The present study showed a significantly elevated progesterone level in local circulating of endometriosis patients. Accordingly, NF-кB signaling was down-regulated in GCs derived from those patients, as manifested by decreased expression of IL1R1, IRAK3, reduced activation of IкBα and p65, compared with those of controls. HPGD and COX-2 were further found to be down-regulated in endometriosis GCs, positively correlating with NF-кB signaling activation, and negatively associated with intrafollicular progesterone levels. Similarly, progesterone suppressed NF-кB signaling and reduced HPGD and COX-2 expression in vitro in KGN cells. The NF-кB activator TNF-α, by contrast, up-regulated HPGD expression. Furthermore, one potential binding element for p65 was identified in the promoter regions of HPGD by ChIP-PCR, suggesting a direct role of NF-кB signaling in regulating HPGD expression. Previous evidence showed that in women with moderate or severe endometriosis, some intrafollicular inflammatory cytokines were upregulated, unparallel with intrafollicular hormone concentrations [ 23 , 24 ]. This may be due to the inflammatory microenvironment in women with endometriosis, impairing ovarian function and contributing to the reproductive dysfunction in endometriosis. However, whether some small molecular metabolites contribute to endometriosis-related ovulatory dysfunction is unknown. We collected both PF and FF from patients with ovarian endometriosis and control patients to explore the changes in the intrafollicular environment. Metabolic spectrum analysis showed significantly increased levels of progesterone in both FF and PF from endometriosis patients. It has been demonstrated that endometriotic stromal cells, which cause endometriotic lesions, were resistant to progesterone due to its deficiency in the expression of progesterone receptor (PR) [ 25 ]. Endometriotic tissues produce more progesterone and express significantly lower levels of PR compared with normal endometrium [ 26 , 27 ]. The metabolic changes in FF and PF from patients with endometriosis could be a reflection of the component changes in the systemic or local circulation of endometriosis lesions in the ovary or peritoneal cavity [ 28 ]. We can assume that it is the progesterone resistance of the endometriotic tissues that cause the elevated levels of progesterone in serum, FF and PF. Oocytes maturation is accompanied by GCs, the most common neighboring cells to FF in follicles. Therefore, we further conducted RNA sequencing in GCs from patients with ovarian endometriosis and healthy controls respectively to explore the alterations in RNA expression profile of GCs from endometriosis patients due to abnormal intrafollicular environment. The results revealed 98 down-regulated and 77 up-regulated genes in GCs from endometriosis group compared with controls. One of the most significantly altered signaling pathways was NF-кB by GO analysis. Activated by inflammatory cytokines, NF-кB was involved in cascade signal amplification of inflammation [ 29 ]. Constitutive activation and over-expression of NF-кB were also observed in endometriotic stromal cells both in vivo and in vitro [ 30 , 31 ]. Highly activated NF-кB in the ectopic endometrium of women with endometriosis was confirmed to be closely related to local inflammation [ 30 ]. Ovulation has been considered a local inflammatory response. The mid-cycle surge of LH initiates a network of interconnected signaling cascades that lead to follicular rupture and oocyte release during ovulation. Many mediators of the LH-initiated signaling cascades are involved with inflammation, introducing the hypothesis that ovulation is similar to an inflammatory response. However, the role of NF-кB signaling in endometriosis-related ovulatory dysfunction has not been explored yet. In our study, decreased activation of NF-кB was observed in GCs derived from patients with endometriosis. This seems to be contradictory with previous studies in endometrium. Progesterone is known to serve as an anti-inflammatory mediator [ 32 ]. Many recent studies have shown that progesterone acts through multiple mechanisms to inhibit NF-кB [ 33 ]. As the direct lesion tissue of endometriosis, the endometrium may harbor specific epigenetic abnormalities altering expression of PR, leading to progesterone resistance [ 25 ] and activation of NF-кB. Without those epigenetic abnormalities, GCs may behave differently due to the local inflammation caused by the ectopic endometrial lesion. We assume that the elevated level of P in FF from patients with endometriosis may contribute to suppressing NF-кB signaling in the neighboring GCs. However, the specific mechanism needs to be clarified. COX-2 is a rate-limiting enzyme in the PGE2 compound[ 34 ], which has been reported as the key ovulatory prostaglandin [ 35 , 36 ]. While HPGD acts as one of the primary catabolic enzymes of PGE2 and can modulate follicular PGE2 levels during the peri-ovulatory interval. Within the follicle, HPGD could maintain low intrafollicular PGE2 concentrations and lengthen the time between the ovulatory gonadotropin surge, thus facilitating the accumulation of PGE2 [ 35 , 36 ]. Accumulation of PGE2 is widely thought to be a necessary and rate-limiting step in the process of ovulation in all mammalian species [ 37 ]. Duffy et al reported that exposure of GCs to progesterone decreased HPGD mRNA levels in vitro [ 35 ]. Similarly, down-regulation of HPGD and COX2 in GCs from patients with endometriosis was also found in the present study. We assume that the decreased expression of HPGD and COX-2 in GCs, due to the elevated levels of progesterone in FF in endometriosis, may synergistically contribute to the decreased PGE2 levels in FF of endometriosis patients. To verify the above assumptions, we investigated whether progesterone-suppressed NF-кB signaling pathway and down-regulated HPGD and COX-2 expression in vitro in KGN cells, a granulosa tumor-like cell line. Our results revealed that progesterone significantly decreased the expression or suppressed the physiologic activation of NF-кB signaling involved molecules including IкBα and p65 [ 31 , 38 ], which were also down-regulated in endometriosis GCs, in vitro in a dose-dependent manner. This observation suggests a role for progesterone in suppressing the NF-кB signaling pathway in GCs. On the other hand, progesterone obviously decreased both the mRNA and protein expression of HPGD and COX-2 in KGN cells as well. The NF-кB signaling pathway might participate in the regulation of HPGD expression by progesterone, as significantly increased HPGD expression was also observed after the induction of NF-кB by TNF-α in KGN cells. Furthermore, we defined one potential binding element for p65 in the promoter region of HPGD by ChIP-PCR. These results suggest HPGD may be down-regulated by high levels of progesterone in FF through suppressing NF-кB signaling in endometriosis. Taken together, we found that patients with ovarian endometriosis presented with suppressed NF-кB signaling pathway in GCs, which might be a negative factor to the timely regulation mode of PGE2 expression and ovulation. Intrafollicular progesterone might down-regulate HPGD and COX-2 expression in GCs via suppressing the NF-кB signaling pathway (Supplementary Fig. 1), while the regulation mechanism is to be investigated. Our study sheds light on the mechanism involved in the ovulatory dysfunction in patients with endometriosis and provide potential therapeutic targets for improvements of their ovulatory function. However, further studies are needed to explore mechanisms involved in the adverse effects of decreased PGE2 in FF on ovulation. Conclusion Higher FF progesterone may down-regulate HPGD and COX2 , which play important roles in the process of ovulation by participating in the metabolism of PGE2, in GCs via suppressing NF-кB signaling and may lead to ovulatory dysfunction in endometriosis patients. Declarations Acknowledgements The authors thank all participants involved in this study. Authors’ contributions DZ and JYL conceived of the study, participated in its design and coordination and helped to draft the manuscript. JPC carried out the molecular studies, participated in the in vitro experiments and drafted the manuscript. YLQ and YFL carried out the ChIP-PCR experiments, JYM and FDN carried out the IHF experiments, RJZ and SWW is involved in revising the manuscript, YH, JL, XCW and BBW are involved in sample and clinical data collection, MXT and YYY help carrying out the WB experiments. YQW and BZ helped with the hormone assay. Funding This work was supported by the National Key Research and Development Program of China (2018YFC1005003, 2017YFC1001003), the National Natural Science Foundation of China (No. 81974224, 81771535, 82001537), the Natural Science Foundation of Zhejiang Province (No. LZ18H040001, LQ19H040007), Zhejiang Provincial Key Medical Technology Program (WKJ-ZJ-1826), and Zhejiang University Education Foundation Global Partnership Fund. No competing interests to declare. Availability of data and materials The data underlying this article are available in the article and in its online supplementary material. Ethics approval This study was approved by the medical ethics committee of the Women’s Hospital of Zhejiang University School of Medicine (Ethics Lot number 20170021). Consent for publication Not applicable. Conflict of interest The authors have none to declare. References de Ziegler D, Borghese B, Chapron C: Endometriosis and infertility: pathophysiology and management. Lancet 2010, 376: 730-738. Giudice LC: Clinical practice. Endometriosis. N Engl J Med 2010, 362: 2389-2398. Qublan H, Amarin Z, Nawasreh M, Diab F, Malkawi S, Al-Ahmad N, Balawneh M: Luteinized unruptured follicle syndrome: incidence and recurrence rate in infertile women with unexplained infertility undergoing intrauterine insemination. Hum Reprod 2006, 21: 2110-2113. Dal J, Vural B, Caliskan E, Ozkan S, Yucesoy I: Power Doppler ultrasound studies of ovarian, uterine, and endometrial blood flow in regularly menstruating women with respect to luteal phase defects. Fertil Steril 2005, 84: 224-227. Kaya H, Oral B: Effect of ovarian involvement on the frequency of luteinized unruptured follicle in endometriosis. Gynecol Obstet Invest 1999, 48: 123-126. Hennet ML, Combelles CM: The antral follicle: a microenvironment for oocyte differentiation. Int J Dev Biol 2012, 56: 819-831. Nagy RA, van Montfoort AP, Dikkers A, van Echten-Arends J, Homminga I, Land JA, Hoek A, Tietge UJ: Presence of bile acids in human follicular fluid and their relation with embryo development in modified natural cycle IVF. Hum Reprod 2015, 30: 1102-1109. Basuino L, Silveira CF, Jr.: Human follicular fluid and effects on reproduction. JBRA Assist Reprod 2016, 20: 38-40. de Barros IBL, Malvezzi H, Gueuvoghlanian-Silva BY, Piccinato CA, Rizzo LV, Podgaec S: "What do we know about regulatory T cells and endometriosis? A systematic review". J Reprod Immunol 2017, 120: 48-55. Matsuda F, Inoue N, Manabe N, Ohkura S: Follicular growth and atresia in mammalian ovaries: regulation by survival and death of granulosa cells. J Reprod Dev 2012, 58: 44-50. Saito H, Seino T, Kaneko T, Nakahara K, Toya M, Kurachi H: Endometriosis and oocyte quality. Gynecol Obstet Invest 2002, 53 Suppl 1: 46-51. Brannstrom M, Pascoe V, Norman RJ, McClure N: Localization of leukocyte subsets in the follicle wall and in the corpus luteum throughout the human menstrual cycle. Fertil Steril 1994, 61: 488-495. Van der Hoek KH, Maddocks S, Woodhouse CM, van Rooijen N, Robertson SA, Norman RJ: Intrabursal injection of clodronate liposomes causes macrophage depletion and inhibits ovulation in the mouse ovary. Biol Reprod 2000, 62: 1059-1066. Wang F, Pan J, Liu Y, Meng Q, Lv P, Qu F, Ding GL, Klausen C, Leung PC, Chan HC, et al: Alternative splicing of the androgen receptor in polycystic ovary syndrome. Proc Natl Acad Sci U S A 2015, 112: 4743-4748. Nishi Y, Yanase T, Mu Y, Oba K, Ichino I, Saito M, Nomura M, Mukasa C, Okabe T, Goto K, et al: Establishment and characterization of a steroidogenic human granulosa-like tumor cell line, KGN, that expresses functional follicle-stimulating hormone receptor. Endocrinology 2001, 142: 437-445. Rocha S, Campbell KJ, Perkins ND: p53- and Mdm2-independent repression of NF-kappa B transactivation by the ARF tumor suppressor. Mol Cell 2003, 12: 15-25. Wang K, Singh D, Zeng Z, Coleman SJ, Huang Y, Savich GL, He X, Mieczkowski P, Grimm SA, Perou CM, et al: MapSplice: accurate mapping of RNA-seq reads for splice junction discovery. Nucleic Acids Res 2010, 38: e178. Zhou X, Wu W, Li H, Cheng Y, Wei N, Zong J, Feng X, Xie Z, Chen D, Manley JL, et al: Transcriptome analysis of alternative splicing events regulated by SRSF10 reveals position-dependent splicing modulation. Nucleic Acids Res 2014, 42: 4019-4030. Anders S, Pyl PT, Huber W: HTSeq--a Python framework to work with high-throughput sequencing data. Bioinformatics 2015, 31: 166-169. Kallio MA, Tuimala JT, Hupponen T, Klemela P, Gentile M, Scheinin I, Koski M, Kaki J, Korpelainen EI: Chipster: user-friendly analysis software for microarray and other high-throughput data. BMC Genomics 2011, 12: 507. Ashburner M, Ball CA, Blake JA, Botstein D, Butler H, Cherry JM, Davis AP, Dolinski K, Dwight SS, Eppig JT, et al: Gene ontology: tool for the unification of biology. The Gene Ontology Consortium. Nat Genet 2000, 25: 25-29. Draghici S, Khatri P, Tarca AL, Amin K, Done A, Voichita C, Georgescu C, Romero R: A systems biology approach for pathway level analysis. Genome Res 2007, 17: 1537-1545. Wu G, Bersinger NA, Mueller MD, von Wolff M: Intrafollicular inflammatory cytokines but not steroid hormone concentrations are increased in naturally matured follicles of women with proven endometriosis. J Assist Reprod Genet 2017, 34: 357-364. Opoien HK, Fedorcsak P, Polec A, Stensen MH, Abyholm T, Tanbo T: Do endometriomas induce an inflammatory reaction in nearby follicles? Hum Reprod 2013, 28: 1837-1845. Bulun SE, Yilmaz BD, Sison C, Miyazaki K, Bernardi L, Liu S, Kohlmeier A, Yin P, Milad M, Wei J: Endometriosis. Endocr Rev 2019, 40: 1048-1079. Attar E, Tokunaga H, Imir G, Yilmaz MB, Redwine D, Putman M, Gurates B, Attar R, Yaegashi N, Hales DB, Bulun SE: Prostaglandin E2 via steroidogenic factor-1 coordinately regulates transcription of steroidogenic genes necessary for estrogen synthesis in endometriosis. J Clin Endocrinol Metab 2009, 94: 623-631. Daniels S, Robbins J, West CR, Nemeth MA: Celecoxib in the treatment of primary dysmenorrhea: results from two randomized, double-blind, active- and placebo-controlled, crossover studies. Clin Ther 2009, 31: 1192-1208. Koninckx PR, Kennedy SH, Barlow DH: Endometriotic disease: the role of peritoneal fluid. Hum Reprod Update 1998, 4: 741-751. Park MH, Hong JT: Roles of NF-kappaB in Cancer and Inflammatory Diseases and Their Therapeutic Approaches. Cells 2016, 5 . Kim SH, Ihm HJ, Oh YS, Chae HD, Kim CH, Kang BM: Increased nuclear expression of nuclear factor kappa-B p65 subunit in the eutopic endometrium and ovarian endometrioma of women with advanced stage endometriosis. Am J Reprod Immunol 2013, 70: 497-508. Cao WG, Morin M, Sengers V, Metz C, Roger T, Maheux R, Akoum A: Tumour necrosis factor-alpha up-regulates macrophage migration inhibitory factor expression in endometrial stromal cells via the nuclear transcription factor NF-kappaB. Hum Reprod 2006, 21: 421-428. Tibbetts TA, Conneely OM, O'Malley BW: Progesterone via its receptor antagonizes the pro-inflammatory activity of estrogen in the mouse uterus. Biol Reprod 1999, 60: 1158-1165. Davies S, Dai D, Feldman I, Pickett G, Leslie KK: Identification of a novel mechanism of NF-kappaB inactivation by progesterone through progesterone receptors in Hec50co poorly differentiated endometrial cancer cells: induction of A20 and ABIN-2. Gynecol Oncol 2004, 94: 463-470. Murakami M, Kudo I: Recent advances in molecular biology and physiology of the prostaglandin E2-biosynthetic pathway. Prog Lipid Res 2004, 43: 3-35. Duffy DM, Dozier BL, Seachord CL: Prostaglandin dehydrogenase and prostaglandin levels in periovulatory follicles: implications for control of primate ovulation by prostaglandin E2. J Clin Endocrinol Metab 2005, 90: 1021-1027. Sayasith K, Bouchard N, Dore M, Sirois J: Cloning of equine prostaglandin dehydrogenase and its gonadotropin-dependent regulation in theca and mural granulosa cells of equine preovulatory follicles during the ovulatory process. Reproduction 2007, 133: 455-466. Duffy DM: Novel contraceptive targets to inhibit ovulation: the prostaglandin E2 pathway. Hum Reprod Update 2015, 21: 652-670. Hayden MS, Ghosh S: Regulation of NF-kappaB by TNF family cytokines. Semin Immunol 2014, 26: 253-266. Supplementary Files Supplementaryfigure1.tif Supplementary Figure 1 A model to explain the mechanism involved in ovulatory dysfunction in endometriosis patients. Higher intrafollicular progesterone might down-regulate HPGD and COX-2 expression in GCs via suppressing the NF-кB signaling pathway, leading to the decreased PGE2 levels in FF and thus ovulatory dysfunction of endometriosis patients. supplementarymethods20210829.docx transcriptomeanalysis.xls Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-882586","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research","associatedPublications":[],"authors":[{"id":50500596,"identity":"70c0ced0-259b-41e4-ae61-96db577ecc2f","order_by":0,"name":"Jing-Yi Li","email":"","orcid":"","institution":"Women's Hospital School of Medicine Zhejiang University","correspondingAuthor":false,"prefix":"","firstName":"Jing-Yi","middleName":"","lastName":"Li","suffix":""},{"id":50500597,"identity":"7fd6749c-712a-4f38-8249-f1f65d6f22a0","order_by":1,"name":"Jian-Peng Chen","email":"","orcid":"","institution":"Women's Hospital School of Medicine Zhejiang University","correspondingAuthor":false,"prefix":"","firstName":"Jian-Peng","middleName":"","lastName":"Chen","suffix":""},{"id":50500598,"identity":"65b0f6ba-5cbf-4336-b657-c0e5755f6991","order_by":2,"name":"Yu-Li Qian","email":"","orcid":"","institution":"Women's Hospital School of Medicine Zhejiang University","correspondingAuthor":false,"prefix":"","firstName":"Yu-Li","middleName":"","lastName":"Qian","suffix":""},{"id":50500599,"identity":"7b91b6a6-83e8-45fd-a8e0-06305a34316c","order_by":3,"name":"Jun-Yan Ma","email":"","orcid":"","institution":"Women's Hospital School of Medicine Zhejiang University","correspondingAuthor":false,"prefix":"","firstName":"Jun-Yan","middleName":"","lastName":"Ma","suffix":""},{"id":50500600,"identity":"efcb38a8-820c-49ce-b1bd-78ae54fb62ad","order_by":4,"name":"Fei-Da Ni","email":"","orcid":"","institution":"Women's Hospital School of Medicine Zhejiang University","correspondingAuthor":false,"prefix":"","firstName":"Fei-Da","middleName":"","lastName":"Ni","suffix":""},{"id":50500601,"identity":"9a79b2eb-b515-4611-8808-bc615bdbd718","order_by":5,"name":"Yi-Feng Lin","email":"","orcid":"","institution":"Women's Hospital School of Medicine Zhejiang University","correspondingAuthor":false,"prefix":"","firstName":"Yi-Feng","middleName":"","lastName":"Lin","suffix":""},{"id":50500602,"identity":"571b4e5d-068a-4d3f-873b-1fed714a897a","order_by":6,"name":"Run-Ju Zhang","email":"","orcid":"","institution":"Women's Hospital School of Medicine Zhejiang University","correspondingAuthor":false,"prefix":"","firstName":"Run-Ju","middleName":"","lastName":"Zhang","suffix":""},{"id":50500603,"identity":"1eb49b2e-8767-42e6-8a31-93c422893cb9","order_by":7,"name":"Si-Wen Wang","email":"","orcid":"","institution":"Women's Hospital School of Medicine Zhejiang University","correspondingAuthor":false,"prefix":"","firstName":"Si-Wen","middleName":"","lastName":"Wang","suffix":""},{"id":50500604,"identity":"8cf9c099-e462-479e-b9e0-2b1130541a8d","order_by":8,"name":"Yun Huang","email":"","orcid":"","institution":"Women's Hospital School of Medicine Zhejiang University","correspondingAuthor":false,"prefix":"","firstName":"Yun","middleName":"","lastName":"Huang","suffix":""},{"id":50500605,"identity":"10f1d853-208b-408c-a24e-ed58819727a6","order_by":9,"name":"Juan Liu","email":"","orcid":"","institution":"Women's Hospital School of Medicine Zhejiang University","correspondingAuthor":false,"prefix":"","firstName":"Juan","middleName":"","lastName":"Liu","suffix":""},{"id":50500606,"identity":"9b908eb9-cc99-4400-a2e3-606dc29cb6c9","order_by":10,"name":"Mi-Xue Tu","email":"","orcid":"","institution":"Women's Hospital School of Medicine Zhejiang University","correspondingAuthor":false,"prefix":"","firstName":"Mi-Xue","middleName":"","lastName":"Tu","suffix":""},{"id":50500607,"identity":"41dc9094-3bc2-4aa7-bf48-332bc302e7b0","order_by":11,"name":"Yan-Yun Ying","email":"","orcid":"","institution":"Women's Hospital School of Medicine Zhejiang University","correspondingAuthor":false,"prefix":"","firstName":"Yan-Yun","middleName":"","lastName":"Ying","suffix":""},{"id":50500608,"identity":"0f558acb-ac5a-4b1c-9434-0744e199102e","order_by":12,"name":"Yi-Qing Wu","email":"","orcid":"","institution":"Women's Hospital School of Medicine Zhejiang University","correspondingAuthor":false,"prefix":"","firstName":"Yi-Qing","middleName":"","lastName":"Wu","suffix":""},{"id":50500609,"identity":"c4a30928-8152-413a-89a8-f603ffc3d97d","order_by":13,"name":"Xue-Chen Wu","email":"","orcid":"","institution":"Women's Hospital School of Medicine Zhejiang University","correspondingAuthor":false,"prefix":"","firstName":"Xue-Chen","middleName":"","lastName":"Wu","suffix":""},{"id":50500610,"identity":"94fb4955-28b4-4c66-b24e-ecb79cd611a4","order_by":14,"name":"Bing-Bing Wu","email":"","orcid":"","institution":"Women's Hospital School of Medicine Zhejiang University","correspondingAuthor":false,"prefix":"","firstName":"Bing-Bing","middleName":"","lastName":"Wu","suffix":""},{"id":50500611,"identity":"15dfbaa7-0025-4379-8ef4-9ede9d405123","order_by":15,"name":"Bo Zhu","email":"","orcid":"","institution":"Women's Hospital School of Medicine Zhejiang University","correspondingAuthor":false,"prefix":"","firstName":"Bo","middleName":"","lastName":"Zhu","suffix":""},{"id":50500612,"identity":"ff115253-239f-47a2-95a0-03330358e0a8","order_by":16,"name":"Dan Zhang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA40lEQVRIiWNgGAWjYDACCRDBxsDAz8CQAGQxk6BFsoFkLQYHwFwitMjPbn728EuZXZ7x+QPPJBgqrBMb2M8ewKuFcc4xc2OZc8nFZgcOpEkwnElPbODJS8CrhVkiwUxaso05cdvBhjQJxrbDiQ0SPAZ4tbBJpH8DaqlP3NzMANTyjwgtPBI5ZpIfgYZvYANpaSBCi4RETpk0w7njiTPOMCRbJBxLN27jycGvRX5G+jbJH2XVif39ZxJvfKixlu1nP4NfCwgw80DcmACOTDaC6oGA8QeYYj9AjOJRMApGwSgYgQAA0JRBeFnNEtsAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0003-1295-4795","institution":"Women's Hospital, Zhejiang University School of Medicine","correspondingAuthor":true,"prefix":"","firstName":"Dan","middleName":"","lastName":"Zhang","suffix":""}],"badges":[],"createdAt":"2021-09-07 10:34:02","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-882586/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-882586/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":13230161,"identity":"08d1ad77-917e-46e9-93ff-916f09088a28","added_by":"auto","created_at":"2021-09-09 19:11:47","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":206202,"visible":true,"origin":"","legend":"Elevated circulating progesterone in serum, PF and FF from endometriosis patients. (A) Comparison of progesterone expression levels in PF and FF from EMT group and control group (n=15) determined by metabolomics analyses. (B) Comparison of basal serum levels of progesterone on D2-D5 of menstrual cycle between EMT group and control group (n=35). (C) Comparison of serum levels of progesterone on the trigger day between EMT group and control group (n=35). (D) Comparison of progesterone concentration in FF between EMT group and control group (n=35). EMT: ovarian endometriosis. Each point in (B), (C) and (D) indicates the value of progesterone concentration in specific body fluid of each patient; bar showed standard error of mean in each group. P\u003c.05 was considered statistically significant versus control group. * P\u003c .05; **P\u003c .01.","description":"","filename":"Fig120210827.png","url":"https://assets-eu.researchsquare.com/files/rs-882586/v1/14f855caf5298ba88da75f9e.png"},{"id":13230164,"identity":"82cf4b47-e897-4ecf-b655-6a1d651435f4","added_by":"auto","created_at":"2021-09-09 19:11:47","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":415032,"visible":true,"origin":"","legend":"Decreased COX-2 and HPGD expression in GCs from endometriosis patients. (A) Volcano plots of genes with differential expression in GCs from EMT group versus those from control group. The X axis represents the log2 of the fold change, and the Y axis represents the −log10 of the P-value from a student’s t-test. The red points and blue points in the plot represent the up-regulated and down-regulated genes with statistical significance respectively (with a fold change ≥ 2, and P-value \u003c 0.05). (B) Differential transcriptional levels of COX-2 and HPGD mRNA in GCs from EMT group and control group were shown by qRT-PCR (n=20). (C) Differential expression levels of COX-2 and HPGD proteins in GCs from EMT group and control group (n=4) were shown by Western blot and the corresponding quantitative analysis. (D) Comparison of PGE2 concentration in FF between EMT group and control group (n=35). EMT: ovarian endometriosis. Each point in (B) and (D) indicates the value of the mRNA transcriptional level in GCs or the PGE2 concentration in FF of each patient; Bar indicates standard error of mean in each group. P\u003c.05 was considered statistically significant versus control group. * P\u003c .05; **P\u003c .01.","description":"","filename":"Fig220210828.png","url":"https://assets-eu.researchsquare.com/files/rs-882586/v1/2a3bd959f938611911ff9527.png"},{"id":13230167,"identity":"c12a3e99-9391-4aef-bd6e-d4747ec0402b","added_by":"auto","created_at":"2021-09-09 19:11:47","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":539932,"visible":true,"origin":"","legend":"Decreased expression of NF-кB signaling pathway involved molecules in GCs from endometriosis patients. (A) GO analysis showed down-regulated signaling pathways in GCs from endometriosis patient by transcriptomics analysis. (B) Decreased transcriptional levels of ILIR1, IRAK3 and MAP3K1 in endometriosis patients compared with control patients were shown by qRT-PCR. Each point indicates specific mRNA transcriptional level in each patient; bar indicates standard error of mean in each group (n=20). (C) Decreased expressions of ILIR1, IRAK3, p65 and pIкBα in endometriosis patients compared with control patients were shown by Western blot and the corresponding quantitative analysis. Bar indicates standard error of mean in each group (n=4). EMT: ovarian endometriosis. P\u003c.05 was considered statistically significant versus control group. * P\u003c .05; **P\u003c .01.","description":"","filename":"Fig320210827.png","url":"https://assets-eu.researchsquare.com/files/rs-882586/v1/8f1f180273af658794e0aa6a.png"},{"id":13230368,"identity":"46aa581e-e2b8-4a20-b6b5-1e3403269374","added_by":"auto","created_at":"2021-09-09 19:14:47","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1721181,"visible":true,"origin":"","legend":"Progesterone regulate NF-кB signaling activity and expression of COX-2 and HPGD in KGN cells. Expression levels of ILIR1, IRAK3, MAP3K1 (A), COX-2 and HPGD (B) in KGN cells pretreated with progesterone at different concentrations (1 × 10-6, 1 × 10-5, 1 × 10-4, 1 × 10-3, 1 × 10-2 nmol/L) were shown by RT-qPCR (n=3). (C) Expression levels of COX-2, HPGD, IL1R1 and IRAK3 in KGN cells pretreated with progesterone at different concentrations (1 × 10-6, 1 × 10-5, 1 × 10-4, 1 × 10-3, 1 × 10-2 nmol/L) were shown by Western blot. (D) Time-dependent effects of progesterone treatment on IкBα phosphorylation, p65 expression in KGN cells were shown by Western blot. Time-dependent effects of progesterone treatment on nucleus translocation of p65 in KGN cells were shown by Western blot conducted on cytoplasmic and nucleus proteins respectively (E) and immunofluorescence (n=3) (F), as well as the corresponding quantitative statistics. KGN cells were exposed to progesterone (1 × 10-4 nmol/L) for 0 min, 15 min, 30 min, 60 min and 120 min respectively. P\u003c.05 was considered statistically significant versus 0 nmol/L or 0 min group (n=3). * P\u003c .05; **P\u003c .01, ***P\u003c .001. ","description":"","filename":"Fig420210903.png","url":"https://assets-eu.researchsquare.com/files/rs-882586/v1/fdf705f649c7c82e2ea0f6ef.png"},{"id":13230367,"identity":"d4ee2a7a-9327-4e1d-8fce-7c360714f0fb","added_by":"auto","created_at":"2021-09-09 19:14:47","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1093794,"visible":true,"origin":"","legend":"Direct regulation effects of NF-кB signaling on HPGD expression. (A) Western blot showed increased expression levels of HPGD and NF-кB signaling associated molecules including IL1R1, IRAK3, p65, and pIкBα in KGN cells pretreated by TNF-α (50 ng/mL). (B) q-PCR showed increased transcriptional of HPGD mRNA in KGN cells pretreated by TNF-α (50 ng/mL). P\u003c.05 was considered statistically significant versus 0 ng/mL group. ** P\u003c .01. (C) The prediction of potential p65 binding sites on HPGD promotor by lasagna-search 2.0, the red rectangle marks the one verified by ChIP-PCR further. (D) The schematic diagram of the positions of the potential p65 binding site on HPGD promotor and the information for the corresponding primer used in ChIP-PCR assays and succeeding in detecting a specific band showing binding of p65 to the potential p65-binding site. ","description":"","filename":"Fig520210827.png","url":"https://assets-eu.researchsquare.com/files/rs-882586/v1/7d2da2a697a5eb006e78a350.png"},{"id":13713757,"identity":"6dc1d424-ceb7-415e-b092-7d91a48ba4fe","added_by":"auto","created_at":"2021-09-17 14:34:44","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3028687,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-882586/v1/4886cc53-029c-46ff-a1c2-70a2868ef2f1.pdf"},{"id":13230166,"identity":"9c93a190-f52b-4c7d-a4ac-a2f9a4bf0897","added_by":"auto","created_at":"2021-09-09 19:11:47","extension":"tif","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":2804936,"visible":true,"origin":"","legend":"Supplementary Figure 1 A model to explain the mechanism involved in ovulatory dysfunction in endometriosis patients. Higher intrafollicular progesterone might down-regulate HPGD and COX-2 expression in GCs via suppressing the NF-кB signaling pathway, leading to the decreased PGE2 levels in FF and thus ovulatory dysfunction of endometriosis patients.","description":"","filename":"Supplementaryfigure1.tif","url":"https://assets-eu.researchsquare.com/files/rs-882586/v1/02b36ba180bb54b734d89645.tif"},{"id":13230160,"identity":"4cc986cd-0f12-42f7-a33e-89e29a9583ed","added_by":"auto","created_at":"2021-09-09 19:11:47","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":23701,"visible":true,"origin":"","legend":"","description":"","filename":"supplementarymethods20210829.docx","url":"https://assets-eu.researchsquare.com/files/rs-882586/v1/863d8d1f1f5b97d00f231824.docx"},{"id":13230162,"identity":"e3d43a2a-2bac-4153-b041-4fc222914a5a","added_by":"auto","created_at":"2021-09-09 19:11:47","extension":"xls","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":55296,"visible":true,"origin":"","legend":"","description":"","filename":"transcriptomeanalysis.xls","url":"https://assets-eu.researchsquare.com/files/rs-882586/v1/957fbce4eec3aec7d7c771db.xls"}],"financialInterests":"","formattedTitle":"\u003cp\u003eHigher Follicular Fluid Progesterone Down-regulated HPGD and COX2 in Granulosa Cells via Suppressing NF-кB Signaling in Endometriosis\u003c/p\u003e","fulltext":[{"header":"Introduction","content":"\u003cp\u003eEndometriosis is a chronic gynecologic disorder affecting approximately 10% of women at reproductive age and 40\u0026ndash;50% of infertile women [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. It is a complex syndrome manifested by chronic pelvic pain and infertility. The etiology of endometriosis is unknown. However, it is now generally accepted that the main causes are the repeated retrograde travel and survival of shed endometrial tissues in the lower abdominal cavity. Endometriosis-associated pelvic pain is currently managed by suppression of ovulatory menses and estrogen production, cyclooxygenase inhibitors, and surgical removal of pelvic lesions; whereas \u003cem\u003ein vitro\u003c/em\u003e fertilization (IVF) is frequently used to overcome infertility.\u003c/p\u003e \u003cp\u003eLUFS is a syndrome of failed ovulation in which the follicle does not rupture, despite of the secondary ovulatory changes, such as peak luteinizing hormone (LH), rising progesterone (P), or endometrial secretion transformation [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. LUFS is a special type of ovulatory menstruation and a common cause of infertility. The incidence of LUFS is 11\u0026ndash;23% in natural menstrual cycle [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e], and is higher in controlled ovarian stimulation cycle; when combined with endometriosis, the incidence of LUFS is 13\u0026ndash;73% [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. It seems that LUFS is one of the reasons for endometriosis-related infertility. However, the mechanism by which endometriosis causes LUFS is still to be investigated.\u003c/p\u003e \u003cp\u003eFF, which consists of a variety of substances, including hormones, immune cells, cytokines, enzymes, anticoagulants, electrolytes, reactive oxygen species, lipids, cholesterol and antioxidants, plays an important role in the growth and development of the follicle [\u003cspan additionalcitationids=\"CR7\" citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Any alteration in FF components may influence the developing oocyte [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. The metabolic profile of FF in patients with endometriosis could reflect the metabolic changes in the systemic circulation or alternatively reflect the local inflammation due to endometriosis lesions in the ovary or peritoneal cavity [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. GCs have also been proved to play an important role in follicular development [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. In patients with endometriosis, abnormalities in GCs might impair oocyte maturation and lead to poor oocyte quality [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Interestingly, as the most neighboring cells to FF, granulosa cells and theca cells of the follicle cooperate with resident and infiltrating immune cells to produce paracrine mediators of ovulation [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], many of which are also common in inflammatory responses. While whether and how alteration in FF components affects ovulation in endometriosis by interacting with GCs remain unclear.\u003c/p\u003e \u003cp\u003eIn the present study, we analyzed the alteration in components of FF from patients with endometriosis compared with control by metabolic spectrum, aiming to find intrafollicular cytokines, steroids, or other small molecule chemicals that might account for the ovulatory dysfunction in endometriosis patients. The differentially expressed genes in corresponding GCs of endometriosis patients were also explored via RNA sequencing. Furthermore, we aimed to identify the mechanism involved in the impairment of ovulation in patients with endometriosis and provide potential therapeutic targets for their ovulation dysfunction.\u003c/p\u003e"},{"header":"Materials And Methods","content":"\u003cp\u003e\u003cstrong\u003eEthics approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was approved by the medical ethics committee of the Women\u0026rsquo;s Hospital of Zhejiang University School of Medicine (Ethics Lot number 20170021). We confirm that human study in our experiments was performed in accordance with relevant guidelines and regulations.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStudy population\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA total of 100 patients, who underwent IVF or intracytoplasmic sperm injection treatment in the reproductive medical center of the Women\u0026rsquo;s Hospital of Zhejiang University School of Medicine during July 2017 and January 2018 were enrolled in this study. Of the 100 subjects, there were 50 with ovarian endometriosis and 50 in the control group. Patients with ovarian endometriosis were confirmed by laparoscopy in our hospital. Inclusion criteria included regular menstrual cycle (23-35 days), unilateral endometrioma (\u0026ge;5\u0026thinsp;cm) and normal ovarian reserve (serum anti-Mullerian hormone \u0026thinsp;level of \u0026gt;\u0026thinsp;1\u0026thinsp;ng/mL, antral follicular count \u0026gt;\u0026thinsp;4 and basal serum follicle-stimulating hormone level of \u0026lt;10 IU/L). Patients aged over 35 years, treated by steroid hormones, with pelvic inflammatory disease, endocrine diseases, unexplained infertility, with immune disease, or chromosomal abnormalities were excluded. Tubal blockage or male-factor infertility as two isolated causes comprised the control group.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFollicular Fluid and GC Isolation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDuring surgery, FF was collected using a new aspiration needle when the first and largest follicle of the ovary was punctured and with a flushed needle for the first follicle of the other ovary. Only FF samples free of blood contamination upon both visual and microscopic examination and that contained mature (MII) oocytes were analyzed. Samples were centrifuged at 2900 rpm for 10 minutes to remove cell debris before being stored. GCs samples was collected on the oocyte retrieval day according to the protocol [14]. Firstly, GCs were centrifuged at 340 \u0026times; g for 5 minutes. Then they were gathered from the pellet with Ficoll solution (Lymphoprep; Axis-Shield, Norway) by density gradient centrifugation at 340 \u0026times; g for 15 minutes. After that, GCs were resuspended in red blood cell lysis buffer (Beyotime, China) for purification and washed with phosphate-buffered saline solution (PBS; Gibco, USA). Both the FF and the GCs were stored at -80℃ until analysis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHormone and PGE2 Measurements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSerum hormone levels on days 2\u0026ndash;5 of the menstrual cycle and trigger day of IVF, including FSH, LH, estradiol (E\u003csub\u003e2\u003c/sub\u003e), P and testosterone (T) levels in serum, as well as the level of P and PGE2 in FF were measured using ELISA kit following the manufacturer\u0026rsquo;s protocol (Beckman Coulter UniCel DxI 800, USA).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell culture and treatment\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGranulosa tumor-like cell line KGN (Bena culture collection, China) was used as \u003cem\u003ein vitro\u003c/em\u003e cell model [15]. Cells were cultured in RPMI medium (Hyclone, Logan, UT, USA) containing 10% fetal bovine serum (FBS, Biological Industries, Kibbutz Beit-Haemek, Israel), which were incubated at 37 ℃ and 5% CO\u003csub\u003e2\u003c/sub\u003e in air. After 48 h of cell culture, the cells were pre-incubated in the serum-free medium for 12 h. Then the cells were cultured in serum-containing medium with progesterone dissolved with DMSO (1 \u0026times; 10\u003csup\u003e-6\u003c/sup\u003e, 1 \u0026times; 10\u003csup\u003e-5\u003c/sup\u003e, 1 \u0026times; 10\u003csup\u003e-4\u003c/sup\u003e, 1 \u0026times; 10\u003csup\u003e-3\u003c/sup\u003e, 1 \u0026times; 10\u003csup\u003e-2\u003c/sup\u003e nmol/L; sigma, USA) for 48 h or TNF-\u0026alpha; (0\u0026ndash;50 ng/mL; Sino Biological, China) for 10 h. Control cultures were exposed to medium added with the same volume of DMSO. Another group of cells were cultured in serum-containing medium with progesterone (1 \u0026times; 10\u003csup\u003e-4\u003c/sup\u003e nmol/L) for 0, 5, 15, 30, 60, 120 minutes respectively to explore the effects of progesterone on NF-кB signaling \u003cem\u003ein vitro\u003c/em\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eQuantitative Real-time PCR Analysis\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe q-PCR analysis was carried out using SDS 2.3 software in 7900HT Fast Real-Time PCR System (Applied Biosystems, USA) according to the standard protocol (see in detail in supplementary methods).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWestern blot analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eProteins were extracted from human GCs or KGN cells, and lysed by RIPA lysis buffer (Cell Signaling Technology, USA) according to the manufacturer\u0026apos;s protocol [16]. Western blot analysis were conducted according to the standard protocol (see in detail in supplementary methods).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eImmunofluorescence\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe cells pre-treated with progesterone (1 \u0026times; 10\u003csup\u003e-4\u003c/sup\u003e nmol/L) for 0, 5, 15, 30, 60, 120 minutes respectively and immunofluorescence analysis were conducted according to the standard protocol (see in detail in supplementary methods).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eChromatin Immunoprecipitation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eIn vivo\u003c/em\u003e crosslinking of proteins was performed by incubating KGN cells pretreated with TNF-\u0026alpha; with 1% formaldehyde for 15 minutes at room temperature. After neutralization with glycine, cell lysates were vortexed with glass beads in lysis buffer containing 100 mM HEPES-KOH pH 7.5, 1% Triton X-100, 0.1% sodium deoxycholate, 1 mM EDTA, 140 mM NaCl, 2X cOmplete ULTRA Tablets (protease inhibitors, Roche, Switzerland), 1 mM phenylmethylsulphonyl fluoride, 50 mM NaF and 0.2 mM Na\u003csub\u003e3\u003c/sub\u003eVO\u003csub\u003e4\u003c/sub\u003e. Samples were then sonicated using a Covaris-S2 sonicator (Covaris, USA) to shear chromatin DNA into fragments of 100 to 500 bp. Immunoprecipitation of P65 bound to chromatin was performed using protein G Sepharose beads that were coupled to a rabbit monoclonal anti-p65 antibody (8242S, 1:100, Cell Signaling Technology, USA). Bead washes and elution, reverse cross-linking, and DNA precipitation were performed according to the Pierce Agarose ChIP Kit manual. Rabbit IgG was used as negative control. PCR was carried out later using different sets of primers spanning the \u003cem\u003eHPGD\u003c/em\u003e promoter to verify the binding. The primer succeeded to detect a band in our ChIP-PCR assay is \u003cem\u003eHPGD\u003c/em\u003e-F (-1333): 5\u0026apos;-TTATGGGGTGGGAGGGAGAC-3\u0026apos;,\u003cem\u003e\u0026nbsp;HPGD\u003c/em\u003e-R (-1189): 5\u0026apos;- TTCTGTCACCTCAGCATGCA -3\u0026apos;.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTranscriptome analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was extracted from cell by Trizol reagent (Invitrogen, USA). The RNA quality was checked by Bioanalyzer 2200 (Aligent, USA) and kept at -80℃. RNA with RIN \u0026gt;8.0 was used for rRNA depletion. The cDNA libraries of each pooled RNA sample for single-end sequencing were prepared using Ion Total RNA-Seq Kit v2.0 (Life Technologies, USA) according to the manufacturer\u0026rsquo;s instructions. The cDNA libraries were processed for the Proton Sequencing process according to the commercially available protocols. Clean reads obtained from the raw reads by removing the adaptor sequences, reads with \u0026gt;5% ambiguous bases (noted as N) and low-quality reads containing more than 20 percent of bases with qualities of \u0026lt;13 were aligned to the human reference genome sequence GRCh38 (ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/000/001/405/GCA_000001405.15_GRCh38) using the MapSplice program (v2.1.6) [17]. Alternative Splicing Detector (ASD, available on http://www.novelbio.com/asd/ASD.html) was used as the tool to detect the differentially alternative splicing cases based on the bam file after mapping according to the \u003cem\u003eP\u0026nbsp;\u003c/em\u003ethreshold (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05) [18]. HTseq was used to count gene and RPKM method was used to normalize gene expression level [19]. DEseq algorithm was used to identify the differentially expressed genes under the criteria that fold change \u0026gt; 1.5 and FDR \u0026lt; 0.05 [20]. Gene ontology (GO) analysis was performed to facilitate elucidating the biological implications of unique genes in the significant or representative profiles of the differentially expressed genes in the experiment [21]. GO annotations were integrated from NCBI (http://www.ncbi.nlm.nih.gov/), UniProt (http://www.uniprot.org/) and the Gene Ontology (http://www.geneontology.org/). Pathway analysis was used to find out the significant pathway of the differential genes according to KEGG database. Fisher\u0026rsquo;s exact test were applied to identify the significant GO categories and pathways, and the false discovery rate (FDR) was used to correct the \u003cem\u003eP\u003c/em\u003e-values. [22].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe results are presented as mean \u0026plusmn; SEM. Quantitative variables were analyzed using Student\u0026apos;s t-test for comparison between two groups. Statistical analysis was performed with Statistical Package for Social Sciences version 22.0 (SPSS 22.0). \u003cem\u003eP\u003c/em\u003e\u0026lt; 0.05 was considered statistically significant.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv class=\"Section2\" id=\"Sec15\"\u003e\n \u003cp\u003e\u003cstrong\u003eClinical Characteristics of all Participants\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eA total of 50 patients with ovarian endometriosis and 50 controls were recruited in the present study. The baseline characteristics between endometriosis group and control group were comparable (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05), including age, body mass index (BMI), duration of infertility, mature, premature, abortion, existence, antral follicle count (AFC), total gonadotrophin dosage and retrieval oocytes (Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\n \u003ctable border=\"1\" id=\"Tab1\"\u003e\n \u003ccaption\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eClinical Characteristics of all Participants.\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\u0026nbsp;\u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eControl\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eEndometriosis\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eP\u003c/em\u003e\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNumber (n)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e35\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e35\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAge (y, mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e29.229\u0026thinsp;\u0026plusmn;\u0026thinsp;2.680\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e29.314\u0026thinsp;\u0026plusmn;\u0026thinsp;2.752\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.8954\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eBody mass index (kg/m\u0026sup2;, mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e21.375\u0026thinsp;\u0026plusmn;\u0026thinsp;2.039\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e20.660\u0026thinsp;\u0026plusmn;\u0026thinsp;2.441\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.1875\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDuration of infertility (y, mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3.886\u0026thinsp;\u0026plusmn;\u0026thinsp;2.374\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3.400\u0026thinsp;\u0026plusmn;\u0026thinsp;2.376\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.3952\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eMature (n, mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.057\u0026thinsp;\u0026plusmn;\u0026thinsp;0.236\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.086\u0026thinsp;\u0026plusmn;\u0026thinsp;0.284\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.6483\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ePremature (n)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAbortion (n, mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.343\u0026thinsp;\u0026plusmn;\u0026thinsp;0.684\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.200\u0026thinsp;\u0026plusmn;\u0026thinsp;0.531\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.3324\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eExistence (n, mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.057\u0026thinsp;\u0026plusmn;\u0026thinsp;0.236\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.086\u0026thinsp;\u0026plusmn;\u0026thinsp;0.284\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.6483\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAFC (n, mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e8.429\u0026thinsp;\u0026plusmn;\u0026thinsp;3.791\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e7.943\u0026thinsp;\u0026plusmn;\u0026thinsp;5.252\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.6587\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTotal Gn dogase (IU, mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2143.786\u0026thinsp;\u0026plusmn;\u0026thinsp;778.794\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1969.693\u0026thinsp;\u0026plusmn;\u0026thinsp;876.802\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.3829\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eBasal FSH (IU/L, mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6.605\u0026thinsp;\u0026plusmn;\u0026thinsp;1.725\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e7.453\u0026thinsp;\u0026plusmn;\u0026thinsp;2.540\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.1931\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eBasal LH (IU/L, mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5.328\u0026thinsp;\u0026plusmn;\u0026thinsp;2.284\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5.210\u0026thinsp;\u0026plusmn;\u0026thinsp;3.128\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.8578\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eBasal E2 (pmol/L, mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e96.327\u0026thinsp;\u0026plusmn;\u0026thinsp;26.497\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e109.410\u0026thinsp;\u0026plusmn;\u0026thinsp;36.801\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.0924\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eBasal P (nmol/L, mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.767\u0026thinsp;\u0026plusmn;\u0026thinsp;0.428\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.124\u0026thinsp;\u0026plusmn;\u0026thinsp;0.712*\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.0135\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eBasal T (nmol/L, mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.549\u0026thinsp;\u0026plusmn;\u0026thinsp;0.408\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.483\u0026thinsp;\u0026plusmn;\u0026thinsp;0.458\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.5266\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLH on trigger day (IU/L, mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.444\u0026thinsp;\u0026plusmn;\u0026thinsp;1.946\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.613\u0026thinsp;\u0026plusmn;\u0026thinsp;2.495\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.7531\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eE2 on trigger day (nmol/L, mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e11.051\u0026thinsp;\u0026plusmn;\u0026thinsp;6.070\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e12.348\u0026thinsp;\u0026plusmn;\u0026thinsp;11.762\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.5641\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eP on trigger day (nmol/L, mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.643\u0026thinsp;\u0026plusmn;\u0026thinsp;1.196\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3.285\u0026thinsp;\u0026plusmn;\u0026thinsp;1.395*\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.0472\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eRetrieval oocytes (n, mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e12.029\u0026thinsp;\u0026plusmn;\u0026thinsp;6.560\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e11.229\u0026thinsp;\u0026plusmn;\u0026thinsp;8.117\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.6516\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003ctfoot\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"4\"\u003eValues were given as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviations. p values were obtained using unpaired one tail t-test. \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;.05 was considered statistically significant (n\u0026thinsp;=\u0026thinsp;50). AMH: anti-mullerian hormone; AFC: antral follicle count; E2: estradiol; FSH: follicle-stimulating hormone; LH: luteinizing hormone; P: progesterone; T: testosterone. * \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;.05.\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tfoot\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eElevated circulating progesterone in serum, PF and FF of endometriosis patients\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eTo gain a better understanding of component changes in local endometriosis circulating, metabolomics analyses was conducted in PF and FF from both endometriosis group (n\u0026thinsp;=\u0026thinsp;15) and control group (n\u0026thinsp;=\u0026thinsp;15). Interestingly, we found that the only overlapping metabolic alteration between PF and FF from endometriosis patients is the higher expression levels of progesterone (1.105\u0026thinsp;\u0026plusmn;\u0026thinsp;0.019 vs 0.852\u0026thinsp;\u0026plusmn;\u0026thinsp;0.025, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.048) (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eA).\u003c/p\u003e\n \u003cp\u003eTo confirm metabolomics observations, the levels of reproductive hormone including FSH, LH, E2, T and P were further measured in both serum and FF from patients in endometriosis group and control group (n\u0026thinsp;=\u0026thinsp;35). We found no differences in serum levels of FSH, LH, E2 and T on D2-5 (the second to the fifth day of menstrual cycle) and trigger day between the two groups (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05, respectively) (Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). However, compared with controls, higher levels of basal serum P (2.124\u0026thinsp;\u0026plusmn;\u0026thinsp;0.020 nmol/L vs 1.767\u0026thinsp;\u0026plusmn;\u0026thinsp;0.012 nmol/L, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.014) (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eB) and higher serum levels of P on trigger day (3.285\u0026thinsp;\u0026plusmn;\u0026thinsp;1.395 nmol/L vs 2.643\u0026thinsp;\u0026plusmn;\u0026thinsp;1.196 nmol/L, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.047) (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eC) were observed in endometriosis group, as well as significantly higher levels of P in FF (47.766\u0026thinsp;\u0026plusmn;\u0026thinsp;9.612 nmol/L vs 39.519\u0026thinsp;\u0026plusmn;\u0026thinsp;8.197 nmol/L, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.008) (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eD).\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eDecreased expression of HPGD and COX-2 in GCs of endometriosis patients\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eTo explore the effects of elevated P in FF on oocyte development and ovulation in endometriosis, we compared the genome-wide expression profiles of GCs from patients in both endometriosis group and control group (n\u0026thinsp;=\u0026thinsp;6) via RNA sequencing. According to the sequence data, we identified 98 downregulated and 77 upregulated genes in GCs of endometriosis patients compared with controls (Supplementary table 1, Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eA). \u003cem\u003eHPGD\u003c/em\u003e, which play an important role in the expression of PGE2, is one of those down-regulated genes with statistical significance. RT q-PCR and Western-blot were carried out on a larger size of GCs samples from endometriosis patients (n\u0026thinsp;=\u0026thinsp;20) and controls (n\u0026thinsp;=\u0026thinsp;20) to confirm the differences in \u003cem\u003eHPGD\u003c/em\u003e expression levels (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eB). COX-2, another key enzyme in the synthesis of PGE2, was also confirmed to be down-regulated in GCs samples from endometriosis patients (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eC).\u003c/p\u003e\n \u003cp\u003ePGE2 concentrations were further confirmed by ELISA in FF from both groups (n\u0026thinsp;=\u0026thinsp;35) to explore the effects of decreased HPGD and COX2 on PGE2 levels. The results showed that PGE2 concentrations in FF from EMT group were higher than that in control group (400.663\u0026thinsp;\u0026plusmn;\u0026thinsp;68.061 ng/L vs 330.791\u0026thinsp;\u0026plusmn;\u0026thinsp;58.755 ng/L, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001) (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eD).\u003c/p\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003cstrong\u003eRepressed NF-\u003c/strong\u003e\u003cstrong\u003eк\u003c/strong\u003e\u003cstrong\u003eB signaling activity in GCs of endometriosis patients\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAs shown by gene ontology (GO) analysis, many down-regulated genes in GCs from endometriosis group were involved in NF-кB associated pathways including IL-1 mediated signaling, cytokine mediated signaling and Myd88-dependent toll-like receptor signaling pathways (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eA). The involved genes include \u003cem\u003eIL1R1\u003c/em\u003e (-0.645 fold, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.028), a receptor for IL-1, acting as an important pro-inflammatory cytokine in the NF-кB pathway; \u003cem\u003eMAP3K1\u003c/em\u003e (-0.738 fold, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.100), involved in one of the upstream pathways of NF-кB pathway ERK/MAPK signaling pathway, and \u003cem\u003eIRAK3\u003c/em\u003e (-0.674 fold, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.030), an important NF-кB signaling molecule (Supplementary Table 1). Similarly, RT q-PCR and Western blot were carried out on a larger size of GC samples from endometriosis patients (n\u0026thinsp;=\u0026thinsp;20) and controls (n\u0026thinsp;=\u0026thinsp;20) to confirm the differential expression of these molecules (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eB, \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eC). Furthermore, decreased activation of IкB\u0026alpha; and p65, two other important NF-кB signaling molecules were also confirmed in GCs from endometriosis patients via Western blot (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eC).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEffects of progesterone on\u003c/strong\u003e \u003cspan class=\"BoldItalic\"\u003eHPGD\u003c/span\u003e \u003cstrong\u003eand\u003c/strong\u003e \u003cspan class=\"BoldItalic\"\u003eCOX-2\u003c/span\u003e \u003cstrong\u003eexpression and NF-кB signaling in GCs\u003c/strong\u003e \u003cspan class=\"BoldItalic\"\u003ein vitro\u003c/span\u003e\u003c/p\u003e\n\u003cp\u003eGiven the suppressed NF-кB signaling and downregulated \u003cem\u003eHPGD\u003c/em\u003e and \u003cem\u003eCOX-2\u003c/em\u003e expression in GCs from endometriosis patients, we further explored whether these alterations were due to elevated P in FF. KGN cells were treated with P at different concentrations (1 \u0026times; 10\u003csup\u003e\u0026minus;\u0026thinsp;6\u003c/sup\u003e, 1 \u0026times; 10\u003csup\u003e\u0026minus;\u0026thinsp;5\u003c/sup\u003e, 1 \u0026times; 10\u003csup\u003e\u0026minus;\u0026thinsp;4\u003c/sup\u003e, 1 \u0026times; 10\u003csup\u003e\u0026minus;\u0026thinsp;3\u003c/sup\u003e, 1 \u0026times; 10\u003csup\u003e\u0026minus;\u0026thinsp;2\u003c/sup\u003e nmol/L) \u003cem\u003ein vitro\u003c/em\u003e. RT q-PCR and western blot revealed decreased expressions of ILIR1 and IRAK3, as well as HPGD and COX-2 (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eA, \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eB, \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eC) by P treatment in a dose dependent manner, which was most obvious at a concentration of 1 \u0026times; 10\u003csup\u003e\u0026minus;\u0026thinsp;4\u003c/sup\u003e nmol/L in KGN cells.\u003c/p\u003e\n\u003cp\u003eThe time-dependent effects of progesterone treatment (1 \u0026times; 10\u003csup\u003e\u0026minus;\u0026thinsp;4\u003c/sup\u003e nmol/L) on NF-кB signaling in KGN cells was further investigated. Given that nuclear translocation of p65 is also a key step for NF-кB signaling transduction, the expression and localization of p65 were identified by Western blot on both cytoplasmic and nuclear protein and immunofluorescence in KGN cells respectively. The ratio of pIкB\u0026alpha;/ IкB\u0026alpha; in whole cell lysates were also determined by Western blot. The results revealed decreased NF-кB signaling activity by progesterone treatment \u003cem\u003ein vitro\u003c/em\u003e in a time-dependent manner, which reached a plateau after 30 minutes of treatment, as manifested by the decreased ratio of pIкB\u0026alpha;/ IкB\u0026alpha; and reduced nucleus translocation of p65 (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eD, \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eE, \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eF).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDirect regulatory effects of NF-кB signaling on\u003c/strong\u003e \u003cspan class=\"BoldItalic\"\u003eHPGD\u003c/span\u003e \u003cstrong\u003eexpression\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eKGN cells were exposed to TNF-\u0026alpha; (50 ng/mL) to explore whether the activation of NF-кB signaling can up-regulate the expression of \u003cem\u003eHPGD\u003c/em\u003e. The results showed that TNF-\u0026alpha; not only obviously enhanced the transduction of NF-кB signaling by up-regulating pIкB\u0026alpha;, p65, IL1R1 and IRAK3, but also up-regulated the expression of \u003cem\u003eHPGD\u003c/em\u003e as expected (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eA, \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eB). ChIP-PCR was conducted on KGN cells to explore whether there were binding elements for p65, an important downstream transcriptional factor, located at the promoter region of \u003cem\u003eHPGD\u003c/em\u003e. We used PROMO (a virtual laboratory for the identification of putative transcription factor binding sites (TFBS) in DNA sequences from a species or groups of species of interest) and LASAGNA-Search 2.0 (Integrated Transcription Factor Binding Site Search and Visualization in a Browser) to search for the potential p65 binding sites in the promotor region of \u003cem\u003eHPGD\u003c/em\u003e. After verified by ChIP-PCR, one potential p65 binding site was identified in the \u003cem\u003eHPGD\u003c/em\u003e promoter (starting at 1261 bp upstream of the transcription start site, 5\u0026rsquo;-AGGAAAATTTCCAA \u0026minus;\u0026thinsp;3\u0026rsquo;) (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eC, \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eD).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe present study showed a significantly elevated progesterone level in local circulating of endometriosis patients. Accordingly, NF-кB signaling was down-regulated in GCs derived from those patients, as manifested by decreased expression of IL1R1, IRAK3, reduced activation of IкBα and p65, compared with those of controls. \u003cem\u003eHPGD\u003c/em\u003e and \u003cem\u003eCOX-2\u003c/em\u003e were further found to be down-regulated in endometriosis GCs, positively correlating with NF-кB signaling activation, and negatively associated with intrafollicular progesterone levels. Similarly, progesterone suppressed NF-кB signaling and reduced \u003cem\u003eHPGD\u003c/em\u003e and \u003cem\u003eCOX-2\u003c/em\u003e expression \u003cem\u003ein vitro\u003c/em\u003e in KGN cells. The NF-кB activator TNF-α, by contrast, up-regulated HPGD expression. Furthermore, one potential binding element for p65 was identified in the promoter regions of \u003cem\u003eHPGD\u003c/em\u003e by ChIP-PCR, suggesting a direct role of NF-кB signaling in regulating \u003cem\u003eHPGD\u003c/em\u003e expression.\u003c/p\u003e \u003cp\u003ePrevious evidence showed that in women with moderate or severe endometriosis, some intrafollicular inflammatory cytokines were upregulated, unparallel with intrafollicular hormone concentrations [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. This may be due to the inflammatory microenvironment in women with endometriosis, impairing ovarian function and contributing to the reproductive dysfunction in endometriosis. However, whether some small molecular metabolites contribute to endometriosis-related ovulatory dysfunction is unknown. We collected both PF and FF from patients with ovarian endometriosis and control patients to explore the changes in the intrafollicular environment. Metabolic spectrum analysis showed significantly increased levels of progesterone in both FF and PF from endometriosis patients. It has been demonstrated that endometriotic stromal cells, which cause endometriotic lesions, were resistant to progesterone due to its deficiency in the expression of progesterone receptor (PR) [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Endometriotic tissues produce more progesterone and express significantly lower levels of PR compared with normal endometrium [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. The metabolic changes in FF and PF from patients with endometriosis could be a reflection of the component changes in the systemic or local circulation of endometriosis lesions in the ovary or peritoneal cavity [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. We can assume that it is the progesterone resistance of the endometriotic tissues that cause the elevated levels of progesterone in serum, FF and PF.\u003c/p\u003e \u003cp\u003eOocytes maturation is accompanied by GCs, the most common neighboring cells to FF in follicles. Therefore, we further conducted RNA sequencing in GCs from patients with ovarian endometriosis and healthy controls respectively to explore the alterations in RNA expression profile of GCs from endometriosis patients due to abnormal intrafollicular environment. The results revealed 98 down-regulated and 77 up-regulated genes in GCs from endometriosis group compared with controls. One of the most significantly altered signaling pathways was NF-кB by GO analysis. Activated by inflammatory cytokines, NF-кB was involved in cascade signal amplification of inflammation [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Constitutive activation and over-expression of NF-кB were also observed in endometriotic stromal cells both \u003cem\u003ein vivo\u003c/em\u003e and \u003cem\u003ein vitro\u003c/em\u003e [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Highly activated NF-кB in the ectopic endometrium of women with endometriosis was confirmed to be closely related to local inflammation [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Ovulation has been considered a local inflammatory response. The mid-cycle surge of LH initiates a network of interconnected signaling cascades that lead to follicular rupture and oocyte release during ovulation. Many mediators of the LH-initiated signaling cascades are involved with inflammation, introducing the hypothesis that ovulation is similar to an inflammatory response. However, the role of NF-кB signaling in endometriosis-related ovulatory dysfunction has not been explored yet.\u003c/p\u003e \u003cp\u003eIn our study, decreased activation of NF-кB was observed in GCs derived from patients with endometriosis. This seems to be contradictory with previous studies in endometrium. Progesterone is known to serve as an anti-inflammatory mediator [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Many recent studies have shown that progesterone acts through multiple mechanisms to inhibit NF-кB [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. As the direct lesion tissue of endometriosis, the endometrium may harbor specific epigenetic abnormalities altering expression of PR, leading to progesterone resistance [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e] and activation of NF-кB. Without those epigenetic abnormalities, GCs may behave differently due to the local inflammation caused by the ectopic endometrial lesion. We assume that the elevated level of P in FF from patients with endometriosis may contribute to suppressing NF-кB signaling in the neighboring GCs. However, the specific mechanism needs to be clarified.\u003c/p\u003e \u003cp\u003eCOX-2 is a rate-limiting enzyme in the PGE2 compound[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e], which has been reported as the key ovulatory prostaglandin [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. While HPGD acts as one of the primary catabolic enzymes of PGE2 and can modulate follicular PGE2 levels during the peri-ovulatory interval. Within the follicle, HPGD could maintain low intrafollicular PGE2 concentrations and lengthen the time between the ovulatory gonadotropin surge, thus facilitating the accumulation of PGE2 [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. Accumulation of PGE2 is widely thought to be a necessary and rate-limiting step in the process of ovulation in all mammalian species [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Duffy \u003cem\u003eet al\u003c/em\u003e reported that exposure of GCs to progesterone decreased \u003cem\u003eHPGD\u003c/em\u003e mRNA levels \u003cem\u003ein vitro\u003c/em\u003e [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Similarly, down-regulation of \u003cem\u003eHPGD\u003c/em\u003e and \u003cem\u003eCOX2\u003c/em\u003e in GCs from patients with endometriosis was also found in the present study. We assume that the decreased expression of \u003cem\u003eHPGD\u003c/em\u003e and \u003cem\u003eCOX-2\u003c/em\u003e in GCs, due to the elevated levels of progesterone in FF in endometriosis, may synergistically contribute to the decreased PGE2 levels in FF of endometriosis patients.\u003c/p\u003e \u003cp\u003eTo verify the above assumptions, we investigated whether progesterone-suppressed NF-кB signaling pathway and down-regulated \u003cem\u003eHPGD\u003c/em\u003e and \u003cem\u003eCOX-2\u003c/em\u003e expression \u003cem\u003ein vitro\u003c/em\u003e in KGN cells, a granulosa tumor-like cell line. Our results revealed that progesterone significantly decreased the expression or suppressed the physiologic activation of NF-кB signaling involved molecules including IкBα and p65 [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e], which were also down-regulated in endometriosis GCs, \u003cem\u003ein vitro\u003c/em\u003e in a dose-dependent manner. This observation suggests a role for progesterone in suppressing the NF-кB signaling pathway in GCs. On the other hand, progesterone obviously decreased both the mRNA and protein expression of HPGD and COX-2 in KGN cells as well. The NF-кB signaling pathway might participate in the regulation of HPGD expression by progesterone, as significantly increased HPGD expression was also observed after the induction of NF-кB by TNF-α in KGN cells. Furthermore, we defined one potential binding element for p65 in the promoter region of \u003cem\u003eHPGD\u003c/em\u003e by ChIP-PCR. These results suggest HPGD may be down-regulated by high levels of progesterone in FF through suppressing NF-кB signaling in endometriosis.\u003c/p\u003e \u003cp\u003eTaken together, we found that patients with ovarian endometriosis presented with suppressed NF-кB signaling pathway in GCs, which might be a negative factor to the timely regulation mode of PGE2 expression and ovulation. Intrafollicular progesterone might down-regulate \u003cem\u003eHPGD\u003c/em\u003e and \u003cem\u003eCOX-2\u003c/em\u003e expression in GCs via suppressing the NF-кB signaling pathway (Supplementary Fig.\u0026nbsp;1), while the regulation mechanism is to be investigated. Our study sheds light on the mechanism involved in the ovulatory dysfunction in patients with endometriosis and provide potential therapeutic targets for improvements of their ovulatory function. However, further studies are needed to explore mechanisms involved in the adverse effects of decreased PGE2 in FF on ovulation.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eHigher FF progesterone may down-regulate \u003cem\u003eHPGD\u003c/em\u003e and \u003cem\u003eCOX2\u003c/em\u003e, which play important roles in the process of ovulation by participating in the metabolism of PGE2, in GCs via suppressing NF-кB signaling and may lead to ovulatory dysfunction in endometriosis patients.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors thank all participants involved in this study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDZ and JYL conceived of the study, participated in its design and coordination and helped to draft the manuscript. JPC carried out the molecular studies, participated in the in vitro experiments and drafted the manuscript. YLQ and YFL carried out the ChIP-PCR experiments, JYM and FDN carried out the IHF experiments, RJZ and SWW is involved in revising the manuscript, YH, JL, XCW and BBW are involved in sample and clinical data collection, MXT and YYY help carrying out the WB experiments. YQW and BZ helped with the hormone assay.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the National Key Research and Development Program of China (2018YFC1005003, 2017YFC1001003), the National Natural Science Foundation of China (No. 81974224, 81771535, 82001537), the Natural Science Foundation of Zhejiang Province (No. LZ18H040001, LQ19H040007), Zhejiang Provincial Key Medical Technology Program (WKJ-ZJ-1826), and Zhejiang University Education Foundation Global Partnership Fund. No competing interests to declare.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data underlying this article are available in the article and in its online supplementary material.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was approved by the medical ethics committee of the Women\u0026rsquo;s Hospital of Zhejiang University School of Medicine (Ethics Lot number 20170021).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have none to declare.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003ede Ziegler D, Borghese B, Chapron C: \u003cstrong\u003eEndometriosis and infertility: pathophysiology and management.\u003c/strong\u003e \u003cem\u003eLancet\u0026nbsp;\u003c/em\u003e2010, \u003cstrong\u003e376:\u003c/strong\u003e730-738.\u003c/li\u003e\n \u003cli\u003eGiudice LC: \u003cstrong\u003eClinical practice. Endometriosis.\u003c/strong\u003e \u003cem\u003eN Engl J Med\u0026nbsp;\u003c/em\u003e2010, \u003cstrong\u003e362:\u003c/strong\u003e2389-2398.\u003c/li\u003e\n \u003cli\u003eQublan H, Amarin Z, Nawasreh M, Diab F, Malkawi S, Al-Ahmad N, Balawneh M: \u003cstrong\u003eLuteinized unruptured follicle syndrome: incidence and recurrence rate in infertile women with unexplained infertility undergoing intrauterine insemination.\u003c/strong\u003e \u003cem\u003eHum Reprod\u0026nbsp;\u003c/em\u003e2006, \u003cstrong\u003e21:\u003c/strong\u003e2110-2113.\u003c/li\u003e\n \u003cli\u003eDal J, Vural B, Caliskan E, Ozkan S, Yucesoy I: \u003cstrong\u003ePower Doppler ultrasound studies of ovarian, uterine, and endometrial blood flow in regularly menstruating women with respect to luteal phase defects.\u003c/strong\u003e \u003cem\u003eFertil Steril\u0026nbsp;\u003c/em\u003e2005, \u003cstrong\u003e84:\u003c/strong\u003e224-227.\u003c/li\u003e\n \u003cli\u003eKaya H, Oral B: \u003cstrong\u003eEffect of ovarian involvement on the frequency of luteinized unruptured follicle in endometriosis.\u003c/strong\u003e \u003cem\u003eGynecol Obstet Invest\u0026nbsp;\u003c/em\u003e1999, \u003cstrong\u003e48:\u003c/strong\u003e123-126.\u003c/li\u003e\n \u003cli\u003eHennet ML, Combelles CM: \u003cstrong\u003eThe antral follicle: a microenvironment for oocyte differentiation.\u003c/strong\u003e \u003cem\u003eInt J Dev Biol\u0026nbsp;\u003c/em\u003e2012, \u003cstrong\u003e56:\u003c/strong\u003e819-831.\u003c/li\u003e\n \u003cli\u003eNagy RA, van Montfoort AP, Dikkers A, van Echten-Arends J, Homminga I, Land JA, Hoek A, Tietge UJ: \u003cstrong\u003ePresence of bile acids in human follicular fluid and their relation with embryo development in modified natural cycle IVF.\u003c/strong\u003e \u003cem\u003eHum Reprod\u0026nbsp;\u003c/em\u003e2015, \u003cstrong\u003e30:\u003c/strong\u003e1102-1109.\u003c/li\u003e\n \u003cli\u003eBasuino L, Silveira CF, Jr.: \u003cstrong\u003eHuman follicular fluid and effects on reproduction.\u003c/strong\u003e \u003cem\u003eJBRA Assist Reprod\u0026nbsp;\u003c/em\u003e2016, \u003cstrong\u003e20:\u003c/strong\u003e38-40.\u003c/li\u003e\n \u003cli\u003ede Barros IBL, Malvezzi H, Gueuvoghlanian-Silva BY, Piccinato CA, Rizzo LV, Podgaec S: \u003cstrong\u003e\u0026quot;What do we know about regulatory T cells and endometriosis? A systematic review\u0026quot;.\u003c/strong\u003e \u003cem\u003eJ Reprod Immunol\u0026nbsp;\u003c/em\u003e2017, \u003cstrong\u003e120:\u003c/strong\u003e48-55.\u003c/li\u003e\n \u003cli\u003eMatsuda F, Inoue N, Manabe N, Ohkura S: \u003cstrong\u003eFollicular growth and atresia in mammalian ovaries: regulation by survival and death of granulosa cells.\u003c/strong\u003e \u003cem\u003eJ Reprod Dev\u0026nbsp;\u003c/em\u003e2012, \u003cstrong\u003e58:\u003c/strong\u003e44-50.\u003c/li\u003e\n \u003cli\u003eSaito H, Seino T, Kaneko T, Nakahara K, Toya M, Kurachi H: \u003cstrong\u003eEndometriosis and oocyte quality.\u003c/strong\u003e \u003cem\u003eGynecol Obstet Invest\u0026nbsp;\u003c/em\u003e2002, \u003cstrong\u003e53 Suppl 1:\u003c/strong\u003e46-51.\u003c/li\u003e\n \u003cli\u003eBrannstrom M, Pascoe V, Norman RJ, McClure N: \u003cstrong\u003eLocalization of leukocyte subsets in the follicle wall and in the corpus luteum throughout the human menstrual cycle.\u003c/strong\u003e \u003cem\u003eFertil Steril\u0026nbsp;\u003c/em\u003e1994, \u003cstrong\u003e61:\u003c/strong\u003e488-495.\u003c/li\u003e\n \u003cli\u003eVan der Hoek KH, Maddocks S, Woodhouse CM, van Rooijen N, Robertson SA, Norman RJ: \u003cstrong\u003eIntrabursal injection of clodronate liposomes causes macrophage depletion and inhibits ovulation in the mouse ovary.\u003c/strong\u003e \u003cem\u003eBiol Reprod\u0026nbsp;\u003c/em\u003e2000, \u003cstrong\u003e62:\u003c/strong\u003e1059-1066.\u003c/li\u003e\n \u003cli\u003eWang F, Pan J, Liu Y, Meng Q, Lv P, Qu F, Ding GL, Klausen C, Leung PC, Chan HC, et al: \u003cstrong\u003eAlternative splicing of the androgen receptor in polycystic ovary syndrome.\u003c/strong\u003e \u003cem\u003eProc Natl Acad Sci U S A\u0026nbsp;\u003c/em\u003e2015, \u003cstrong\u003e112:\u003c/strong\u003e4743-4748.\u003c/li\u003e\n \u003cli\u003eNishi Y, Yanase T, Mu Y, Oba K, Ichino I, Saito M, Nomura M, Mukasa C, Okabe T, Goto K, et al: \u003cstrong\u003eEstablishment and characterization of a steroidogenic human granulosa-like tumor cell line, KGN, that expresses functional follicle-stimulating hormone receptor.\u003c/strong\u003e \u003cem\u003eEndocrinology\u0026nbsp;\u003c/em\u003e2001, \u003cstrong\u003e142:\u003c/strong\u003e437-445.\u003c/li\u003e\n \u003cli\u003eRocha S, Campbell KJ, Perkins ND: \u003cstrong\u003ep53- and Mdm2-independent repression of NF-kappa B transactivation by the ARF tumor suppressor.\u003c/strong\u003e \u003cem\u003eMol Cell\u0026nbsp;\u003c/em\u003e2003, \u003cstrong\u003e12:\u003c/strong\u003e15-25.\u003c/li\u003e\n \u003cli\u003eWang K, Singh D, Zeng Z, Coleman SJ, Huang Y, Savich GL, He X, Mieczkowski P, Grimm SA, Perou CM, et al: \u003cstrong\u003eMapSplice: accurate mapping of RNA-seq reads for splice junction discovery.\u003c/strong\u003e \u003cem\u003eNucleic Acids Res\u0026nbsp;\u003c/em\u003e2010, \u003cstrong\u003e38:\u003c/strong\u003ee178.\u003c/li\u003e\n \u003cli\u003eZhou X, Wu W, Li H, Cheng Y, Wei N, Zong J, Feng X, Xie Z, Chen D, Manley JL, et al: \u003cstrong\u003eTranscriptome analysis of alternative splicing events regulated by SRSF10 reveals position-dependent splicing modulation.\u003c/strong\u003e \u003cem\u003eNucleic Acids Res\u0026nbsp;\u003c/em\u003e2014, \u003cstrong\u003e42:\u003c/strong\u003e4019-4030.\u003c/li\u003e\n \u003cli\u003eAnders S, Pyl PT, Huber W: \u003cstrong\u003eHTSeq--a Python framework to work with high-throughput sequencing data.\u003c/strong\u003e \u003cem\u003eBioinformatics\u0026nbsp;\u003c/em\u003e2015, \u003cstrong\u003e31:\u003c/strong\u003e166-169.\u003c/li\u003e\n \u003cli\u003eKallio MA, Tuimala JT, Hupponen T, Klemela P, Gentile M, Scheinin I, Koski M, Kaki J, Korpelainen EI: \u003cstrong\u003eChipster: user-friendly analysis software for microarray and other high-throughput data.\u003c/strong\u003e \u003cem\u003eBMC Genomics\u0026nbsp;\u003c/em\u003e2011, \u003cstrong\u003e12:\u003c/strong\u003e507.\u003c/li\u003e\n \u003cli\u003eAshburner M, Ball CA, Blake JA, Botstein D, Butler H, Cherry JM, Davis AP, Dolinski K, Dwight SS, Eppig JT, et al: \u003cstrong\u003eGene ontology: tool for the unification of biology. The Gene Ontology Consortium.\u003c/strong\u003e \u003cem\u003eNat Genet\u0026nbsp;\u003c/em\u003e2000, \u003cstrong\u003e25:\u003c/strong\u003e25-29.\u003c/li\u003e\n \u003cli\u003eDraghici S, Khatri P, Tarca AL, Amin K, Done A, Voichita C, Georgescu C, Romero R: \u003cstrong\u003eA systems biology approach for pathway level analysis.\u003c/strong\u003e \u003cem\u003eGenome Res\u0026nbsp;\u003c/em\u003e2007, \u003cstrong\u003e17:\u003c/strong\u003e1537-1545.\u003c/li\u003e\n \u003cli\u003eWu G, Bersinger NA, Mueller MD, von Wolff M: \u003cstrong\u003eIntrafollicular inflammatory cytokines but not steroid hormone concentrations are increased in naturally matured follicles of women with proven endometriosis.\u003c/strong\u003e \u003cem\u003eJ Assist Reprod Genet\u0026nbsp;\u003c/em\u003e2017, \u003cstrong\u003e34:\u003c/strong\u003e357-364.\u003c/li\u003e\n \u003cli\u003eOpoien HK, Fedorcsak P, Polec A, Stensen MH, Abyholm T, Tanbo T: \u003cstrong\u003eDo endometriomas induce an inflammatory reaction in nearby follicles?\u003c/strong\u003e \u003cem\u003eHum Reprod\u0026nbsp;\u003c/em\u003e2013, \u003cstrong\u003e28:\u003c/strong\u003e1837-1845.\u003c/li\u003e\n \u003cli\u003eBulun SE, Yilmaz BD, Sison C, Miyazaki K, Bernardi L, Liu S, Kohlmeier A, Yin P, Milad M, Wei J: \u003cstrong\u003eEndometriosis.\u003c/strong\u003e \u003cem\u003eEndocr Rev\u0026nbsp;\u003c/em\u003e2019, \u003cstrong\u003e40:\u003c/strong\u003e1048-1079.\u003c/li\u003e\n \u003cli\u003eAttar E, Tokunaga H, Imir G, Yilmaz MB, Redwine D, Putman M, Gurates B, Attar R, Yaegashi N, Hales DB, Bulun SE: \u003cstrong\u003eProstaglandin E2 via steroidogenic factor-1 coordinately regulates transcription of steroidogenic genes necessary for estrogen synthesis in endometriosis.\u003c/strong\u003e \u003cem\u003eJ Clin Endocrinol Metab\u0026nbsp;\u003c/em\u003e2009, \u003cstrong\u003e94:\u003c/strong\u003e623-631.\u003c/li\u003e\n \u003cli\u003eDaniels S, Robbins J, West CR, Nemeth MA: \u003cstrong\u003eCelecoxib in the treatment of primary dysmenorrhea: results from two randomized, double-blind, active- and placebo-controlled, crossover studies.\u003c/strong\u003e \u003cem\u003eClin Ther\u0026nbsp;\u003c/em\u003e2009, \u003cstrong\u003e31:\u003c/strong\u003e1192-1208.\u003c/li\u003e\n \u003cli\u003eKoninckx PR, Kennedy SH, Barlow DH: \u003cstrong\u003eEndometriotic disease: the role of peritoneal fluid.\u003c/strong\u003e \u003cem\u003eHum Reprod Update\u0026nbsp;\u003c/em\u003e1998, \u003cstrong\u003e4:\u003c/strong\u003e741-751.\u003c/li\u003e\n \u003cli\u003ePark MH, Hong JT: \u003cstrong\u003eRoles of NF-kappaB in Cancer and Inflammatory Diseases and Their Therapeutic Approaches.\u003c/strong\u003e \u003cem\u003eCells\u0026nbsp;\u003c/em\u003e2016, \u003cstrong\u003e5\u003c/strong\u003e.\u003c/li\u003e\n \u003cli\u003eKim SH, Ihm HJ, Oh YS, Chae HD, Kim CH, Kang BM: \u003cstrong\u003eIncreased nuclear expression of nuclear factor kappa-B p65 subunit in the eutopic endometrium and ovarian endometrioma of women with advanced stage endometriosis.\u003c/strong\u003e \u003cem\u003eAm J Reprod Immunol\u0026nbsp;\u003c/em\u003e2013, \u003cstrong\u003e70:\u003c/strong\u003e497-508.\u003c/li\u003e\n \u003cli\u003eCao WG, Morin M, Sengers V, Metz C, Roger T, Maheux R, Akoum A: \u003cstrong\u003eTumour necrosis factor-alpha up-regulates macrophage migration inhibitory factor expression in endometrial stromal cells via the nuclear transcription factor NF-kappaB.\u003c/strong\u003e \u003cem\u003eHum Reprod\u0026nbsp;\u003c/em\u003e2006, \u003cstrong\u003e21:\u003c/strong\u003e421-428.\u003c/li\u003e\n \u003cli\u003eTibbetts TA, Conneely OM, O\u0026apos;Malley BW: \u003cstrong\u003eProgesterone via its receptor antagonizes the pro-inflammatory activity of estrogen in the mouse uterus.\u003c/strong\u003e \u003cem\u003eBiol Reprod\u0026nbsp;\u003c/em\u003e1999, \u003cstrong\u003e60:\u003c/strong\u003e1158-1165.\u003c/li\u003e\n \u003cli\u003eDavies S, Dai D, Feldman I, Pickett G, Leslie KK: \u003cstrong\u003eIdentification of a novel mechanism of NF-kappaB inactivation by progesterone through progesterone receptors in Hec50co poorly differentiated endometrial cancer cells: induction of A20 and ABIN-2.\u003c/strong\u003e \u003cem\u003eGynecol Oncol\u0026nbsp;\u003c/em\u003e2004, \u003cstrong\u003e94:\u003c/strong\u003e463-470.\u003c/li\u003e\n \u003cli\u003eMurakami M, Kudo I: \u003cstrong\u003eRecent advances in molecular biology and physiology of the prostaglandin E2-biosynthetic pathway.\u003c/strong\u003e \u003cem\u003eProg Lipid Res\u0026nbsp;\u003c/em\u003e2004, \u003cstrong\u003e43:\u003c/strong\u003e3-35.\u003c/li\u003e\n \u003cli\u003eDuffy DM, Dozier BL, Seachord CL: \u003cstrong\u003eProstaglandin dehydrogenase and prostaglandin levels in periovulatory follicles: implications for control of primate ovulation by prostaglandin E2.\u003c/strong\u003e \u003cem\u003eJ Clin Endocrinol Metab\u0026nbsp;\u003c/em\u003e2005, \u003cstrong\u003e90:\u003c/strong\u003e1021-1027.\u003c/li\u003e\n \u003cli\u003eSayasith K, Bouchard N, Dore M, Sirois J: \u003cstrong\u003eCloning of equine prostaglandin dehydrogenase and its gonadotropin-dependent regulation in theca and mural granulosa cells of equine preovulatory follicles during the ovulatory process.\u003c/strong\u003e \u003cem\u003eReproduction\u0026nbsp;\u003c/em\u003e2007, \u003cstrong\u003e133:\u003c/strong\u003e455-466.\u003c/li\u003e\n \u003cli\u003eDuffy DM: \u003cstrong\u003eNovel contraceptive targets to inhibit ovulation: the prostaglandin E2 pathway.\u003c/strong\u003e \u003cem\u003eHum Reprod Update\u0026nbsp;\u003c/em\u003e2015, \u003cstrong\u003e21:\u003c/strong\u003e652-670.\u003c/li\u003e\n \u003cli\u003eHayden MS, Ghosh S: \u003cstrong\u003eRegulation of NF-kappaB by TNF family cytokines.\u003c/strong\u003e \u003cem\u003eSemin Immunol\u0026nbsp;\u003c/em\u003e2014, \u003cstrong\u003e26:\u003c/strong\u003e253-266.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"endometriosis, progesterone, follicular fluid, granulosa cell, LUFS, PGE2","lastPublishedDoi":"10.21203/rs.3.rs-882586/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-882586/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground: \u003c/strong\u003eLuteinized unruptured follicular follicle syndrome (LUFS) is a special type of ovulatory dysfunction and a common cause of infertility. It is estimated that its prevalence is 13% ~ 73% in endometriosis patients. Increasing evidences prove that LUFS is one of the reasons for endometriosis-related infertility. Any alteration in FF components and GCs in endometriosis may influence the developing oocyte and ovulation. This study aimed to explore the effect of local elevated progesterone in follicular fluid (FF) on ovulation in endometriosis patients.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eMethods: \u003c/strong\u003eA Prospective study with matched pairs design was conducted at a reproductive medicine center between July 2017 and January 2018 in patients undergoing in vitro fertilization (IVF) or intracytoplasmic sperm injection treatment (ICSI), while granulosa tumor-like cell line KGN (Bena culture collection, China) was used as \u003cem\u003ein vitro\u003c/em\u003e cell model.\u003cstrong\u003e \u003c/strong\u003eAlterations in follicular and peritoneal fluid (PF) components identified with metabolomics analyses; Differentially expressed genes in GCs identified with transcriptome analysis; Polymerase chain reaction (PCR), western blot, enzyme-linked immunosorbent assay (ELISA) \u0026nbsp;and immunofluorescence were used to determine the expression of progesterone, NF-кB related genes, \u003cem\u003eHPGD \u003c/em\u003eand \u003cem\u003eCOX-2\u003c/em\u003e; NF-кB binding identified with chromatin immunoprecipitation (ChIP).\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eResults: \u003c/strong\u003ePatients with endometriosis exhibited a significantly higher basal serum progesterone level, higher serum level of progesterone on trigger day and higher progesterone expression level in FF and PF. GCs from endometriosis patients revealed decreased expression of \u003cem\u003eHPGD\u003c/em\u003e, \u003cem\u003eCOX-2\u003c/em\u003e and suppressed NF-кB signaling, as manifested by decreased expressions of \u003cem\u003eIL1R1\u003c/em\u003e and \u003cem\u003eIRAK3\u003c/em\u003e. Similarly, progesterone treatment \u003cem\u003ein vitro\u003c/em\u003e down-regulated \u003cem\u003eHPGD\u003c/em\u003e and \u003cem\u003eCOX2\u003c/em\u003e expression and suppressed NF-кB signaling in KGN cells in a dose dependent manner, as manifested by decreased expressions of IL1R1, IRAK3, reduced pIкBα/IкBα ratio and nucleus translocation of p65. TNF-α, by contrast, increased expression of IL1R1, IRAK3, pIкBα, p65 and HPGD in KGN cells. Furthermore, one potential p65 binding site was identified in the promoter region of \u003cem\u003eHPGD\u003c/em\u003e by chromatin immunoprecipitation.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eConclusion: \u003c/strong\u003eEndometriosis showed repression of NF-кB pathways and down-regulation of \u003cem\u003eHPGD\u003c/em\u003e and \u003cem\u003eCOX2\u003c/em\u003e, which play important roles in the process of ovulation by participating in the metabolism of prostaglandin E2 (PGE2), in granulosa cells (GCs) due to elevated progesterone in FF.\u0026nbsp;\u003c/p\u003e","manuscriptTitle":"Higher Follicular Fluid Progesterone Down-regulated HPGD and COX2 in Granulosa Cells via Suppressing NF-кB Signaling in Endometriosis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2021-09-09 19:11:45","doi":"10.21203/rs.3.rs-882586/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"05ce82d2-02bc-4483-97ad-da59bb0e783f","owner":[],"postedDate":"September 9th, 2021","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":7075309,"name":"Endocrinology \u0026 Metabolism"}],"tags":[],"updatedAt":"2021-09-09T19:14:46+00:00","versionOfRecord":[],"versionCreatedAt":"2021-09-09 19:11:45","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-882586","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-882586","identity":"rs-882586","version":["v1"]},"buildId":"B-jG_2CBjPDmsCi4Wdhf-","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Condition tags

endometriosis

Citation neighborhood (sparse)

Too few in-corpus citations on either side for a chart; here are the lists.

Cites (3)

References (15)

Source provenance

europepmc
last seen: 2026-09-21T07:13:24.865968+00:00
openalex
last seen: 2026-06-10T17:14:06.276822+00:00
License: CC0 · commercial use OK