Expression of membrane progesterone receptors in eutopic and ectopic endometrium of women with endometriosis

In: Research Square · 2020 · doi:10.21203/rs.3.rs-16694/v1 · W4246620198
preprint OA: green CC0 ⤵ 1 in-corpus citation
AI-generated summary by claude@2026-06, 2026-06-08

This study found decreased expression and protein content of membrane progesterone receptors (mPRs) in eutopic and ectopic endometrium of women with endometriosis, potentially contributing to progesterone resistance.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

AI-generated deep summary by claude@2026-06, 2026-06-08 · read from full text

This study assessed mRNA expression and protein content of membrane progesterone receptors from the PAQR family (PAQR7/mPRα, PAQR8/mPRβ, PAQR5/mPRγ, and PAQR6/mPRδ) in endometrium from women with ovarian endometriosis and in control endometrium. Using RT-qPCR and Western blot on samples from eutopic endometrium of 17 patients and 17 controls, plus ectopic lesion tissues from 9 patients, the authors found reduced PAQR7 and PAQR5 mRNA in both eutopic and ectopic endometrium, and reduced PAQR8 and PAQR6 mRNA specifically in eutopic endometrium; mPRα and mPRβ protein content were decreased in ectopic endometrium. A key caveat is the observational design with relatively small and phase-influenced sampling (many samples in the proliferative phase, and ectopic tissues split across lesion types). This paper is centrally about endometriosis — specifically, it analyzes membrane progesterone receptor (PAQR/mPR) expression in eutopic versus ectopic endometrium in women with endometriosis.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Abstract Background: Endometriosis is one of the most frequent gynecological diseases in reproductive age women, but its etiology is not completely understood. Endometriosis is characterized by progesterone resistance, which has been explained in part by a decrease in the expression of the intracellular progesterone receptor in the ectopic endometrium. Progesterone action is also mediated by non-genomic mechanisms via membrane progesterone receptors that belong to the class II members of the progesterone and adipoQ receptor (PAQR) family. The aim of the present study was to evaluate the expression at mRNA and protein levels of PAQR family members in the eutopic and ectopic endometrium of women with endometriosis. Methods : Total RNA and total protein were isolated from control endometrium (17 samples), eutopic endometrium (17 samples), and ectopic endometrium (9 samples). The expression of PAQR7 ( mPRα ) , PAQR8 , (mPRβ) PAQR5 ( mPRγ ) , and PAQR6 ( mPRδ ) at mRNA and protein levels was evaluated by RT-qPCR and western blot. Statistical analysis between comparable groups was performed using one-way ANOVA followed by Tukey's multiple comparisons test with a confidence interval of 95%. Results : The analysis of gene expression showed that PAQR7 and PAQR5 expression was lower in both eutopic and ectopic endometrium as compared to the endometrium of women without endometriosis, whereas the expression of PAQR8 and PAQR6 was only reduced in eutopic endometrium. Furthermore, mPRα and mPRβ protein content was decreased in the ectopic endometrium of women with endometriosis. Conclusions : Our results demonstrate a decrease in the expression and protein content of mPRs in eutopic and ectopic endometrium of patients with endometriosis, which could contribute to the progesterone resistance observed in patients with this disease.
Full text 89,649 characters · extracted from preprint-html · click to expand
Expression of membrane progesterone receptors in eutopic and ectopic endometrium of women with endometriosis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Expression of membrane progesterone receptors in eutopic and ectopic endometrium of women with endometriosis EDGAR RICARDO VAZQUEZ-MARTINEZ, Claudia Bello-Alvarez, Ana Lorena Hermenegildo-Molina, and 14 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-16694/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 14 Jul, 2020 Read the published version in BioMed Research International → Version 1 posted You are reading this latest preprint version Abstract Background: Endometriosis is one of the most frequent gynecological diseases in reproductive age women, but its etiology is not completely understood. Endometriosis is characterized by progesterone resistance, which has been explained in part by a decrease in the expression of the intracellular progesterone receptor in the ectopic endometrium. Progesterone action is also mediated by non-genomic mechanisms via membrane progesterone receptors that belong to the class II members of the progesterone and adipoQ receptor (PAQR) family. The aim of the present study was to evaluate the expression at mRNA and protein levels of PAQR family members in the eutopic and ectopic endometrium of women with endometriosis. Methods : Total RNA and total protein were isolated from control endometrium (17 samples), eutopic endometrium (17 samples), and ectopic endometrium (9 samples). The expression of PAQR7 ( mPRα ) , PAQR8 , (mPRβ) PAQR5 ( mPRγ ) , and PAQR6 ( mPRδ ) at mRNA and protein levels was evaluated by RT-qPCR and western blot. Statistical analysis between comparable groups was performed using one-way ANOVA followed by Tukey's multiple comparisons test with a confidence interval of 95%. Results : The analysis of gene expression showed that PAQR7 and PAQR5 expression was lower in both eutopic and ectopic endometrium as compared to the endometrium of women without endometriosis, whereas the expression of PAQR8 and PAQR6 was only reduced in eutopic endometrium. Furthermore, mPRα and mPRβ protein content was decreased in the ectopic endometrium of women with endometriosis. Conclusions : Our results demonstrate a decrease in the expression and protein content of mPRs in eutopic and ectopic endometrium of patients with endometriosis, which could contribute to the progesterone resistance observed in patients with this disease. Sexual & Reproductive Medicine endometriosis progesterone membrane progesterone receptor endometrium Figures Figure 1 Figure 2 Background Endometriosis is defined as the presence of endometrial glands and stroma outside the uterus, which are commonly found in the peritoneal cavity and ovaries [1–3]. Endometriosis is the leading cause of chronic and cyclic pelvic pain in reproductive age women, affecting 10–15% of women worldwide; pain symptoms include dysmenorrhea, dyspareunia, dysuria and dyschezia [4,5]. Infertility is commonly associated with this disease mainly due to physical and molecular disruption in the uterus which in turn reduces implantation capacity, and finally increases the risk of pregnancy loss [6]. Moreover, endometriosis negatively impacts women’s quality of life by deteriorating their physical, mental, and social wellbeing [7]. The gold standard for the diagnosis of endometriosis is made by laparoscopic inspection with histologic confirmation after biopsy [8]. The aim of endometriosis treatment is to mitigate the symptoms associated with the disease and includes pharmacological therapy with non-steroidal anti-inflammatory drugs, progestins, oral contraceptives, and gonadotropin-releasing hormone agonists, as well as surgical removal of endometrial implants and the affected tissue; however, endometriosis recurs in at least 5–15% of the cases after most invasive surgeries [8,9]. The etiology of this disease is far from being elucidated; however, altered estrogen signaling and progesterone resistance have been identified as the most common hallmarks of this disease [10]. Progesterone resistance in endometriosis has been attributed in part to a decrease in the expression of the B isoform of its intracellular receptor (PR-B) in the endometriotic lesions (ectopic endometrium) of women with the disease [11]. Furthermore, it has been proposed that progesterone resistance leads to an altered eutopic endometrium function in women with endometriosis, which in turn has been associated with pregnancy loss [6]. There is controversy about the alteration in the expression of PR in eutopic endometrium, suggesting that other mechanisms should be involved in progesterone resistance in this tissue [12]. Progesterone induces the decidualization of the endometrium, which is essential for embryo implantation and maintenance of pregnancy [13]. It has been demonstrated that progesterone exerts its actions by activating genomic and non-genomic mechanisms [14,15]. Genomic action mechanisms are mediated by the PR, which acts as a ligand-dependent transcription factor that regulates the expression of progesterone responsive genes [16–18]. Besides, non-genomic action mechanisms are mediated in part by specific receptors localized in the plasma membrane that are not related to PR, and are divided into two major groups: the membrane progesterone receptors (mPRs) that belong to the class II members of the progesterone and adipoQ receptor (PAQR) family, and the progesterone receptor membrane components (PGRMCs) [19]. mPRs are G protein-coupled receptors that are encoded by five different genes: PAQR7 (mPRα), PAQR8 (mPRβ), PAQR5 (mPRγ), PAQR6 (mPRδ) and PAQR9 (mPRε) [19,20]. The activation of mPRs is necessary to achieve full effects of progesterone in some responsive tissues or cells to this hormone in which those effects are only partially explained by PR activation [21–23]. Importantly, we and others have demonstrated that the content and activity of these receptors are altered in many diseases, including cancer [24–27]. The expression pattern of mPRs is tissue-specific and their activation by progesterone or by the mPRs specific agonist 10-ethenyl-19-norprogesterone (Org OD 02 − 0) regulates signaling pathways involved in mammary gland development, sexual behavior, ovulation, maintenance of pregnancy and other processes [19,21,28–32]. mPRs are expressed in female reproductive and embryonic tissues, mainly in the endometrium, myometrium, ovaries, and placenta [19,30,33,34]. Particularly, it has been demonstrated that PAQR7 , PAQR8 , PARQ5 , and PAQR9 are expressed in the endometrium. PAQR7 expression is induced during the secretory phase of the menstrual cycle, whereas the expression of PAQR5 and PAQR9 is decreased during that phase [30]. In addition, PAQR7 and PAQR8 expression and the respective protein content are decreased in endometrial cancer compared to adjacent non-affected endometrium, whereas mPRγ protein content is increased in endometrial cancer tissue [35]. To the best of our knowledge, it has not been demonstrated whether gene expression and protein content of mPRs are altered in ectopic lesions and eutopic endometrium of patients with endometriosis. We hypothesized that the expression of mPRs is decreased in both eutopic and ectopic endometrium of patients with endometriosis compared with the endometrium of women without the disease, similar to that reported in PR. Methods Aim and design of the study The aim of the present study was to evaluate the mRNA expression and protein content of mPRs in eutopic and ectopic endometrium of women with endometriosis and endometrium in control subjects. This is an observational study of cases (endometriosis patients) and controls (women without the disease). Participants and tissue collection Seventeen patients with ovarian endometriosis (confirmed by laparoscopy and histological analysis) and seventeen women without the disease undergoing hysterectomy for benign conditions were recruited. Women included in the present study had regular menstrual cycles and did not take any hormonal treatment (included contraceptives) for at least 3 months before obtaining the sample. The characteristics of the women included in the present study are summarized in Table 1 . This study was approved by the Research and Ethical Committee from the Instituto Nacional de Perinatología in Mexico City, Mexico, reference number IRB00001944 and complied with the 1964 Declaration of Helsinki and its later amendments. All study participants signed informed consent for enrolment in the present study. Samples were collected from November 2016 to October 2019. A total of seven tissue biopsies from ovarian endometrioma, two tissue biopsies from peritoneum lesions and seventeen biopsies from eutopic endometrium were obtained from women with a diagnosis of ovarian endometriosis at the time of resection surgery. Seventeen endometrial biopsies were obtained from women without endometriosis (controls). Endometrial samples from patients (eutopic) and controls were obtained using a Pipelle suction curette. Most samples were obtained during the proliferative phase of the menstrual cycle. Once obtained, samples were immediately transferred and conserved in RNA later (Qiagen) at -20 °C until RNA and protein isolation. Table 1 Characteristics of the women included in the present study Demographic/clinical characteristics Patients (17) Controls (17) Age (mean, SD) 34.8 ( 7.4) 31.9 ( 9.6) Term pregnancy (n) 10 11 Spontaneous abortion (n) 8 5 Pelvic pain (n) 17 0 Severe endometriosis (n) 8 Not applicable Other lesions (n) 14 Not applicable History of surgery for endometriosis before the present study (n) 8 Not applicable RNA isolation and RT-qPCR RNA isolation was performed using the RNeasy Fibrous Tissue Kit (74704, Qiagen) following the manufacturer’s instructions. RNA Integrity Number (RIN) was determined in an Agilent 2100 Bioanalyzer (Agilent Technologies). All samples included in the present study shown a RIN score > 7.0. RNA was quantified using a NanoDrop 2000 spectrophotometer (ThermoFisher Scientific). cDNA was obtained from 2 µg of total RNA using the M-MVL reverse transcriptase and oligo-dT 12 − 18 primers according to the manufacturer’s instructions (28025013, ThermoFisher Scientific). 20 ng of cDNA was amplified using the StepOnePlus PCR system (ThermoFisher Scientific) and the Power SYBR Green PCR Master Mix (4367659, ThermoFisher Scientific) following the manufacturer's protocol. Table 2 describes the oligonucleotides used in the present study. Negative controls with non-retrotranscribed RNA and without cDNA were included in all the experiments. Relative quantification of gene expression was performed by the ΔΔCt method, in which 18S ribosomal RNA was used as the endogenous reference gene. All PCR reactions generated a single product of the expected size, as evidenced by melting curve analysis and agarose gel electrophoresis, respectively. Table 2 Primers used in the present study Gene Forward (5’-3’) Reverse (5’-3’) Reference 18S CGCGGTTCTATTTTGTTGGT AGTCGGCATCGTTTATGGTC [27] PAQR7 AACTGTCAAGGGAGGTGCTG ATTGCATCCAGGCCATAATC [27] PAQR8 AGGACACAGCAAACAGGACA GGCAACACAGGCAGGAATAA [27] PAQR5 CAGCTGTTTCACGTGTGTGTGATCCTG GGACAGAAGTATGGCTCCAGCTATCTGAG [35] PAQR6 CTTTCATCTGGCTCCGTTTC CTGGCAAACTGGATTACCT Present study Protein isolation and Western blot Tissues from biopsies were homogenized with a Polytron homogenizer using a T-PER buffer (FNN0071, Thermo Fisher Scientific) supplemented with a protease inhibitor cocktail (p8340, Sigma-Aldrich). Total proteins were obtained by centrifugation at 22,000 g, at 4 °C for 5 min and quantified using a NanoDrop 2000 spectrophotometer (Thermo Scientific). Protein samples (50 µg) were separated on a 12% v/v SDS-PAGE at 80 V. Then were transferred to PVDF membranes (Millipore) in semi-dry conditions at room temperature at 25 V for 30 min. Membranes were blocked with 5% w/v of bovine serum albumin (BSA) at 37 °C under constant agitation for 2 h. Then, they were incubated with the primary antibodies: goat polyclonal anti-mPRα and mPRβ (Santa Cruz biotechnology 1 µg/mL; sc-50111 and sc-50109 [C-20]) and rabbit polyclonal anti mPRδ (Novus Biologicals 1 µg/mL; NPB1-59428), or mouse monoclonal anti y-tubulin (Santa Cruz biotechnology 1 µg/mL; sc-5286), at 4 °C for 48 h. Blots were then incubated with a rabbit anti-goat secondary antibody (Santa Cruz biotechnology 1:10000; sc-2768), and goat anti-mouse secondary antibody (Santa Cruz biotechnology 1:10000; sc-2005) conjugated to horseradish peroxidase at room temperature under constant agitation for 45 min. Chemiluminescence signals were detected, exposing membranes to Kodak Biomax Light Films (Sigma-Aldrich) using the Supersignal West Femto as peroxidase substrate (Thermo Scientific). The band density for the antigen-antibody complex was calculated as the area under a peak in a semiquantitative way using a 14.1 megapixels digital Canon camera (SD1400IS, Canon) and the ImageJ 1.45S software (National Institutes of Health). Statistical analysis All data were analyzed and plotted using the GraphPad Prism 6.0e program (GraphPad Sofware, Inc., USA). Statistical analysis between comparable groups was performed using one-way ANOVA followed by Tukey's multiple comparisons test with a confidence interval of 95%. Results Demographical and clinical data There were no differences in the demographic data and most of the clinical data between patients with endometriosis and women without the disease (Table 1 ). As expected, the only difference between the study groups relies on the fact that all women with endometriosis manifested pelvic pain, which was not reported by the control women. Almost half of the women with endometriosis included in the present study had severe endometriosis and presented a previous endometriosis surgery. Other lesions were found in most of the patients involved in the present study, which included bilateral endometriomas, adhesions, peritoneal endometriosis, uterosacral ligaments and endometriotic lesions in the appendix and pelvic wall. mPRs coding genes are downregulated in ectopic and eutopic tissue of women with endometriosis Using RT-qPCR, we observed that the expression of PAQR7 , PAQR8 , PAQR5 , and PAQR6 genes was significantly downregulated in the eutopic endometrium of patients with endometriosis compared with the endometrium of women without the disease. Besides, the expression of PAQR7 and PAQR5 was significantly reduced in ectopic endometrium (Fig. 1 ). Interestingly, very similar expression levels of PAQR7 , PAQR8 , PAQR5 , and PAQR6 genes were observed between eutopic and ectopic endometrium. mPRα and mPRβ content is decreased in ectopic endometrium of patients with endometriosis mPRs protein content was quantified by Western blot. mPRα, mPRβ, and mPRδ content did not significantly change in the eutopic endometrium, however, in the ectopic endometrium of patients with endometriosis, the content of mPRα and mPRβ was significantly lower than that in the endometrium of healthy women (Fig. 2 ). Discussion Endometriosis is a chronic and inflammatory disease in which specific etiology has not been elucidated. However, some molecular and biochemical alterations have been related to the development and progression of this pathology [36]. Progesterone resistance is one of the classical hallmarks of endometriosis, and although the mechanisms involved in this resistance have not been fully explained, it has been suggested that a decrease in the expression of PR-B in the endometriotic lesions could be involved in this resistance [11]. PR is not the only receptor through which progesterone can exert its functions. mPRs belongs to a group of cell surface receptors that activate non-genomic mechanisms of progesterone action in many progesterone-responsive cells and tissues [19]. In the present study, we have shown for the first time that gene expression and protein content of mPRs are decreased in the ectopic and eutopic endometrium of women with endometriosis compared to the endometrium of women without the disease, which in turn could explain another possibility for the molecular mechanisms involved in the lack of progesterone effects in this pathology. The decrease in PR-B expression in the ectopic endometrium of patients with endometriosis only partially explains the progesterone resistance since other factors such as alterations in progesterone signaling have been involved in this pathology [10,11]. The results of the present study showed that both the expression of PAQR7 and PAQR5 , as well as the protein content of mPRα and mPRβ, were significantly reduced in the ectopic endometrium of patients with endometriosis compared to the endometrium of women without the disease. Further studies are required to clarify whether the differences between mRNA expression and protein content are due to the sample size used in the present study or to specific mechanisms of transcriptional or translational regulation. These findings, together with previous studies, suggest that the decrease in the content of mPRα, mPRβ, and PR-B in the ectopic endometrium of women with endometriosis contributes to the progesterone resistance observed in this disease. The decrease in the expression of PR-B in the eutopic endometrium of women with endometriosis remains controversial since some studies have not found this reduction [12]. In the present study, we have shown that the expression of PAQR7 , PAQR8 , PAQR5 and PAQR6 genes is downregulated in the eutopic endometrium of patients with endometriosis compared to that of controls, which in turn could be associated with the progesterone resistance that leads to a reduced implantation capacity and increased risk of pregnancy loss observed in these patients [6]. However, we did not find a decrease in the protein content of mPRα, mPRβ, and mPRδ, which should be addressed in future studies with a larger sample size to compare our findings at the mRNA level. We were not able to detect mPRλ protein in our experimental conditions. A decrease in the expression and protein content of other membrane progesterone receptors, PGRMC1 and PGRMC2, has also been reported in the eutopic endometrium of patients with endometriosis compared to women without the disease [37]. The consistent decrease in mRNA levels of genes encoding mPRs and PGRMCs in the eutopic endometrium of women with endometriosis suggests a probable role of plasma membrane progesterone receptors in the pathogenesis of the disease, which should be addressed in future functional studies since it has been proposed that endometriosis is originated from eutopic endometrium cells [38]. It has been previously reported that genes encoding mPRs are differentially expressed during the menstrual cycle, which suggests that sex hormones regulate their expression. Particularly, PAQR7 expression is higher in the secretory phase of the menstrual cycle compared to that in the proliferative phase, whereas the expression of PAQR5 and PAQR9 is decreased in the secretory phase and, PAQR8 expression is not differentially expressed during the menstrual cycle [30]. In the present study, most of the samples were obtained during the proliferative phase of the menstrual cycle and the expression of the four genes analyzed ( PAQR7 , PAQR8 , PAQR5 , and PAQR6 ) was decreased in the eutopic endometrium of patients with endometriosis compared to the endometrium of control women. An open question that remains is whether the reduced expression of PARQ genes observed in patients with endometriosis is in part responsible for the progesterone resistance or if the latter leads to the decreased expression of those genes. It has been recently reported that the expression of PAQR7 and the respective protein content are decreased in endometrial cancer compared to adjacent unaffected tissue [35]. In the present study, we also found a decrease in the mRNA expression and protein content of mPRα in the ectopic endometrium of women with endometriosis, suggesting a possible connection between the alterations in endometriosis and endometrial cancer, as previously proposed [39]. Conclusions The overall results of the present study demonstrate for the first time that gene expression of PAQR7 and PAQR5 , and protein content of mPRα and mPRβ are decreased in ectopic endometrium compared to that of women without the disease, and that gene expression of PAQR7 , PAQR8 , PAQR5 , and PAQR6 is decreased in eutopic endometrium. Our results reinforce the theory of progesterone resistance as part of the etiology of endometriosis. Further studies are required to elucidate the functional role of mPRs in normal, eutopic, and ectopic endometrium. Abbreviations BSA, bovine serum albumin mPR, membrane progesterone receptor Org OD 02-0, 10-ethenyl-19-norprogesterone PAQR, progesterone and adipoQ receptor PGRMC, progesterone receptor membrane component PR-B, progesterone receptor isoform B PR, progesterone receptor RIN, RNA Integrity Number Declarations Ethical approval and consent to participate: All procedures performed in the present study were in accordance with the ethical standards of the Comité de Ética en Investigación of the Instituto Nacional de Perinatología in Mexico City, Mexico, reference number IRB00001944 and with the 1964 Helsinki declaration and its later amendments. All study participants signed informed consent for enrolment in the present study. Consent for publication: Not applicable Availability of data and materials: All data generated or analyzed during this study are included in this published article. Competing interests: The authors declare that they have no competing interests. Funding: This work was supported by the Instituto Nacional de Perinatología “Isidro Espinosa de los Reyes” (INPer; grant number 553, 212250-3000-20209-03-16). Authors’ contributions: ERVM and ICA conceived the study and wrote the manuscript. ICA received the funds to support the present study. CBA performed protein isolation and western blot experiments and wrote the manuscript. ALHM performed RT-qPCR experiments. MSP analyzed RNA integrity and purity. ALHM and SPH extracted RNA. OCO, JRST, LFEP, LAHL, CRM, AOO, and BSR recruited women with endometriosis and obtained the samples from these patients. MOC and EGG recruited control women and obtained samples from this group. GEG and MC wrote and revised the manuscript. Acknowledgements: Not applicable. References Collinet P, Fritel X, Revel-Delhom C, Ballester M, Bolze PA, Borghese B, et al. Management of endometriosis: CNGOF/HAS clinical practice guidelines - Short version. J Gynecol Obstet Hum Reprod. 2018;47:265–74. Burney RO, Giudice LC. Pathogenesis and pathophysiology of endometriosis. Fertil Steril. 2012;98:511–9. Hickey M, Ballard K, Farquhar C. Endometriosis. BMJ. 2014;348:g1752. Schliep KC, Mumford SL, Peterson CM, Chen Z, Johnstone EB, Sharp HT, et al. Pain typology and incident endometriosis. Hum Reprod. 2015;30:2427–38. Practice Committee of the American Society for Reproductive Medicine. Endometriosis and infertility: a committee opinion. Fertil Steril. 2012;98:591–8. Lessey BA, Kim JJ. Endometrial receptivity in the eutopic endometrium of women with endometriosis: it is affected, and let me show you why. Fertil Steril. 2017;108:19–27. Gao X, Yeh YC, Outley J, Simon J, Botteman M, Spalding J. Health-related quality of life burden of women with endometriosis: a literature review. Curr Med Res Opin. 2006;22:1787–97. Parasar P, Ozcan P, Terry KL. Endometriosis: Epidemiology, Diagnosis and Clinical Management. Curr Obstet Gynecol Rep. 2017;6:34–41. Geoffron S, Legendre G, Daraï E, Chabbert-Buffet N. Medical treatment of endometriosis: Hormonal treatment of pain, impact on evolution and future perspectives. Presse Med. 2017;46:1199–211. Marquardt RM, Kim TH, Shin JH, Jeong JW. Progesterone and Estrogen Signaling in the Endometrium: What Goes Wrong in Endometriosis? Int J Mol Sci. 2019;20. Wu Y, Strawn E, Basir Z, Halverson G, Guo SW. Promoter hypermethylation of progesterone receptor isoform B (PR-B) in endometriosis. Epigenetics. 2006;1:106–11. McKinnon B, Mueller M, Montgomery G. Progesterone Resistance in Endometriosis: an Acquired Property? Trends Endocrinol Metab. 2018;29:535–48. Norwitz ER, Schust DJ, Fisher SJ. Implantation and the survival of early pregnancy. N Engl J Med. 2001;345:1400–8. Faivre E, Skildum A, Pierson-Mullany L, Lange CA. Integration of progesterone receptor mediated rapid signaling and nuclear actions in breast cancer cell models: role of mitogen-activated protein kinases and cell cycle regulators. Steroids. 70:418–26. Lösel R, Breiter S, Seyfert M, Wehling M, Falkenstein E. Classic and non-classic progesterone receptors are both expressed in human spermatozoa. Horm Metab Res. 2005;37:10–4. Hernandez-Hernandez OT, Camacho-Arroyo I. Regulation of Gene Expression by Progesterone in Cancer Cells: Effects on Cyclin D1, EGFR and VEGF. Mini Rev Med Chem. 2013;13:635–42. Scarpin KM, Graham JD, Mote PA, Clarke CL. Progesterone action in human tissues: regulation by progesterone receptor (PR) isoform expression, nuclear positioning and coregulator expression. Nucl Recept Signal. 2009;7:e009. Camacho-Arroyo I, Hansberg-Pastor V, Vázquez-Martínez ER, Cerbón M. Mechanism of Progesterone Action in the Brain. In: Pfaff DW, Joëls M, editors. Hormones, Brain and Behavior. USA: Academic Press; 2016. pp. 181–214. Valadez-Cosmes P, Vázquez-Martínez ER, Cerbón M, Camacho-Arroyo I. Membrane progesterone receptors in reproduction and cancer. Mol Cell Endocrinol. 2016;434:166–75. Smith JL, Kupchak BR, Garitaonandia I, Hoang LK, Maina AS, Regalla LM, et al. Heterologous expression of human mPRalpha, mPRbeta and mPRgamma in yeast confirms their ability to function as membrane progesterone receptors. Steroids. 2008;73:1160–73. González-Orozco JC, Hansberg-Pastor V, Valadez-Cosmes P, Nicolas-Ortega W, Bastida-Beristain Y, Fuente-Granada MD La, et al. Activation of membrane progesterone receptor-alpha increases proliferation, migration, and invasion of human glioblastoma cells. Mol Cell Endocrinol. 2018;477:81–9. Zuo L, Li W, You S. Progesterone reverses the mesenchymal phenotypes of basal phenotype breast cancer cells via a membrane progesterone receptor mediated pathway. Breast Cancer Res. 2010;12:R34. Xie M, Zhu X, Liu Z, Shrubsole M, Varma V, Mayer IA, et al. Membrane progesterone receptor alpha as a potential prognostic biomarker for breast cancer survival: a retrospective study. PLoS One. 2012;7:e35198. Charles NJ, Thomas P, Lange CA. Expression of membrane progesterone receptors (mPR/PAQR) in ovarian cancer cells: implications for progesterone-induced signaling events. Horm Cancer. 2010;1:167–76. Dressing GE, Thomas P. Identification of membrane progestin receptors in human breast cancer cell lines and biopsies and their potential involvement in breast cancer. Steroids. 2007;72:111–6. Romero-Sánchez M, Peiper SC, Evans B, Wang Z, Catasús L, Ribe A, et al. Expression profile of heptahelical putative membrane progesterone receptors in epithelial ovarian tumors. Hum Pathol. 2008;39:1026–33. Valadez-Cosmes P, Germán-Castelán L, González-Arenas A, Velasco-Velázquez MA, Hansberg-Pastor V, Camacho-Arroyo I. Expression and hormonal regulation of membrane progesterone receptors in human astrocytoma cells. J Steroid Biochem Mol Biol. 2015;154:176–85. Zhu Y, Bond J, Thomas P. Identification, classification, and partial characterization of genes in humans and other vertebrates homologous to a fish membrane progestin receptor. Proc Natl Acad Sci U S A. 2003;100:2237–42. Pang Y, Dong J, Thomas P. Characterization, neurosteroid binding and brain distribution of human membrane progesterone receptors δ and {epsilon} (mPRδ and mPR{epsilon}) and mPRδ involvement in neurosteroid inhibition of apoptosis. Endocrinology. 2013;154:283–95. Fernandes MS, Pierron V, Michalovich D, Astle S, Thornton S, Peltoketo H, et al. Regulated expression of putative membrane progestin receptor homologues in human endometrium and gestational tissues. J Endocrinol. 2005;187:89–101. Macias H, Hinck L. Mammary gland development. Wiley Interdiscip Rev Dev Biol. 2012;1:533–57. Mesiano S, Wang Y, Norwitz ER. Progesterone receptors in the human pregnancy uterus: do they hold the key to birth timing? Reprod Sci. 2011;18:6–19. Karteris E, Zervou S, Pang Y, Dong J, Hillhouse EW, Randeva HS, et al. Progesterone signaling in human myometrium through two novel membrane G protein-coupled receptors: potential role in functional progesterone withdrawal at term. Mol Endocrinol. 2006;20:1519–34. Merlino AA, Welsh TN, Tan H, Yi LJ, Cannon V, Mercer BM, et al. Nuclear progesterone receptors in the human pregnancy myometrium: evidence that parturition involves functional progesterone withdrawal mediated by increased expression of progesterone receptor-A. J Clin Endocrinol Metab. 2007;92:1927–33. Sinreih M, Knific T, Thomas P, Frković Grazio S, Rižner TL. Membrane progesterone receptors β and γ have potential as prognostic biomarkers of endometrial cancer. J Steroid Biochem Mol Biol. 2018;178:303–11. Burney RO. The genetics and biochemistry of endometriosis. Curr Opin Obstet Gynecol. 2013;25:280–6. Bunch K, Tinnemore D, Huff S, Hoffer ZS, Burney RO, Stallings JD. Expression patterns of progesterone receptor membrane components 1 and 2 in endometria from women with and without endometriosis. Reprod Sci. 2014;21:190–7. Baranov V, Malysheva O, Yarmolinskaya M. Pathogenomics of Endometriosis Development. Int J Mol Sci. 2018;19: E1852. Painter JN, O’Mara TA, Morris AP, Cheng THT, Gorman M, Martin L, et al. Genetic overlap between endometriosis and endometrial cancer: evidence from cross-disease genetic correlation and GWAS meta-analyses. Cancer Med. 2018;7:1978–87. Cite Share Download PDF Status: Published Journal Publication published 14 Jul, 2020 Read the published version in BioMed Research International → Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-16694","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research","associatedPublications":[],"authors":[{"id":396441,"identity":"2576ccec-4627-477f-94e7-a86990e087b7","order_by":1,"name":"EDGAR RICARDO VAZQUEZ-MARTINEZ","email":"","orcid":"","institution":"Universidad Nacional Autonoma de Mexico Facultad de Quimica","correspondingAuthor":false,"prefix":"","firstName":"EDGAR","middleName":"RICARDO","lastName":"VAZQUEZ-MARTINEZ","suffix":""},{"id":396442,"identity":"56613b1a-0f56-44ae-b5ae-ca9283a4da6b","order_by":2,"name":"Claudia Bello-Alvarez","email":"","orcid":"","institution":"Universidad Nacional Autonoma de Mexico Facultad de Quimica","correspondingAuthor":false,"prefix":"","firstName":"Claudia","middleName":"","lastName":"Bello-Alvarez","suffix":""},{"id":396443,"identity":"35f9f35f-cf4e-497f-bab7-61451cca24e8","order_by":3,"name":"Ana Lorena Hermenegildo-Molina","email":"","orcid":"","institution":"Instituto Nacional de Perinatologia","correspondingAuthor":false,"prefix":"","firstName":"Ana","middleName":"Lorena","lastName":"Hermenegildo-Molina","suffix":""},{"id":396444,"identity":"6138fde3-4421-46da-8da2-e037c2d8e5b2","order_by":4,"name":"Mario Solís-Paredes","email":"","orcid":"","institution":"Instituto Nacional de Perinatologia","correspondingAuthor":false,"prefix":"","firstName":"Mario","middleName":"","lastName":"Solís-Paredes","suffix":""},{"id":396445,"identity":"dadfc011-1c05-4517-b49f-a507aa15e809","order_by":5,"name":"Sandra Parra-Hernandez","email":"","orcid":"","institution":"Instituto Nacional de Perinatologia","correspondingAuthor":false,"prefix":"","firstName":"Sandra","middleName":"","lastName":"Parra-Hernandez","suffix":""},{"id":396446,"identity":"d108665e-b745-4fed-9183-269fca6bb475","order_by":6,"name":"Oliver Cruz-Orozco","email":"","orcid":"","institution":"Instituto Nacional de Perinatologia","correspondingAuthor":false,"prefix":"","firstName":"Oliver","middleName":"","lastName":"Cruz-Orozco","suffix":""},{"id":396447,"identity":"1c9654d7-af92-49b3-8a93-843afa8b7e4b","order_by":7,"name":"J Roberto Silvestri-Tomassoni","email":"","orcid":"","institution":"Instituto Nacional de Perinatologia","correspondingAuthor":false,"prefix":"","firstName":"J","middleName":"Roberto","lastName":"Silvestri-Tomassoni","suffix":""},{"id":396448,"identity":"cc37a063-7328-45a6-bddd-9c094027245a","order_by":8,"name":"Luis F Escobar-Ponce","email":"","orcid":"","institution":"Instituto Nacional de Perinatologia","correspondingAuthor":false,"prefix":"","firstName":"Luis","middleName":"F","lastName":"Escobar-Ponce","suffix":""},{"id":396449,"identity":"a667a56d-1471-48d4-b5b3-233efc56d265","order_by":9,"name":"Luis A Hernandez-Lopez","email":"","orcid":"","institution":"Instituto Nacional de Perinatologia","correspondingAuthor":false,"prefix":"","firstName":"Luis","middleName":"A","lastName":"Hernandez-Lopez","suffix":""},{"id":396450,"identity":"ed770725-2bb7-4d57-85b9-d3025a5be9c7","order_by":10,"name":"Christian Reyes-Mayoral","email":"","orcid":"","institution":"Instituto Nacional de Perinatologia","correspondingAuthor":false,"prefix":"","firstName":"Christian","middleName":"","lastName":"Reyes-Mayoral","suffix":""},{"id":396451,"identity":"db886419-cde8-46db-b20b-0195c31366d1","order_by":11,"name":"Andrea Olguín-Ortega","email":"","orcid":"","institution":"Instituto Nacional de Perinatologia","correspondingAuthor":false,"prefix":"","firstName":"Andrea","middleName":"","lastName":"Olguín-Ortega","suffix":""},{"id":396452,"identity":"2d6f8251-a7ba-43ff-bcdc-cc452096fd4a","order_by":12,"name":"Brenda Sánchez-Ramírez","email":"","orcid":"","institution":"Instituto Nacional de Perinatologia","correspondingAuthor":false,"prefix":"","firstName":"Brenda","middleName":"","lastName":"Sánchez-Ramírez","suffix":""},{"id":396453,"identity":"74764563-f0eb-4066-b43d-924127816de1","order_by":13,"name":"Mauricio Osorio-Caballero","email":"","orcid":"","institution":"Instituto Nacional de Perinatologia","correspondingAuthor":false,"prefix":"","firstName":"Mauricio","middleName":"","lastName":"Osorio-Caballero","suffix":""},{"id":396454,"identity":"047f7488-6073-4030-874d-6ff2d86d391a","order_by":14,"name":"Elizabeth García-Gómez","email":"","orcid":"","institution":"Instituto Nacional de Perinatologia","correspondingAuthor":false,"prefix":"","firstName":"Elizabeth","middleName":"","lastName":"García-Gómez","suffix":""},{"id":396455,"identity":"12cedd5d-4e06-4ba4-b5f3-47eaf7c4ffc1","order_by":15,"name":"Guadalupe Estrada-Gutiérrez","email":"","orcid":"","institution":"Instituto Nacional de Perinatologia","correspondingAuthor":false,"prefix":"","firstName":"Guadalupe","middleName":"","lastName":"Estrada-Gutiérrez","suffix":""},{"id":396456,"identity":"e1a116c1-3834-4c27-8f13-6f354f5b605f","order_by":16,"name":"Marco Cerbón","email":"","orcid":"","institution":"Instituto Nacional de Perinatologia","correspondingAuthor":false,"prefix":"","firstName":"Marco","middleName":"","lastName":"Cerbón","suffix":""},{"id":396457,"identity":"8f78cbc4-6f09-4bde-b239-5eb891099c6b","order_by":17,"name":"Ignacio Camacho-Arroyo","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA8klEQVRIiWNgGAWjYLACxgYYqwKImZkbcKrEouUMSAuCS4QWxjZUE7AC/vbTiR9+7rCRN599+JjEx3m10fztQC0/Krbh1CJxJnezZO+ZNMM559LSJGduO5474zBjA2PPmds4tRgw5G6QZmw7zDiDh8dMmnfbsdwGoBZmxjY8Wvjfbv4N1GIP0TLnWO58glokcreBbEmEaGmoyd1ASIvEjbfbLHvb0pJn8LAlW844diB3I1DLQXx+4e/P3XzjZ5uN7Qwe5oM3PtTU5c47f/jggx8VuLUgAxYJBobDYNYBotQDAfMHBoY6YhWPglEwCkbBCAIAK29arYWoIbQAAAAASUVORK5CYII=","orcid":"","institution":"","correspondingAuthor":true,"prefix":"","firstName":"Ignacio","middleName":"","lastName":"Camacho-Arroyo","suffix":""}],"badges":[],"createdAt":"2020-03-05 17:25:27","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-16694/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-16694/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1155/2020/2196024","type":"published","date":"2020-07-14T21:02:04+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":628360,"identity":"dcdd504a-5044-497b-95ba-406c45a9eb13","added_by":"auto","created_at":"2020-03-11 14:59:37","extension":"tif","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":36733,"visible":true,"origin":"","legend":"Expression levels of PAQR genes in ectopic and eutopic endometrium of patients with endometriosis. Total RNA was extracted from each tissue biopsy, and RT-qPCR was performed to evaluate the relative expression of PAQR7 (a), PAQR8 (b), PAQR5 (c), and PAQR6 (d) genes, which was calculated by the ΔΔCt method. Data were normalized using 18S transcript as a constitutive gene expression control. Results are expressed as mean ± S.E.M. Controls (C), ectopic (EC), and eutopic (EU) endometrium of women with endometriosis. *P\u003c 0.05 vs C; **P\u003c0.05 vs C","description":"","filename":"Fig1.tif","url":"https://assets-eu.researchsquare.com/files/rs-16694/v1/Fig 1.tif"},{"id":628361,"identity":"99353758-a846-4b68-af8b-d6f7f2f62d35","added_by":"auto","created_at":"2020-03-11 14:59:37","extension":"tiff","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":62746,"visible":true,"origin":"","legend":"Protein content of mPRs in ectopic and eutopic endometrium of patients with endometriosis. Tissue biopsies were lysed, and proteins (50 µg) were separated by electrophoresis on 12% SDS-PAGE. Gels were transferred to PVDF membranes and then incubated with antibodies against mPRα, mPRβ, mPRδ or γ-tubulin (used for normalization). Representative images (a), and densitometric analysis (b) of mPRα, mPRβ, or mPRδ content in controls (C), ectopic (EC), and eutopic (EU) endometrium of women with endometriosis. Results are expressed as mean ± S.E.M. of n: C = 9 (mPRα, mPRβ, and mPRδ); EU = 9 (mPRα), 6 (mPRβ) and 8 (mPRδ) and EC = 9 (mPRα and mPRβ) and 7 (mPRδ). *P\u003c 0.05 vs C","description":"","filename":"Fig2.tiff","url":"https://assets-eu.researchsquare.com/files/rs-16694/v1/Fig2.tiff"},{"id":13492838,"identity":"d4097f81-e394-4f32-bf03-beeb9cdbafe2","added_by":"auto","created_at":"2021-09-16 22:33:16","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":555890,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-16694/v1/83d995e5-9999-459a-893c-f1e58d81fdc8.pdf"}],"financialInterests":"","formattedTitle":"Expression of membrane progesterone receptors in eutopic and ectopic endometrium of women with endometriosis","fulltext":[{"header":"Background","content":" \u003cp\u003eEndometriosis is defined as the presence of endometrial glands and stroma outside the uterus, which are commonly found in the peritoneal cavity and ovaries [1\u0026ndash;3]. Endometriosis is the leading cause of chronic and cyclic pelvic pain in reproductive age women, affecting 10\u0026ndash;15% of women worldwide; pain symptoms include dysmenorrhea, dyspareunia, dysuria and dyschezia [4,5]. Infertility is commonly associated with this disease mainly due to physical and molecular disruption in the uterus which in turn reduces implantation capacity, and finally increases the risk of pregnancy loss [6]. Moreover, endometriosis negatively impacts women\u0026rsquo;s quality of life by deteriorating their physical, mental, and social wellbeing [7]. The gold standard for the diagnosis of endometriosis is made by laparoscopic inspection with histologic confirmation after biopsy [8]. The aim of endometriosis treatment is to mitigate the symptoms associated with the disease and includes pharmacological therapy with non-steroidal anti-inflammatory drugs, progestins, oral contraceptives, and gonadotropin-releasing hormone agonists, as well as surgical removal of endometrial implants and the affected tissue; however, endometriosis recurs in at least 5\u0026ndash;15% of the cases after most invasive surgeries [8,9]. The etiology of this disease is far from being elucidated; however, altered estrogen signaling and progesterone resistance have been identified as the most common hallmarks of this disease [10].\u003c/p\u003e \u003cp\u003eProgesterone resistance in endometriosis has been attributed in part to a decrease in the expression of the B isoform of its intracellular receptor (PR-B) in the endometriotic lesions (ectopic endometrium) of women with the disease [11]. Furthermore, it has been proposed that progesterone resistance leads to an altered eutopic endometrium function in women with endometriosis, which in turn has been associated with pregnancy loss [6]. There is controversy about the alteration in the expression of PR in eutopic endometrium, suggesting that other mechanisms should be involved in progesterone resistance in this tissue [12].\u003c/p\u003e \u003cp\u003eProgesterone induces the decidualization of the endometrium, which is essential for embryo implantation and maintenance of pregnancy [13]. It has been demonstrated that progesterone exerts its actions by activating genomic and non-genomic mechanisms [14,15]. Genomic action mechanisms are mediated by the PR, which acts as a ligand-dependent transcription factor that regulates the expression of progesterone responsive genes [16\u0026ndash;18]. Besides, non-genomic action mechanisms are mediated in part by specific receptors localized in the plasma membrane that are not related to PR, and are divided into two major groups: the membrane progesterone receptors (mPRs) that belong to the class II members of the progesterone and adipoQ receptor (PAQR) family, and the progesterone receptor membrane components (PGRMCs) [19].\u003c/p\u003e \u003cp\u003emPRs are G protein-coupled receptors that are encoded by five different genes: \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePAQR7\u003c/span\u003e (mPRα), \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePAQR8\u003c/span\u003e (mPRβ), \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePAQR5\u003c/span\u003e (mPRγ), \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePAQR6\u003c/span\u003e (mPRδ) and \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePAQR9\u003c/span\u003e (mPRε) [19,20]. The activation of mPRs is necessary to achieve full effects of progesterone in some responsive tissues or cells to this hormone in which those effects are only partially explained by PR activation [21\u0026ndash;23]. Importantly, we and others have demonstrated that the content and activity of these receptors are altered in many diseases, including cancer [24\u0026ndash;27]. The expression pattern of mPRs is tissue-specific and their activation by progesterone or by the mPRs specific agonist 10-ethenyl-19-norprogesterone (Org OD 02\u0026thinsp;\u0026minus;\u0026thinsp;0) regulates signaling pathways involved in mammary gland development, sexual behavior, ovulation, maintenance of pregnancy and other processes [19,21,28\u0026ndash;32]. mPRs are expressed in female reproductive and embryonic tissues, mainly in the endometrium, myometrium, ovaries, and placenta [19,30,33,34]. Particularly, it has been demonstrated that \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePAQR7\u003c/span\u003e, \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePAQR8\u003c/span\u003e, \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePARQ5\u003c/span\u003e, and \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePAQR9\u003c/span\u003e are expressed in the endometrium. \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePAQR7\u003c/span\u003e expression is induced during the secretory phase of the menstrual cycle, whereas the expression of \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePAQR5\u003c/span\u003e and \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePAQR9\u003c/span\u003e is decreased during that phase [30]. In addition, \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePAQR7\u003c/span\u003e and \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePAQR8\u003c/span\u003e expression and the respective protein content are decreased in endometrial cancer compared to adjacent non-affected endometrium, whereas mPRγ protein content is increased in endometrial cancer tissue [35]. To the best of our knowledge, it has not been demonstrated whether gene expression and protein content of mPRs are altered in ectopic lesions and eutopic endometrium of patients with endometriosis.\u003c/p\u003e \u003cp\u003eWe hypothesized that the expression of mPRs is decreased in both eutopic and ectopic endometrium of patients with endometriosis compared with the endometrium of women without the disease, similar to that reported in PR.\u003c/p\u003e "},{"header":"Methods","content":" \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eAim and design of the study\u003c/h2\u003e \u003cp\u003eThe aim of the present study was to evaluate the mRNA expression and protein content of mPRs in eutopic and ectopic endometrium of women with endometriosis and endometrium in control subjects. This is an observational study of cases (endometriosis patients) and controls (women without the disease).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eParticipants and tissue collection\u003c/h2\u003e \u003cp\u003eSeventeen patients with ovarian endometriosis (confirmed by laparoscopy and histological analysis) and seventeen women without the disease undergoing hysterectomy for benign conditions were recruited. Women included in the present study had regular menstrual cycles and did not take any hormonal treatment (included contraceptives) for at least 3 months before obtaining the sample. The characteristics of the women included in the present study are summarized in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. This study was approved by the Research and Ethical Committee from the Instituto Nacional de Perinatolog\u0026iacute;a in Mexico City, Mexico, reference number IRB00001944 and complied with the 1964 Declaration of Helsinki and its later amendments. All study participants signed informed consent for enrolment in the present study. Samples were collected from November 2016 to October 2019. A total of seven tissue biopsies from ovarian endometrioma, two tissue biopsies from peritoneum lesions and seventeen biopsies from eutopic endometrium were obtained from women with a diagnosis of ovarian endometriosis at the time of resection surgery. Seventeen endometrial biopsies were obtained from women without endometriosis (controls). Endometrial samples from patients (eutopic) and controls were obtained using a Pipelle suction curette. Most samples were obtained during the proliferative phase of the menstrual cycle. Once obtained, samples were immediately transferred and conserved in RNA later (Qiagen) at -20\u0026nbsp;\u0026deg;C until RNA and protein isolation.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cdiv class=\"SimplePara\"\u003eCharacteristics of the women included in the present study\u003c/div\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eDemographic/clinical characteristics\u003c/div\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003ePatients (17)\u003c/div\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cdiv class=\"SimplePara\"\u003eControls (17)\u003c/div\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eAge (mean, \u003cdiv id=\"IEq1\" class=\"InlineEquation\"\u003e\u003cdiv format=\"TEX\" class=\"mathinline\" id=\"FileID_IEq1\" name=\"EquationSource\"\u003e\u003c/div\u003e\u003c/div\u003eSD)\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003e34.8 (\u003cdiv id=\"IEq2\" class=\"InlineEquation\"\u003e\u003cdiv format=\"TEX\" class=\"mathinline\" id=\"FileID_IEq2\" name=\"EquationSource\"\u003e\u003c/div\u003e\u003c/div\u003e7.4)\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cdiv class=\"SimplePara\"\u003e31.9 (\u003cdiv id=\"IEq3\" class=\"InlineEquation\"\u003e\u003cdiv format=\"TEX\" class=\"mathinline\" id=\"FileID_IEq3\" name=\"EquationSource\"\u003e\u003c/div\u003e\u003c/div\u003e9.6)\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eTerm pregnancy (n)\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003e10\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cdiv class=\"SimplePara\"\u003e11\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eSpontaneous abortion (n)\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003e8\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cdiv class=\"SimplePara\"\u003e5\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003ePelvic pain (n)\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003e17\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cdiv class=\"SimplePara\"\u003e0\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eSevere endometriosis (n)\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003e8\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cdiv class=\"SimplePara\"\u003eNot applicable\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eOther lesions (n)\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003e14\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cdiv class=\"SimplePara\"\u003eNot applicable\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eHistory of surgery for endometriosis before the present study (n)\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003e8\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cdiv class=\"SimplePara\"\u003eNot applicable\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eRNA isolation and RT-qPCR\u003c/h2\u003e \u003cp\u003eRNA isolation was performed using the RNeasy Fibrous Tissue Kit (74704, Qiagen) following the manufacturer\u0026rsquo;s instructions. RNA Integrity Number (RIN) was determined in an Agilent 2100 Bioanalyzer (Agilent Technologies). All samples included in the present study shown a RIN score\u0026thinsp;\u0026gt;\u0026thinsp;7.0. RNA was quantified using a NanoDrop 2000 spectrophotometer (ThermoFisher Scientific). cDNA was obtained from 2\u0026nbsp;\u0026micro;g of total RNA using the M-MVL reverse transcriptase and oligo-dT\u003csub\u003e12\u0026thinsp;\u0026minus;\u0026thinsp;18\u003c/sub\u003e primers according to the manufacturer\u0026rsquo;s instructions (28025013, ThermoFisher Scientific). 20\u0026nbsp;ng of cDNA was amplified using the StepOnePlus PCR system (ThermoFisher Scientific) and the Power SYBR Green PCR Master Mix (4367659, ThermoFisher Scientific) following the manufacturer's protocol. Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e describes the oligonucleotides used in the present study. Negative controls with non-retrotranscribed RNA and without cDNA were included in all the experiments. Relative quantification of gene expression was performed by the ΔΔCt method, in which \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003e18S\u003c/span\u003e ribosomal RNA was used as the endogenous reference gene. All PCR reactions generated a single product of the expected size, as evidenced by melting curve analysis and agarose gel electrophoresis, respectively.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cdiv class=\"SimplePara\"\u003ePrimers used in the present study\u003c/div\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eGene\u003c/div\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eForward (5\u0026rsquo;-3\u0026rsquo;)\u003c/div\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cdiv class=\"SimplePara\"\u003eReverse (5\u0026rsquo;-3\u0026rsquo;)\u003c/div\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cdiv class=\"SimplePara\"\u003eReference\u003c/div\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003e\u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003e18S\u003c/span\u003e\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eCGCGGTTCTATTTTGTTGGT\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cdiv class=\"SimplePara\"\u003eAGTCGGCATCGTTTATGGTC\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cdiv class=\"SimplePara\"\u003e[27]\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003e\u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePAQR7\u003c/span\u003e\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eAACTGTCAAGGGAGGTGCTG\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cdiv class=\"SimplePara\"\u003eATTGCATCCAGGCCATAATC\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cdiv class=\"SimplePara\"\u003e[27]\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003e\u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePAQR8\u003c/span\u003e\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eAGGACACAGCAAACAGGACA\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cdiv class=\"SimplePara\"\u003eGGCAACACAGGCAGGAATAA\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cdiv class=\"SimplePara\"\u003e[27]\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003e\u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePAQR5\u003c/span\u003e\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eCAGCTGTTTCACGTGTGTGTGATCCTG\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cdiv class=\"SimplePara\"\u003eGGACAGAAGTATGGCTCCAGCTATCTGAG\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cdiv class=\"SimplePara\"\u003e[35]\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003e\u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePAQR6\u003c/span\u003e\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eCTTTCATCTGGCTCCGTTTC\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cdiv class=\"SimplePara\"\u003eCTGGCAAACTGGATTACCT\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cdiv class=\"SimplePara\"\u003ePresent study\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eProtein isolation and Western blot\u003c/h2\u003e \u003cp\u003eTissues from biopsies were homogenized with a Polytron homogenizer using a T-PER buffer (FNN0071, Thermo Fisher Scientific) supplemented with a protease inhibitor cocktail (p8340, Sigma-Aldrich). Total proteins were obtained by centrifugation at 22,000\u0026nbsp;g, at 4\u0026nbsp;\u0026deg;C for 5\u0026nbsp;min and quantified using a NanoDrop 2000 spectrophotometer (Thermo Scientific).\u003c/p\u003e \u003cp\u003eProtein samples (50\u0026nbsp;\u0026micro;g) were separated on a 12% v/v SDS-PAGE at 80\u0026nbsp;V. Then were transferred to PVDF membranes (Millipore) in semi-dry conditions at room temperature at 25\u0026nbsp;V for 30\u0026nbsp;min. Membranes were blocked with 5% w/v of bovine serum albumin (BSA) at 37\u0026nbsp;\u0026deg;C under constant agitation for 2\u0026nbsp;h. Then, they were incubated with the primary antibodies: goat polyclonal anti-mPRα and mPRβ (Santa Cruz biotechnology 1\u0026nbsp;\u0026micro;g/mL; sc-50111 and sc-50109 [C-20]) and rabbit polyclonal anti mPRδ (Novus Biologicals 1\u0026nbsp;\u0026micro;g/mL; NPB1-59428), or mouse monoclonal anti y-tubulin (Santa Cruz biotechnology 1\u0026nbsp;\u0026micro;g/mL; sc-5286), at 4\u0026nbsp;\u0026deg;C for 48\u0026nbsp;h. Blots were then incubated with a rabbit anti-goat secondary antibody (Santa Cruz biotechnology 1:10000; sc-2768), and goat anti-mouse secondary antibody (Santa Cruz biotechnology 1:10000; sc-2005) conjugated to horseradish peroxidase at room temperature under constant agitation for 45\u0026nbsp;min.\u003c/p\u003e \u003cp\u003eChemiluminescence signals were detected, exposing membranes to Kodak Biomax Light Films (Sigma-Aldrich) using the Supersignal West Femto as peroxidase substrate (Thermo Scientific). The band density for the antigen-antibody complex was calculated as the area under a peak in a semiquantitative way using a 14.1 megapixels digital Canon camera (SD1400IS, Canon) and the ImageJ 1.45S software (National Institutes of Health).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eAll data were analyzed and plotted using the GraphPad Prism 6.0e program (GraphPad Sofware, Inc., USA). Statistical analysis between comparable groups was performed using one-way ANOVA followed by Tukey's multiple comparisons test with a confidence interval of 95%.\u003c/p\u003e \u003c/div\u003e "},{"header":"Results","content":" \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eDemographical and clinical data\u003c/h2\u003e \u003cp\u003eThere were no differences in the demographic data and most of the clinical data between patients with endometriosis and women without the disease (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). As expected, the only difference between the study groups relies on the fact that all women with endometriosis manifested pelvic pain, which was not reported by the control women. Almost half of the women with endometriosis included in the present study had severe endometriosis and presented a previous endometriosis surgery. Other lesions were found in most of the patients involved in the present study, which included bilateral endometriomas, adhesions, peritoneal endometriosis, uterosacral ligaments and endometriotic lesions in the appendix and pelvic wall.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003emPRs coding genes are downregulated in ectopic and eutopic tissue of women with endometriosis\u003c/h2\u003e \u003cp\u003eUsing RT-qPCR, we observed that the expression of \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePAQR7\u003c/span\u003e, \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePAQR8\u003c/span\u003e, \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePAQR5\u003c/span\u003e, and \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePAQR6\u003c/span\u003e genes was significantly downregulated in the eutopic endometrium of patients with endometriosis compared with the endometrium of women without the disease. Besides, the expression of \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePAQR7\u003c/span\u003e and \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePAQR5\u003c/span\u003e was significantly reduced in ectopic endometrium (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Interestingly, very similar expression levels of \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePAQR7\u003c/span\u003e, \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePAQR8\u003c/span\u003e, \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePAQR5\u003c/span\u003e, and \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePAQR6\u003c/span\u003e genes were observed between eutopic and ectopic endometrium.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003emPRα and mPRβ content is decreased in ectopic endometrium of patients with endometriosis\u003c/h2\u003e \u003cp\u003emPRs protein content was quantified by Western blot. mPRα, mPRβ, and mPRδ content did not significantly change in the eutopic endometrium, however, in the ectopic endometrium of patients with endometriosis, the content of mPRα and mPRβ was significantly lower than that in the endometrium of healthy women (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e "},{"header":"Discussion","content":" \u003cp\u003eEndometriosis is a chronic and inflammatory disease in which specific etiology has not been elucidated. However, some molecular and biochemical alterations have been related to the development and progression of this pathology [36]. Progesterone resistance is one of the classical hallmarks of endometriosis, and although the mechanisms involved in this resistance have not been fully explained, it has been suggested that a decrease in the expression of PR-B in the endometriotic lesions could be involved in this resistance [11]. PR is not the only receptor through which progesterone can exert its functions. mPRs belongs to a group of cell surface receptors that activate non-genomic mechanisms of progesterone action in many progesterone-responsive cells and tissues [19]. In the present study, we have shown for the first time that gene expression and protein content of mPRs are decreased in the ectopic and eutopic endometrium of women with endometriosis compared to the endometrium of women without the disease, which in turn could explain another possibility for the molecular mechanisms involved in the lack of progesterone effects in this pathology.\u003c/p\u003e \u003cp\u003eThe decrease in PR-B expression in the ectopic endometrium of patients with endometriosis only partially explains the progesterone resistance since other factors such as alterations in progesterone signaling have been involved in this pathology [10,11]. The results of the present study showed that both the expression of \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePAQR7\u003c/span\u003e and \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePAQR5\u003c/span\u003e, as well as the protein content of mPRα and mPRβ, were significantly reduced in the ectopic endometrium of patients with endometriosis compared to the endometrium of women without the disease. Further studies are required to clarify whether the differences between mRNA expression and protein content are due to the sample size used in the present study or to specific mechanisms of transcriptional or translational regulation. These findings, together with previous studies, suggest that the decrease in the content of mPRα, mPRβ, and PR-B in the ectopic endometrium of women with endometriosis contributes to the progesterone resistance observed in this disease.\u003c/p\u003e \u003cp\u003eThe decrease in the expression of PR-B in the eutopic endometrium of women with endometriosis remains controversial since some studies have not found this reduction [12]. In the present study, we have shown that the expression of \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePAQR7\u003c/span\u003e, \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePAQR8\u003c/span\u003e, \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePAQR5\u003c/span\u003e and \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePAQR6\u003c/span\u003e genes is downregulated in the eutopic endometrium of patients with endometriosis compared to that of controls, which in turn could be associated with the progesterone resistance that leads to a reduced implantation capacity and increased risk of pregnancy loss observed in these patients [6]. However, we did not find a decrease in the protein content of mPRα, mPRβ, and mPRδ, which should be addressed in future studies with a larger sample size to compare our findings at the mRNA level. We were not able to detect mPRλ protein in our experimental conditions. A decrease in the expression and protein content of other membrane progesterone receptors, PGRMC1 and PGRMC2, has also been reported in the eutopic endometrium of patients with endometriosis compared to women without the disease [37]. The consistent decrease in mRNA levels of genes encoding mPRs and PGRMCs in the eutopic endometrium of women with endometriosis suggests a probable role of plasma membrane progesterone receptors in the pathogenesis of the disease, which should be addressed in future functional studies since it has been proposed that endometriosis is originated from eutopic endometrium cells [38].\u003c/p\u003e \u003cp\u003eIt has been previously reported that genes encoding mPRs are differentially expressed during the menstrual cycle, which suggests that sex hormones regulate their expression. Particularly, \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePAQR7\u003c/span\u003e expression is higher in the secretory phase of the menstrual cycle compared to that in the proliferative phase, whereas the expression of \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePAQR5\u003c/span\u003e and \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePAQR9\u003c/span\u003e is decreased in the secretory phase and, \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePAQR8\u003c/span\u003e expression is not differentially expressed during the menstrual cycle [30]. In the present study, most of the samples were obtained during the proliferative phase of the menstrual cycle and the expression of the four genes analyzed (\u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePAQR7\u003c/span\u003e, \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePAQR8\u003c/span\u003e, \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePAQR5\u003c/span\u003e, and \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePAQR6\u003c/span\u003e) was decreased in the eutopic endometrium of patients with endometriosis compared to the endometrium of control women. An open question that remains is whether the reduced expression of \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePARQ\u003c/span\u003e genes observed in patients with endometriosis is in part responsible for the progesterone resistance or if the latter leads to the decreased expression of those genes.\u003c/p\u003e \u003cp\u003eIt has been recently reported that the expression of \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePAQR7\u003c/span\u003e and the respective protein content are decreased in endometrial cancer compared to adjacent unaffected tissue [35]. In the present study, we also found a decrease in the mRNA expression and protein content of mPRα in the ectopic endometrium of women with endometriosis, suggesting a possible connection between the alterations in endometriosis and endometrial cancer, as previously proposed [39].\u003c/p\u003e "},{"header":"Conclusions","content":" \u003cp\u003eThe overall results of the present study demonstrate for the first time that gene expression of \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePAQR7\u003c/span\u003e and \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePAQR5\u003c/span\u003e, and protein content of mPRα and mPRβ are decreased in ectopic endometrium compared to that of women without the disease, and that gene expression of \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePAQR7\u003c/span\u003e, \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePAQR8\u003c/span\u003e, \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePAQR5\u003c/span\u003e, and \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePAQR6\u003c/span\u003e is decreased in eutopic endometrium. Our results reinforce the theory of progesterone resistance as part of the etiology of endometriosis. Further studies are required to elucidate the functional role of mPRs in normal, eutopic, and ectopic endometrium.\u003c/p\u003e "},{"header":"Abbreviations ","content":"\u003cp\u003eBSA, bovine serum albumin\u003c/p\u003e\n\u003cp\u003emPR, membrane progesterone receptor\u003c/p\u003e\n\u003cp\u003eOrg OD 02-0, 10-ethenyl-19-norprogesterone\u003c/p\u003e\n\u003cp\u003ePAQR, progesterone and adipoQ receptor\u003c/p\u003e\n\u003cp\u003ePGRMC, progesterone receptor membrane component\u003c/p\u003e\n\u003cp\u003ePR-B, progesterone receptor isoform B\u003c/p\u003e\n\u003cp\u003ePR, progesterone receptor\u003c/p\u003e\u003cp\u003e RIN, RNA Integrity Number\u003c/p\u003e"},{"header":"Declarations ","content":"\u003cp\u003eEthical approval and consent to participate: All procedures performed in the present study were in accordance with the ethical standards of the \u003cem\u003eComit\u0026eacute; de \u0026Eacute;tica en Investigaci\u0026oacute;n\u003c/em\u003e of the \u003cem\u003eInstituto Nacional de Perinatolog\u0026iacute;a\u003c/em\u003e in Mexico City, Mexico, reference number IRB00001944 and with the 1964 Helsinki declaration and its later amendments. All study participants signed informed consent for enrolment in the present study.\u003c/p\u003e\n\u003cp\u003eConsent for publication: Not applicable\u003c/p\u003e\n\u003cp\u003eAvailability of data and materials: All data generated or analyzed during this study are included in this published article.\u003c/p\u003e\n\u003cp\u003eCompeting interests: The authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003eFunding: This work was supported by the Instituto Nacional de Perinatolog\u0026iacute;a \u0026ldquo;Isidro Espinosa de los Reyes\u0026rdquo; (INPer; grant number 553, 212250-3000-20209-03-16).\u003c/p\u003e\n\u003cp\u003eAuthors\u0026rsquo; contributions: ERVM and ICA conceived the study and wrote the manuscript. ICA received the funds to support the present study. CBA performed protein isolation and western blot experiments and wrote the manuscript. ALHM performed RT-qPCR experiments. MSP analyzed RNA integrity and purity. ALHM and SPH extracted RNA. OCO, JRST, LFEP, LAHL, CRM, AOO, and BSR recruited women with endometriosis and obtained the samples from these patients. MOC and EGG recruited control women and obtained samples from this group. GEG and MC wrote and revised the manuscript.\u003c/p\u003e\n\u003cp\u003eAcknowledgements: Not applicable.\u003c/p\u003e"},{"header":"References ","content":"\u003col\u003e\n\u003cli\u003eCollinet P, Fritel X, Revel-Delhom C, Ballester M, Bolze PA, Borghese B, et al. Management of endometriosis: CNGOF/HAS clinical practice guidelines - Short version. J Gynecol Obstet Hum Reprod. 2018;47:265\u0026ndash;74.\u003c/li\u003e\n\u003cli\u003eBurney RO, Giudice LC. Pathogenesis and pathophysiology of endometriosis. Fertil Steril. 2012;98:511\u0026ndash;9.\u003c/li\u003e\n\u003cli\u003eHickey M, Ballard K, Farquhar C. Endometriosis. BMJ. 2014;348:g1752.\u003c/li\u003e\n\u003cli\u003eSchliep KC, Mumford SL, Peterson CM, Chen Z, Johnstone EB, Sharp HT, et al. Pain typology and incident endometriosis. Hum Reprod. 2015;30:2427\u0026ndash;38.\u003c/li\u003e\n\u003cli\u003ePractice Committee of the American Society for Reproductive Medicine. Endometriosis and infertility: a committee opinion. Fertil Steril. 2012;98:591\u0026ndash;8.\u003c/li\u003e\n\u003cli\u003eLessey BA, Kim JJ. Endometrial receptivity in the eutopic endometrium of women with endometriosis: it is affected, and let me show you why. Fertil Steril. 2017;108:19\u0026ndash;27.\u003c/li\u003e\n\u003cli\u003eGao X, Yeh YC, Outley J, Simon J, Botteman M, Spalding J. Health-related quality of life burden of women with endometriosis: a literature review. Curr Med Res Opin. 2006;22:1787\u0026ndash;97.\u003c/li\u003e\n\u003cli\u003eParasar P, Ozcan P, Terry KL. Endometriosis: Epidemiology, Diagnosis and Clinical Management. Curr Obstet Gynecol Rep. 2017;6:34\u0026ndash;41.\u003c/li\u003e\n\u003cli\u003eGeoffron S, Legendre G, Dara\u0026iuml; E, Chabbert-Buffet N. Medical treatment of endometriosis: Hormonal treatment of pain, impact on evolution and future perspectives. Presse Med. 2017;46:1199\u0026ndash;211.\u003c/li\u003e\n\u003cli\u003eMarquardt RM, Kim TH, Shin JH, Jeong JW. Progesterone and Estrogen Signaling in the Endometrium: What Goes Wrong in Endometriosis? Int J Mol Sci. 2019;20.\u003c/li\u003e\n\u003cli\u003eWu Y, Strawn E, Basir Z, Halverson G, Guo SW. Promoter hypermethylation of progesterone receptor isoform B (PR-B) in endometriosis. Epigenetics. 2006;1:106\u0026ndash;11.\u003c/li\u003e\n\u003cli\u003eMcKinnon B, Mueller M, Montgomery G. Progesterone Resistance in Endometriosis: an Acquired Property? Trends Endocrinol Metab. 2018;29:535\u0026ndash;48.\u003c/li\u003e\n\u003cli\u003eNorwitz ER, Schust DJ, Fisher SJ. Implantation and the survival of early pregnancy. N Engl J Med. 2001;345:1400\u0026ndash;8.\u003c/li\u003e\n\u003cli\u003eFaivre E, Skildum A, Pierson-Mullany L, Lange CA. Integration of progesterone receptor mediated rapid signaling and nuclear actions in breast cancer cell models: role of mitogen-activated protein kinases and cell cycle regulators. Steroids. 70:418\u0026ndash;26.\u003c/li\u003e\n\u003cli\u003eL\u0026ouml;sel R, Breiter S, Seyfert M, Wehling M, Falkenstein E. Classic and non-classic progesterone receptors are both expressed in human spermatozoa. Horm Metab Res. 2005;37:10\u0026ndash;4.\u003c/li\u003e\n\u003cli\u003eHernandez-Hernandez OT, Camacho-Arroyo I. Regulation of Gene Expression by Progesterone in Cancer Cells: Effects on Cyclin D1, EGFR and VEGF. Mini Rev Med Chem. 2013;13:635\u0026ndash;42.\u003c/li\u003e\n\u003cli\u003eScarpin KM, Graham JD, Mote PA, Clarke CL. Progesterone action in human tissues: regulation by progesterone receptor (PR) isoform expression, nuclear positioning and coregulator expression. Nucl Recept Signal. 2009;7:e009.\u003c/li\u003e\n\u003cli\u003eCamacho-Arroyo I, Hansberg-Pastor V, V\u0026aacute;zquez-Mart\u0026iacute;nez ER, Cerb\u0026oacute;n M. Mechanism of Progesterone Action in the Brain. In: Pfaff DW, Jo\u0026euml;ls M, editors. Hormones, Brain and Behavior. USA: Academic Press; 2016. pp. 181\u0026ndash;214.\u003c/li\u003e\n\u003cli\u003eValadez-Cosmes P, V\u0026aacute;zquez-Mart\u0026iacute;nez ER, Cerb\u0026oacute;n M, Camacho-Arroyo I. Membrane progesterone receptors in reproduction and cancer. Mol Cell Endocrinol. 2016;434:166\u0026ndash;75.\u003c/li\u003e\n\u003cli\u003eSmith JL, Kupchak BR, Garitaonandia I, Hoang LK, Maina AS, Regalla LM, et al. Heterologous expression of human mPRalpha, mPRbeta and mPRgamma in yeast confirms their ability to function as membrane progesterone receptors. Steroids. 2008;73:1160\u0026ndash;73.\u003c/li\u003e\n\u003cli\u003eGonz\u0026aacute;lez-Orozco JC, Hansberg-Pastor V, Valadez-Cosmes P, Nicolas-Ortega W, Bastida-Beristain Y, Fuente-Granada MD La, et al. Activation of membrane progesterone receptor-alpha increases proliferation, migration, and invasion of human glioblastoma cells. Mol Cell Endocrinol. 2018;477:81\u0026ndash;9.\u003c/li\u003e\n\u003cli\u003eZuo L, Li W, You S. Progesterone reverses the mesenchymal phenotypes of basal phenotype breast cancer cells via a membrane progesterone receptor mediated pathway. Breast Cancer Res. 2010;12:R34.\u003c/li\u003e\n\u003cli\u003eXie M, Zhu X, Liu Z, Shrubsole M, Varma V, Mayer IA, et al. Membrane progesterone receptor alpha as a potential prognostic biomarker for breast cancer survival: a retrospective study. PLoS One. 2012;7:e35198.\u003c/li\u003e\n\u003cli\u003eCharles NJ, Thomas P, Lange CA. Expression of membrane progesterone receptors (mPR/PAQR) in ovarian cancer cells: implications for progesterone-induced signaling events. Horm Cancer. 2010;1:167\u0026ndash;76.\u003c/li\u003e\n\u003cli\u003eDressing GE, Thomas P. Identification of membrane progestin receptors in human breast cancer cell lines and biopsies and their potential involvement in breast cancer. Steroids. 2007;72:111\u0026ndash;6.\u003c/li\u003e\n\u003cli\u003eRomero-S\u0026aacute;nchez M, Peiper SC, Evans B, Wang Z, Catas\u0026uacute;s L, Ribe A, et al. Expression profile of heptahelical putative membrane progesterone receptors in epithelial ovarian tumors. Hum Pathol. 2008;39:1026\u0026ndash;33.\u003c/li\u003e\n\u003cli\u003eValadez-Cosmes P, Germ\u0026aacute;n-Castel\u0026aacute;n L, Gonz\u0026aacute;lez-Arenas A, Velasco-Vel\u0026aacute;zquez MA, Hansberg-Pastor V, Camacho-Arroyo I. Expression and hormonal regulation of membrane progesterone receptors in human astrocytoma cells. J Steroid Biochem Mol Biol. 2015;154:176\u0026ndash;85.\u003c/li\u003e\n\u003cli\u003eZhu Y, Bond J, Thomas P. Identification, classification, and partial characterization of genes in humans and other vertebrates homologous to a fish membrane progestin receptor. Proc Natl Acad Sci U S A. 2003;100:2237\u0026ndash;42.\u003c/li\u003e\n\u003cli\u003ePang Y, Dong J, Thomas P. Characterization, neurosteroid binding and brain distribution of human membrane progesterone receptors \u0026delta; and {epsilon} (mPR\u0026delta; and mPR{epsilon}) and mPR\u0026delta; involvement in neurosteroid inhibition of apoptosis. Endocrinology. 2013;154:283\u0026ndash;95.\u003c/li\u003e\n\u003cli\u003eFernandes MS, Pierron V, Michalovich D, Astle S, Thornton S, Peltoketo H, et al. Regulated expression of putative membrane progestin receptor homologues in human endometrium and gestational tissues. J Endocrinol. 2005;187:89\u0026ndash;101.\u003c/li\u003e\n\u003cli\u003eMacias H, Hinck L. Mammary gland development. Wiley Interdiscip Rev Dev Biol. 2012;1:533\u0026ndash;57.\u003c/li\u003e\n\u003cli\u003eMesiano S, Wang Y, Norwitz ER. Progesterone receptors in the human pregnancy uterus: do they hold the key to birth timing? Reprod Sci. 2011;18:6\u0026ndash;19.\u003c/li\u003e\n\u003cli\u003eKarteris E, Zervou S, Pang Y, Dong J, Hillhouse EW, Randeva HS, et al. Progesterone signaling in human myometrium through two novel membrane G protein-coupled receptors: potential role in functional progesterone withdrawal at term. Mol Endocrinol. 2006;20:1519\u0026ndash;34.\u003c/li\u003e\n\u003cli\u003eMerlino AA, Welsh TN, Tan H, Yi LJ, Cannon V, Mercer BM, et al. Nuclear progesterone receptors in the human pregnancy myometrium: evidence that parturition involves functional progesterone withdrawal mediated by increased expression of progesterone receptor-A. J Clin Endocrinol Metab. 2007;92:1927\u0026ndash;33.\u003c/li\u003e\n\u003cli\u003eSinreih M, Knific T, Thomas P, Frković Grazio S, Rižner TL. Membrane progesterone receptors \u0026beta; and \u0026gamma; have potential as prognostic biomarkers of endometrial cancer. J Steroid Biochem Mol Biol. 2018;178:303\u0026ndash;11.\u003c/li\u003e\n\u003cli\u003eBurney RO. The genetics and biochemistry of endometriosis. Curr Opin Obstet Gynecol. 2013;25:280\u0026ndash;6.\u003c/li\u003e\n\u003cli\u003eBunch K, Tinnemore D, Huff S, Hoffer ZS, Burney RO, Stallings JD. Expression patterns of progesterone receptor membrane components 1 and 2 in endometria from women with and without endometriosis. Reprod Sci. 2014;21:190\u0026ndash;7.\u003c/li\u003e\n\u003cli\u003eBaranov V, Malysheva O, Yarmolinskaya M. Pathogenomics of Endometriosis Development. Int J Mol Sci. 2018;19: E1852.\u003c/li\u003e\n\u003cli\u003ePainter JN, O\u0026rsquo;Mara TA, Morris AP, Cheng THT, Gorman M, Martin L, et al. Genetic overlap between endometriosis and endometrial cancer: evidence from cross-disease genetic correlation and GWAS meta-analyses. Cancer Med. 2018;7:1978\u0026ndash;87.\u003c/li\u003e\n\u003c/ol\u003e\n"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"endometriosis, progesterone, membrane progesterone receptor, endometrium","lastPublishedDoi":"10.21203/rs.3.rs-16694/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-16694/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eBackground: Endometriosis is one of the most frequent gynecological diseases in reproductive age women, but its etiology is not completely understood. Endometriosis is characterized by progesterone resistance, which has been explained in part by a decrease in the expression of the intracellular progesterone receptor in the ectopic endometrium. Progesterone action is also mediated by non-genomic mechanisms via membrane progesterone receptors that belong to the class II members of the progesterone and adipoQ receptor (PAQR) family. The aim of the present study was to evaluate the expression at mRNA and protein levels of PAQR family members in the eutopic and ectopic endometrium of women with endometriosis. \u003c/p\u003e\u003cp\u003eMethods : Total RNA and total protein were isolated from control endometrium (17 samples), eutopic endometrium (17 samples), and ectopic endometrium (9 samples). The expression of PAQR7 ( mPRα ) , PAQR8 , (mPRβ) PAQR5 ( mPRγ ) , and PAQR6 ( mPRδ ) at mRNA and protein levels was evaluated by RT-qPCR and western blot. Statistical analysis between comparable groups was performed using one-way ANOVA followed by Tukey's multiple comparisons test with a confidence interval of 95%. \u003c/p\u003e\u003cp\u003eResults : The analysis of gene expression showed that PAQR7 and PAQR5 expression was lower in both eutopic and ectopic endometrium as compared to the endometrium of women without endometriosis, whereas the expression of PAQR8 and PAQR6 was only reduced in eutopic endometrium. Furthermore, mPRα and mPRβ protein content was decreased in the ectopic endometrium of women with endometriosis.\u003c/p\u003e\u003cp\u003e Conclusions : Our results demonstrate a decrease in the expression and protein content of mPRs in eutopic and ectopic endometrium of patients with endometriosis, which could contribute to the progesterone resistance observed in patients with this disease.\u003c/p\u003e","manuscriptTitle":"Expression of membrane progesterone receptors in eutopic and ectopic endometrium of women with endometriosis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2020-03-11 14:59:29","doi":"10.21203/rs.3.rs-16694/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"95b56708-9b1f-42cf-90c8-c3315ca23538","owner":[],"postedDate":"March 11th, 2020","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":68433,"name":"Sexual \u0026 Reproductive Medicine"}],"tags":[],"updatedAt":"2021-07-22T21:02:04+00:00","versionOfRecord":{"articleIdentity":"rs-16694","link":"https://doi.org/10.1155/2020/2196024","journal":{"identity":"biomed-research-international","isVorOnly":true,"title":"BioMed Research International"},"publishedOn":"2020-07-14 21:02:04","publishedOnDateReadable":"July 14th, 2020"},"versionCreatedAt":"2020-03-11 14:59:29","video":"","vorDoi":"10.1155/2020/2196024","vorDoiUrl":"https://doi.org/10.1155/2020/2196024","workflowStages":[]},"version":"v1","identity":"rs-16694","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-16694","identity":"rs-16694","version":["v1"]},"buildId":"0SHbDDIpRTBOrFPTvp6pu","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Condition tags

endometriosis

Citation neighborhood

Papers in the corpus that this work cites (lower rings, blue) and that cite this one (upper rings, green). Dot size scales with the paper's in-corpus citation count — bigger dot = more influential within the endo/adeno field. Click a dot to open that paper. [ expand to 2 hops ] — adds papers reached through this work's immediate citers/citees. Heavier; up to 60 extra dots.

References (29)

Cited by (1)

Source provenance

europepmc
last seen: 2026-07-29T07:07:21.499057+00:00
openalex
last seen: 2026-06-10T17:14:06.276822+00:00
License: CC0 · commercial use OK