Intro
One of the most common reproductive health
issues in developing countries is the high rate of
infertility ( 1 ). It becomes a globally important
subject for clinical research and practice because
infertility affects 60 to 168 million individuals,
both women and men, in reproductive age. It
has been reported that of 10 couples, one couple
incurs the early or secondary stages infertility ( 2 , 3 ).
Infertility is characterized as inability to conceive during one year, despite normal
cohabitation ( 4 ), as indicated by the European
Society of Human Reproduction and Embryology (ESHRE), which is evidenced in 10-15% of
all couples ( 5 ).
There are a number of factors which are responsible for infertility in females. According to
a study by Vayena et al. ( 3 ), the rates of primary
infertility are generally between 1 and 8% with
rates of secondary infertility reaching as high as 35%. Infection of reproductive organs is one of
the most important factors affecting infertility,
while the determination of the type of infection
has a significant contribution to the treatment of
this issue. However, the significance of these infections in the genital tracts is not well known.
Many microorganisms, including bacteria, viruses, parasites and fungi, seem to be able to
interfere with the reproductive function in both
genders. Bacterial vaginosis is a prevalent issue
among women with changing the balance of normal vaginal flora such as lactobacilli ( 6 , 7 ). However, some related pathogenic impacts have been
evidenced such as increased rates of premature
rupture of the membranes (PROM), late miscarriage in first trimester, preterm labor, endometriosis and delivery ( 6 ). Bacterial vaginosis is the
most common lower genital tract disorder among
reproductive age of women (pregnant and nonpregnant) and the most common cause of vaginal
odor and malodorous discharge ( 8 ).
The bacteria encountered in the female genital
tract can be divided into aerobic and anaerobic
organisms. Among the aerobic Gram-positive organisms, there are several species of Streptococcus (S.) , such as group B S. (GBS), and among
Gram-positive facultative anaerobic organisms,
there are several species of Enterococcus (E.)
( 9 ). S. aureus is an infrequent but one of the most
successful human pathogens. It has the ability to
cause a number of infections in various environmental corners within the host. S. aureus has additionally been reported to be commonly isolated
microorganism from cervical specimens ( 10 ). It
is found in the genital tract of approximately 9
to 10% of asymptomatic women, approximately
10% of patients with postoperative wound abscess after gynecologic or obstetric procedures,
and 5 to 20% of genital tract cultures of women
with pelvic infection. It is also detected in virtually 100% of women who have toxic shock
syndrome toxin-1 (TSST-1) ( 9 ). This study was,
therefore, designed to assess the frequency of S.
aureus isolated from infertile women’s endocervix in northwest Iran.
Results
During the study period, a total of 100 infertile women were included in this study. All participants underwent intrauterine insemination
(IUI). About 26 (26%) and 9 (9%) women’s urogenital tracts were colonized by S. aureus and
Candida spp., respectively, which were identified by mycology methods. Among them, three
(8.5%) patients were infected with fungus and
S. aureus , simultaneously. The average age of
these patients was 30.96 years, ranging between
18 and 56 years. Of the patients who were colonized by S. aureus , 11 (42.1%) were under 30
years and 14 (53.7%) were over 30 years of age.
After examining the wives of the patients who
were colonized by S. aureus , the semen samples
of four (15.38%) couples were positive for S.aureus . In addition, penicillin-resistant strains
of S. aureus were colonized in the reproductive
system of a couple. Of those Candida spp. carriers, three (3 of 9) wives were also infected with
Candida spp. The results of antibiotic susceptibility testing are summarized in Table 1.
The results of antibiotic susceptibility testing
The data were presented as N (%).
In general, vancomycin and co-trimoxazole
showed high activity against the isolates. Regarding PCR results, mecA sequences were detected
in 7 (26.9%) isolates, whilst the tst gene encoding TSST-1 was not detected in any of clinical
isolates.
Multiplex PCR product for the mecA and tst genes. M; 100
bp molecular weight marker, Lane 1; tst gene positive control
(ATCC 92-S-1344), Lane 2; mecA gene positive control (ATCC 95-
S-739), Lane 3; Negative control, and Lane 4-9; mecA positive .
Discussion
The study investigated the prevalence of S. aureus in infertile women. An in-depth study on these
genera has not yet been conducted in Iran. Generally, infectious vaginitis is a prevalent disorder with
noteworthy clinical results if left untreated. Infertility is an important health issue with far-reaching consequences on couple, family planning program,
health system and spread of sexually transmitted
diseases (STD) and acquired immunodeficiency
syndrome (AIDS). It can be characterized as the
lack of a conception after at least one year of constant, unprotected sexual intercourse ( 15 ).
In a study by Okonofua et al. ( 10 ), Candida albicans (25%), S. aureus (21.7%) and Neisseria
gonorrhoeae (17.4%) were the most commonly
isolated microorganisms; however, there was no
difference between fertile and infertile women in
the rates of isolation of these pathogens. In most
cases, resistance to penicillin is attributable to
β-lactamase production. We found that the most
antibiotic resistance was against penicillin, which
is not supported by a study conducted by Ghiasi
et al. ( 16 ), in which they have indicated 100% of
S. aureus were sensitive. Our findings also indicated that none of the S. aureus strains were resistant to vancomycin. In a study by El-Ghodban
et al. ( 17 ), they have reported that less than 50%
of S. aureus strains were β-lactamase producers
and resistant to penicillin. However, almost 75%
of the strains originating from food were positive
for β-lactamase and resistant to penicillin. In our
study, all isolates were positive for mecA genes,
while they were resistant to the gentamicin, ciprofloxacin and cefoxitin. de A Trindade et al. ( 18 )
have also reported that among methicillin-resistant
S. aureus (MRSA) isolated from blood samples,
twenty (13%) individuals were susceptible to four
or more antimicrobials.
The incidence of TSST-1-producing strains has
been registered worldwide ( 19 ). Colonization
with S. aureus is generally highest (20 to 30%) in
the oropharynx or nose of non-healthcare workers. Vaginal colonization with S. aureus has been
determined to be lower (10 to 20%) in the United
States, Europe, and Asia ( 20 ). Similarly, TSST-
1-producing strains of S. aureus have been isolated vaginally from 1 to 4% of healthy, menstruating women in the general population ( 19 ). Due
to a higher immune response to TSST-1, S. infections are more common in developing countries
than developed countries ( 21 ). We decided to
use tst in the present study because of limited reports from many developing countries. In a study
by Parsonnet et al. ( 19 ) carried out on Japanese
women, of the 159 S. aureus isolates recovered,
14 (9%) were TSST-1 positive, suggesting that
only 47% of women had positive titers of anti-
TSST-1 antibody, which is significantly lower
than the reported seropositivity rates in the Europe and United States ( 20 ). In the same study by
El-Ghodban et al. ( 17 ), TSST-1 was detected in
only three (7.5%) of 40 S. aureus clinical strains
and in none of the food strains. In another study
by Tsen et al. ( 22 ), they have firmly reported the
comparative discoveries, in which only three
(4.8%) of 62 strains of S. aureus from clinical
sources as tst-carrying strains were identified using PCR, but none of their food strains carried
this gene.
In the etiologies of infertility, the most contributed factors are related to female (40 to 55%) followed by male factors (30 to 40%), both partners
(10%) and unexplained factors (10%) ( 1 ). There
are several factors which increase risks for acquisition of bacterial vaginosis, while bacterial vaginosis is more prevalent in women who smoke ( 23 ),
black women ( 24 ), women who are sexually active
compared with virginal women ( 25 ), and women
who utilize vaginal douches ( 26 ).
The infertility leads to decreased levels of personal well-being, while for many individuals, it causes
more serious consequences ( 27 ). Subsequently, it
appears that screening is a reasonable approach that
is likely to be cost effective. However, all physicians must have a high index of suspicion and utilize promptly accessible screening methods to detect and treat the patients with infectious vaginitis
adequately ( 28 ). A limitation of the present study
was the lack of evaluation of S. aureus in fertile
women. However, it is suggested that further studies will be conducted on a larger sample.
Conclusions
The exact knowledge of S. aureus colonization
rate in infertile women has a great importance.
Therefore, it demands all patients undergoing infertility treatment to be investigated thoroughly.
Such screening and treatment during the course
of infertility treatment increase the pregnancy rate
extensively. However, randomized studies with
larger number of participants are needed to reach
more validated conclusions.
Materials Methods
Descriptive cross sectional study was carried
out at the Tabriz University of Medical Science
(TUMS), Tabriz, Iran, between April and July
2015. The cervical samples were randomly taken
from 100 women who attended the Department
of Obstetrics and Gynecology of Milad Infertility
Center affiliated to TUMS for unexplained infertility during the mentioned-period. Patients with
infertility due to unrelated reasons to S. aureus infections, such as ovarian cancer, lazy ovary, ovarian cysts and polycystic ovary syndrome (PCOS),
were excluded from the study.
The Ethic Commission of TUMS approved this
study (Number: 5/412912-2015). After obtaining a
written consent form from all patients, the specimens were collected using a sterile vaginal speculum and swab.
Samples were streaked on blood agar and mannitol salt agar (Merck, Germany) plates and incubated aerobically at 37°C for 24-48 hours. After
overnight incubation, the isolates were examined
by Gram staining technique using catalase, DNase
and coagulase tests ( 11 ).
The susceptibility of S. aureus isolates to antimicrobial agents was measured in vitro using the
disc diffusion method according to Clinical and
Laboratory Standards Institute (CLSI) protocols
( 12 ). The tested antibiotics included penicillin,
gentamicin, ciprofloxacin, vancomycin, trimethoprim/sulfamethoxazole and cefoxitin (MAST Diagnostics, UK).
Bacterial DNA was extracted from the isolates
according to tissue buffer boiling method ( 13 ).
Firstly, 20 µl tissue buffer [0.25% sodium dodecyl sulfate (SDS)+0.05M NaOH (CinnaClon,
Iran)] were mixed with one colony of bacterial
isolate, the combination was incubated for ten
minutes in 95°C, the mixture was centrifuged
for one minute in 13000 g, 180 µl Milli-Q water
(CinnaClon, Iran) were slowly added, and finally
extracted DNA was frozen in -20°C for durable
storage.
DNA isolates with the concentration of 0.1 ng/µl were used as the templates for polymerase chain
reaction (PCR) analysis. Multiplex PCR was carried out by CinnaGen MsterMix (CinnaClon, Iran)
using the mecA and tst primers, as described previously ( 14 ).
The sequences of the mecA primers used were:
5´-ACTGCTATCCACCCTCAAAC-3´ and
5´- CTGGTGAAGTTGTAATCTGG -3´,
while the sequences of the tst primers used were:
5´-ACCCCTGTTCCCTTATCATC-3´ and
5´-TTTTCAGTATTTGTAACGCC-3´ (synthesized
at the CinnaClon, Iran).
The strains 92-S-1344 (tst) and 95-S-739
(mecA) were used as positive control in this
study. Amplification was carried out using a
thermocycler (Eppendorf, Germany) as follows:
i. Initial denaturation at 94°C for 5 minutes, ii.
35 cycles of denaturation at 94°C for 2 minutes,
annealing at 57°C for 2 minutes, and primer extension at 72°C for 1 minutes, and iii. Terminal
extension at 72°C for 7 minutes. Electrophoresis
of PCR products was performed on 1% agarose
gel (CinnaClon, Iran). The gel staining was performed in ethidium bromide for 20 minutes and
visualized using a gel documentation system
(UVP, USA).
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.