{"paper_id":"c975b715-5e85-489a-b1f8-99d9f75c68de","body_text":"One of the most common reproductive health\nissues in developing countries is the high rate of\ninfertility ( 1 ). It becomes a globally important\nsubject for clinical research and practice because\ninfertility affects 60 to 168 million individuals,\nboth women and men, in reproductive age. It\nhas been reported that of 10 couples, one couple\nincurs the early or secondary stages infertility ( 2 ,  3 ).\nInfertility is characterized as inability to conceive during one year, despite normal\ncohabitation ( 4 ), as indicated by the European\nSociety of Human Reproduction and Embryology (ESHRE), which is evidenced in 10-15% of\nall couples ( 5 ).\nThere are a number of factors which are responsible for infertility in females. According to\na study by Vayena et al. ( 3 ), the rates of primary\ninfertility are generally between 1 and 8% with\nrates of secondary infertility reaching as high as 35%. Infection of reproductive organs is one of\nthe most important factors affecting infertility,\nwhile the determination of the type of infection\nhas a significant contribution to the treatment of\nthis issue. However, the significance of these infections in the genital tracts is not well known.\nMany microorganisms, including bacteria, viruses, parasites and fungi, seem to be able to\ninterfere with the reproductive function in both\ngenders. Bacterial vaginosis is a prevalent issue\namong women with changing the balance of normal vaginal flora such as lactobacilli ( 6 ,  7 ). However, some related pathogenic impacts have been\nevidenced such as increased rates of premature\nrupture of the membranes (PROM), late miscarriage in first trimester, preterm labor, endometriosis and delivery ( 6 ). Bacterial vaginosis is the\nmost common lower genital tract disorder among\nreproductive age of women (pregnant and nonpregnant) and the most common cause of vaginal\nodor and malodorous discharge ( 8 ).\nThe bacteria encountered in the female genital\ntract can be divided into aerobic and anaerobic\norganisms. Among the aerobic Gram-positive organisms, there are several species of  Streptococcus (S.) , such as group B S. (GBS), and among\nGram-positive facultative anaerobic organisms,\nthere are several species of  Enterococcus (E.) \n( 9 ).  S. aureus  is an infrequent but one of the most\nsuccessful human pathogens. It has the ability to\ncause a number of infections in various environmental corners within the host.  S. aureus  has additionally been reported to be commonly isolated\nmicroorganism from cervical specimens ( 10 ). It\nis found in the genital tract of approximately 9\nto 10% of asymptomatic women, approximately\n10% of patients with postoperative wound abscess after gynecologic or obstetric procedures,\nand 5 to 20% of genital tract cultures of women\nwith pelvic infection. It is also detected in virtually 100% of women who have toxic shock\nsyndrome toxin-1 (TSST-1) ( 9 ). This study was,\ntherefore, designed to assess the frequency of  S.\naureus  isolated from infertile women’s endocervix in northwest Iran.\n\nDescriptive cross sectional study was carried\nout at the Tabriz University of Medical Science\n(TUMS), Tabriz, Iran, between April and July\n2015. The cervical samples were randomly taken\nfrom 100 women who attended the Department\nof Obstetrics and Gynecology of Milad Infertility\nCenter affiliated to TUMS for unexplained infertility during the mentioned-period. Patients with\ninfertility due to unrelated reasons to  S. aureus  infections, such as ovarian cancer, lazy ovary, ovarian cysts and polycystic ovary syndrome (PCOS),\nwere excluded from the study.\nThe Ethic Commission of TUMS approved this\nstudy (Number: 5/412912-2015). After obtaining a\nwritten consent form from all patients, the specimens were collected using a sterile vaginal speculum and swab.\nSamples were streaked on blood agar and mannitol salt agar (Merck, Germany) plates and incubated aerobically at 37°C for 24-48 hours. After\novernight incubation, the isolates were examined\nby Gram staining technique using catalase, DNase\nand coagulase tests ( 11 ).\nThe susceptibility of  S. aureus  isolates to antimicrobial agents was measured  in vitro  using the\ndisc diffusion method according to Clinical and\nLaboratory Standards Institute (CLSI) protocols\n( 12 ). The tested antibiotics included penicillin,\ngentamicin, ciprofloxacin, vancomycin, trimethoprim/sulfamethoxazole and cefoxitin (MAST Diagnostics, UK).\nBacterial DNA was extracted from the isolates\naccording to tissue buffer boiling method ( 13 ).\nFirstly, 20 µl tissue buffer [0.25% sodium dodecyl sulfate (SDS)+0.05M NaOH (CinnaClon,\nIran)] were mixed with one colony of bacterial\nisolate, the combination was incubated for ten\nminutes in 95°C, the mixture was centrifuged\nfor one minute in 13000 g, 180 µl Milli-Q water\n(CinnaClon, Iran) were slowly added, and finally\nextracted DNA was frozen in -20°C for durable\nstorage.\nDNA isolates with the concentration of 0.1 ng/µl were used as the templates for polymerase chain\nreaction (PCR) analysis. Multiplex PCR was carried out by CinnaGen MsterMix (CinnaClon, Iran)\nusing the mecA and tst primers, as described previously ( 14 ).\nThe sequences of the mecA primers used were:\n5´-ACTGCTATCCACCCTCAAAC-3´ and\n5´- CTGGTGAAGTTGTAATCTGG -3´,\nwhile the sequences of the tst primers used were:\n5´-ACCCCTGTTCCCTTATCATC-3´ and\n5´-TTTTCAGTATTTGTAACGCC-3´ (synthesized\nat the CinnaClon, Iran).\nThe strains 92-S-1344 (tst) and 95-S-739\n(mecA) were used as positive control in this\nstudy. Amplification was carried out using a\nthermocycler (Eppendorf, Germany) as follows:\ni. Initial denaturation at 94°C for 5 minutes, ii.\n35 cycles of denaturation at 94°C for 2 minutes,\nannealing at 57°C for 2 minutes, and primer extension at 72°C for 1 minutes, and iii. Terminal\nextension at 72°C for 7 minutes. Electrophoresis\nof PCR products was performed on 1% agarose\ngel (CinnaClon, Iran). The gel staining was performed in ethidium bromide for 20 minutes and\nvisualized using a gel documentation system\n(UVP, USA).\n\nDuring the study period, a total of 100 infertile women were included in this study. All participants underwent intrauterine insemination\n(IUI). About 26 (26%) and 9 (9%) women’s urogenital tracts were colonized by  S. aureus  and\nCandida spp., respectively, which were identified by mycology methods. Among them, three\n(8.5%) patients were infected with fungus and\n S. aureus , simultaneously. The average age of\nthese patients was 30.96 years, ranging between\n18 and 56 years. Of the patients who were colonized by  S. aureus , 11 (42.1%) were under 30\nyears and 14 (53.7%) were over 30 years of age.\nAfter examining the wives of the patients who\nwere colonized by  S. aureus , the semen samples\nof four (15.38%) couples were positive for  S.aureus . In addition, penicillin-resistant strains\nof  S. aureus  were colonized in the reproductive\nsystem of a couple. Of those  Candida  spp. carriers, three (3 of 9) wives were also infected with\nCandida spp. The results of antibiotic susceptibility testing are summarized in Table 1.\nThe results of antibiotic susceptibility testing\nThe data were presented as N (%).\nIn general, vancomycin and co-trimoxazole\nshowed high activity against the isolates. Regarding PCR results,  mecA  sequences were detected\nin 7 (26.9%) isolates, whilst the tst gene encoding TSST-1 was not detected in any of clinical\nisolates.\nMultiplex PCR product for the mecA and tst genes. M; 100\nbp molecular weight marker, Lane 1; tst gene positive control\n(ATCC 92-S-1344), Lane 2; mecA gene positive control (ATCC 95-\nS-739), Lane 3; Negative control, and Lane 4-9; mecA positive .\n\nThe study investigated the prevalence of  S. aureus  in infertile women. An in-depth study on these\ngenera has not yet been conducted in Iran. Generally, infectious vaginitis is a prevalent disorder with\nnoteworthy clinical results if left untreated. Infertility is an important health issue with far-reaching consequences on couple, family planning program,\nhealth system and spread of sexually transmitted\ndiseases (STD) and acquired immunodeficiency\nsyndrome (AIDS). It can be characterized as the\nlack of a conception after at least one year of constant, unprotected sexual intercourse ( 15 ).\nIn a study by Okonofua et al. ( 10 ),  Candida albicans  (25%),  S. aureus  (21.7%) and  Neisseria\ngonorrhoeae  (17.4%) were the most commonly\nisolated microorganisms; however, there was no\ndifference between fertile and infertile women in\nthe rates of isolation of these pathogens. In most\ncases, resistance to penicillin is attributable to\nβ-lactamase production. We found that the most\nantibiotic resistance was against penicillin, which\nis not supported by a study conducted by Ghiasi\net al. ( 16 ), in which they have indicated 100% of\n S. aureus  were sensitive. Our findings also indicated that none of the  S. aureus  strains were resistant to vancomycin. In a study by El-Ghodban\net al. ( 17 ), they have reported that less than 50%\nof  S. aureus  strains were β-lactamase producers\nand resistant to penicillin. However, almost 75%\nof the strains originating from food were positive\nfor β-lactamase and resistant to penicillin. In our\nstudy, all isolates were positive for  mecA  genes,\nwhile they were resistant to the gentamicin, ciprofloxacin and cefoxitin. de A Trindade et al. ( 18 )\nhave also reported that among methicillin-resistant\n S. aureus  (MRSA) isolated from blood samples,\ntwenty (13%) individuals were susceptible to four\nor more antimicrobials.\nThe incidence of TSST-1-producing strains has\nbeen registered worldwide ( 19 ). Colonization\nwith  S. aureus  is generally highest (20 to 30%) in\nthe oropharynx or nose of non-healthcare workers. Vaginal colonization with  S. aureus  has been\ndetermined to be lower (10 to 20%) in the United\nStates, Europe, and Asia ( 20 ). Similarly, TSST-\n1-producing strains of  S. aureus  have been isolated vaginally from 1 to 4% of healthy, menstruating women in the general population ( 19 ). Due\nto a higher immune response to TSST-1, S. infections are more common in developing countries\nthan developed countries ( 21 ). We decided to\nuse tst in the present study because of limited reports from many developing countries. In a study\nby Parsonnet et al. ( 19 ) carried out on Japanese\nwomen, of the 159  S. aureus  isolates recovered,\n14 (9%) were TSST-1 positive, suggesting that\nonly 47% of women had positive titers of anti-\nTSST-1 antibody, which is significantly lower\nthan the reported seropositivity rates in the Europe and United States ( 20 ). In the same study by\nEl-Ghodban et al. ( 17 ), TSST-1 was detected in\nonly three (7.5%) of 40  S. aureus  clinical strains\nand in none of the food strains. In another study\nby Tsen et al. ( 22 ), they have firmly reported the\ncomparative discoveries, in which only three\n(4.8%) of 62 strains of  S. aureus  from clinical\nsources as tst-carrying strains were identified using PCR, but none of their food strains carried\nthis gene.\nIn the etiologies of infertility, the most contributed factors are related to female (40 to 55%) followed by male factors (30 to 40%), both partners\n(10%) and unexplained factors (10%) ( 1 ). There\nare several factors which increase risks for acquisition of bacterial vaginosis, while bacterial vaginosis is more prevalent in women who smoke ( 23 ),\nblack women ( 24 ), women who are sexually active\ncompared with virginal women ( 25 ), and women\nwho utilize vaginal douches ( 26 ).\nThe infertility leads to decreased levels of personal well-being, while for many individuals, it causes\nmore serious consequences ( 27 ). Subsequently, it\nappears that screening is a reasonable approach that\nis likely to be cost effective. However, all physicians must have a high index of suspicion and utilize promptly accessible screening methods to detect and treat the patients with infectious vaginitis\nadequately ( 28 ). A limitation of the present study\nwas the lack of evaluation of  S. aureus  in fertile\nwomen. However, it is suggested that further studies will be conducted on a larger sample.\n\nThe exact knowledge of  S. aureus  colonization\nrate in infertile women has a great importance.\nTherefore, it demands all patients undergoing infertility treatment to be investigated thoroughly.\nSuch screening and treatment during the course\nof infertility treatment increase the pregnancy rate\nextensively. However, randomized studies with\nlarger number of participants are needed to reach\nmore validated conclusions.","source_license":"CC-BY-4.0","license_restricted":false}