Correction to "Bushen Xiaozheng Decoction Improves Immunosuppression in a Rat Model of Endometriosis by Reducing IL-10 and TGF-β Levels"

American journal of reproductive immunology (New York, N.Y. : 1989) · 2026 · vol. 95(4) , pp. e70233 · doi:10.1111/aji.70233 · PMID:41954263
other OA: closed public-domain-us
Full text JSON View on PubMed View at publisher
⚙ AI-generated summary by gemini-2.5-flash-lite, 2026-06-08 ⓘ

This paper corrects previously published findings on Bushen Xiaozheng Decoction's effects on immunosuppression in a rat model of endometriosis, specifically addressing levels of IL-10 and TGF-β.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

⚙ AI-generated deep summary by claude@2026-06, 2026-06-10 · read from full text ⓘ

This paper is a correction notice to the previously published article on Bushen Xiaozheng Decoction in a rat model of endometriosis, specifically addressing errors in Table 1 primer sequences and in the author affiliations. The notice states that Table 1 originally included a redundant reverse primer sequence under the “Rat IL-10” entry, which should be removed, and provides the corrected version of the table. It also reports that the city listed for first and third authors under affiliation 1 was incorrectly stated as “Taiyuan” instead of “Jinzhong.” This paper is centrally about endometriosis — it is a correction to a rat endometriosis study assessing immunosuppression changes linked to IL-10 and TGF-β.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Full text 1,665 characters · extracted from oa-doi-fallback · click to expand
Correction to “Bushen Xiaozheng Decoction Improves Immunosuppression in a Rat Model of Endometriosis by Reducing IL-10 and TGF-β Levels” Chen F, Cui Y, Zhang W. Bushen Xiaozheng Decoction Improves Immunosuppression in a Rat Model of Endometriosis by Reducing IL-10 and TGF-β Levels. J. American Journal of Reproductive Immunology. 2026;95:e70223 In Table 1 (Primer sequences) on page 4 of the published article, an additional, redundant reverse primer sequence was incorrectly included under the “Rat IL-10” entry. The original, incorrect Table 1 is reproduced below: | Name | Primer | Sequence | Size | |---|---|---|---| | Rat GAPDH | Forward | ACAGCAACAGGGTGGTGGAC | 253bp | | Reverse | TTTGAGGGTGCAGCGAACTT | || | Rat IL-10 | Forward | ATAACTGCACCCACTTCCCA | 340bp | | Reverse | TGCTCCACTGCCTTGCTTTT | || | Reverse | GGCGGACAATAGAGGAAACG | || | Rat TGF-β1 | Forward | GTGGCTGAACCAAGGAGACGGAATA | 118bp | | Reverse | ACCTCGACGTTTGGGACTGATC | This second “Reverse” entry for Rat IL-10 is redundant and should be removed. The corrected, final version of Table 1 is provided below: | Name | Primer | Sequence | Size | |---|---|---|---| | Rat GAPDH | Forward | ACAGCAACAGGGTGGTGGAC | 253bp | | Reverse | TTTGAGGGTGCAGCGAACTT | || | Rat IL-10 | Forward | ATAACTGCACCCACTTCCCA | 340bp | | Reverse | TGCTCCACTGCCTTGCTTTT | || | Rat TGF-β1 | Forward | GTGGCTGAACCAAGGAGACGGAATA | 118bp | | Reverse | ACCTCGACGTTTGGGACTGATC | In the author affiliation section of the published article, the city affiliation listed for first author and third author under affiliation 1 was incorrectly stated as “Taiyuan” instead of the correct city “Jinzhong.” We apologize for this error.

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

⚙ Ask this paper AI returns verbatim quotes from the full text · source: oa-doi-fallback ⓘ

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Condition tags

endometriosis

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2026) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-09-04T06:17:57.233406+00:00
pubmed
last seen: 2026-09-04T06:11:57.934247+00:00
unpaywall
last seen: 2026-05-11T08:34:28.763810+00:00
License: public-domain-us · commercial use OK · attribution required
Courtesy of the U.S. National Library of Medicine