{"paper_id":"b8dd2f17-eff3-4847-b210-23dd920dd9fd","body_text":"Correction to “Bushen Xiaozheng Decoction Improves Immunosuppression in a Rat Model of Endometriosis by Reducing IL-10 and TGF-β Levels”\nChen F, Cui Y, Zhang W. Bushen Xiaozheng Decoction Improves Immunosuppression in a Rat Model of Endometriosis by Reducing IL-10 and TGF-β Levels. J. American Journal of Reproductive Immunology. 2026;95:e70223\nIn Table 1 (Primer sequences) on page 4 of the published article, an additional, redundant reverse primer sequence was incorrectly included under the “Rat IL-10” entry. The original, incorrect Table 1 is reproduced below:\n| Name | Primer | Sequence | Size |\n|---|---|---|---|\n| Rat GAPDH | Forward | ACAGCAACAGGGTGGTGGAC | 253bp |\n| Reverse | TTTGAGGGTGCAGCGAACTT | ||\n| Rat IL-10 | Forward | ATAACTGCACCCACTTCCCA | 340bp |\n| Reverse | TGCTCCACTGCCTTGCTTTT | ||\n| Reverse | GGCGGACAATAGAGGAAACG | ||\n| Rat TGF-β1 | Forward | GTGGCTGAACCAAGGAGACGGAATA | 118bp |\n| Reverse | ACCTCGACGTTTGGGACTGATC |\nThis second “Reverse” entry for Rat IL-10 is redundant and should be removed. The corrected, final version of Table 1 is provided below:\n| Name | Primer | Sequence | Size |\n|---|---|---|---|\n| Rat GAPDH | Forward | ACAGCAACAGGGTGGTGGAC | 253bp |\n| Reverse | TTTGAGGGTGCAGCGAACTT | ||\n| Rat IL-10 | Forward | ATAACTGCACCCACTTCCCA | 340bp |\n| Reverse | TGCTCCACTGCCTTGCTTTT | ||\n| Rat TGF-β1 | Forward | GTGGCTGAACCAAGGAGACGGAATA | 118bp |\n| Reverse | ACCTCGACGTTTGGGACTGATC |\nIn the author affiliation section of the published article, the city affiliation listed for first author and third author under affiliation 1 was incorrectly stated as “Taiyuan” instead of the correct city “Jinzhong.”\nWe apologize for this error.","source_license":"public-domain-us","license_restricted":false}