BMAL1 improves assisted reproductive technology outcomes in patients with polycystic ovary syndrome by targeting BMP6 and regulating ovarian granulosa cell apoptosis.

OA: gold CC-BY-NC-ND-4.0
AI-generated summary by gemini-2.5-flash-lite, 2026-07-08

This study found that BMAL1 expression is lower and BMP6 expression is higher in PCOS patients, with BMAL1 positively correlating with assisted reproductive technology outcomes by regulating granulosa cell apoptosis and proliferation via BMP6.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

AI-generated deep summary by qwen3.7-flash, 2026-08-30 · read from full text

This study investigated the molecular mechanisms by which BMAL1 influences assisted reproductive technology outcomes in patients with polycystic ovary syndrome (PCOS). Researchers analyzed ovarian granulosa cells from 40 PCOS patients and 39 controls, alongside KGN cell line experiments involving BMAL1 overexpression and knockdown. The findings demonstrated that BMAL1 improves oocyte quality and embryo development by upregulating BMP6 expression and subsequently reducing granulosa cell apoptosis. Relevance to endometriosis: BMP6 is cited as being associated with endometriosis, but the paper’s primary focus remains on polycystic ovary syndrome and its impact on ART success.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

PurposeTo investigate BMAL1 and BMP6 expressive differences in ovarian granulosa cells (OGCs) of patients with polycystic ovary syndrome (PCOS), explore regulatory relationship, assess their impacts on OGC proliferation and apoptosis, and analyze their correlations with ART outcomes of patients.MethodsA clinical study selected 40 PCOS patients who underwent IVF/ICSI in our hospital from January to October 2022 and 39 controls with male or tubal factor infertility. RT-qPCR and Western blot assessed BMAL1 and BMP6 mRNA/protein levels. The number of oocytes retrieved, 2PN fertilized oocytes, available embryos, and high-quality embryos were compared between groups and analyzed their correlations with BMAL1 and BMP6 expression levels. Cellular experiments were performed by overexpressing or knocking down BMAL1 in KGN cells by plasmid transfection. The dual-luciferase reporter assay was used to identify BMAL1/BMP6 regulatory relationship. CCK-8 and flow cytometry assessed cellular proliferation and apoptosis.ResultsBMAL1 mRNA/protein expression (P < 0.001) in the PCOS group was significantly lower than that in controls, as was the number of high-quality embryos (P = 0.001). Contrastingly, BMP6 (P < 0.001) was significantly higher in the PCOS group. BMAL1 expression levels were negatively correlated with BMP6 (r = - 0.684, P = 0.002) and positively correlated with the number of 2PN fertilized oocytes, available embryos, and high-quality embryos (r = 0.659, P = 0.003; r = 0.623, P = 0.006; and r = 0.738, P < 0.001). Cellular experiments showed that overexpression of BMAL1 significantly decreased relative luciferase activity (P < 0.01). Overexpression of BMAL1 significantly decreased KGN cell apoptosis (P < 0.01) and enhanced proliferation (P < 0.01).ConclusionBMAL1 regulates OGCs proliferation and apoptosis by targeting BMP6, thereby influencing ART outcomes in patients with PCOS. This study might provide molecular factors that indicate ART outcomes and therapeutic targets for PCOS.Trial registrationRegistration number: ChiCTR2100052331; registration date: 2021-10-24.
Full text 35,319 characters · extracted from pmc-nxml · 4 sections · click to expand

Results

We enrolled 79 patients: 39 within the control group and 40 within the PCOS group. Table 4 shows the baseline characteristics of the participants. The differences in age, types and durations of infertility, dosages and durations of gonadotropin (Gn) administration, basic follicle-stimulating hormone (FSH), progesterone, and estradiol were statistically non-significant between the two groups ( P  > 0.05). Nonetheless, the PCOS group’s body mass index (BMI), basic luteinizing hormone (LH), and LH/FSH ratio were significantly greater than those of the control group ( P  < 0.05). Table 4 Baseline characteristics of the enrolled participants Control group PCOS group P value No. of patients 40 39 Age (years) 30.88 ± 2.21 30.36 ± 2.35 0.317 Duration of Gn (days) 9 (8–10) 9 (8–10) 0.758 Total Gn dose administered (IU) 2025 (1756.25–2175) 1900 (1625–2400) 0.852 Duration of infertility (years) 2.5 (2–4) 3 (2–5) 0.225 Infertility type 0.744     Primary infertility 42.5% (17/40) 46.2% (18/39)     Secondary infertility 57.5% (23/40) 53.8% (21/39) BMI (kg/m 2 ) 24.12 ± 3.71 26.23 ± 4.48 0.025 * Basic FSH (mIU/ml) 6.18 ± 1.19 5.81 ± 1.65 0.246 Basic LH (mIU/ml) 3.82 (2.95–6.15) 6.70 (3.88–10.24) 0.002 ** LH/FSH 0.66 (0.45–0.92) 1.29 (0.77–1.89)  < 0.001 *** Basic estradiol (pg/ml) 32.48 (25.79–41.88) 35.55 (29.80–45.34) 0.357 Basic progesterone (ng/ml) 0.32 (0.17–0.40) 0.33 (0.14–0.65) 0.474 Data are mean ± SD, median ( P 25 - P 75 ), or % ( n / N ). All P values were assessed with the use of Independent samples t test, Mann–Whitney U test, or χ 2 BMI body mass index, FSH follicle stimulating hormone, LH luteinizing hormone * P  < 0.05, ** P  < 0.01, and *** P  < 0.001 Baseline characteristics of the enrolled participants Data are mean ± SD, median ( P 25 - P 75 ), or % ( n / N ). All P values were assessed with the use of Independent samples t test, Mann–Whitney U test, or χ 2 BMI body mass index, FSH follicle stimulating hormone, LH luteinizing hormone * P  < 0.05, ** P  < 0.01, and *** P  < 0.001 Statistical analyses of the indicators related to the embryo transfer cycle for both groups are shown in Table  5 . There was no statistically significant difference in the fertilization method ( P  > 0.05). The PCOS group had significantly more retrieved oocytes and 2PN fertilized oocytes than the control group ( P   0.05). Furthermore, there were significantly more high-quality embryos in the control group than in the PCOS group ( P  < 0.05). Table 5 Clinical outcomes Control group PCOS group P value No. of patients 40 39 Fertilization method 0.228     IVF 80% (32/40) 89.7% (35/39)     ICSI 20% (8/40) 10.3% (4/39) No. of oocytes retrieved 11 (8.25–14) 19 (11–23)  < 0.001 *** No. of 2PN fertilized oocytes 8 (6–11.75) 13 (8–19) 0.004 ** No. of available embryos 5 (3–7) 5 (3–7) 0.653 No. of high-quality embryos 3 (1.25–4) 2 (1–2) 0.001 ** Data are mean ± SD, median ( P 25 - P 75 ), or % ( n / N ). All P values were assessed with the use of Independent samples t test, Mann–Whitney U test, or  χ 2 ICSI intra cytoplasmic sperm injection, IVF in vitro fertilization * P  < 0.05, ** P  < 0.01, and *** P  < 0.001 Clinical outcomes Data are mean ± SD, median ( P 25 - P 75 ), or % ( n / N ). All P values were assessed with the use of Independent samples t test, Mann–Whitney U test, or  χ 2 ICSI intra cytoplasmic sperm injection, IVF in vitro fertilization * P  < 0.05, ** P  < 0.01, and *** P  < 0.001 BMAL1/BMP6 mRNA and protein levels in OGCs were assessed using qRT-PCR and western blot, respectively. As shown in Fig.  1 , compared to those of the control group, the mRNA and protein levels of BMAL1 in the OGCs of the PCOS group were markedly downregulated ( P  < 0.001), while those of BMP6 were upregulated ( P  < 0.001). Furthermore, there was an inverse correlation between the levels of BMP6 and BMAL1 mRNA ( r  = − 0.684, P  = 0.002). Fig. 1 Comparison of the expression levels of BMAL1 and BMP6 in human OGCs between PCOS and control groups. A, B BMAL1 and BMP6 mRNA levels between PCOS and control groups. C–E BMAL1 and BMP6 protein levels between PCOS and control groups. F Correlations between the mRNA expression levels of BMP6 and BMAL1 in OGCs. * P  < 0.05, ** P  < 0.01, and *** P  < 0.001 Comparison of the expression levels of BMAL1 and BMP6 in human OGCs between PCOS and control groups. A, B BMAL1 and BMP6 mRNA levels between PCOS and control groups. C–E BMAL1 and BMP6 protein levels between PCOS and control groups. F Correlations between the mRNA expression levels of BMP6 and BMAL1 in OGCs. * P  < 0.05, ** P  < 0.01, and *** P  < 0.001 To explore the impact of changes in the mRNA levels of BMAL1 and BMP6 in OGCs of patients on ART outcomes, we used Spearman’s correlation analysis to perform a correlation study. The results showed that the mRNA levels of BMAL1 were positively connected with the number of 2PN fertilized oocytes, available embryos, and high-quality embryos ( r  = 0.659, P  = 0.003; r  = 0.623, P  = 0.006; and r  = 0.738, P  < 0.001, Fig.  2 B–D). Conversely, the mRNA levels of BMP6 were inversely related to these outcomes ( r  = − 0.606, P  = 0.008; r  = − 0.574, P  = 0.013; and r  = − 0.598, P  = 0.009, Fig.  2 F–H). These findings suggest that high levels of BMAL1 in OGCs are correlated with a higher number of 2PN fertilized oocytes, available embryos, and high-quality embryos. Fig. 2 The mRNA levels of BMAL1 and BMP6 in OGCs are correlated with ART outcomes of patients. Spearman’s correlation analyses were used to investigate the correlation between the mRNA levels of BMAL1 and the number of retrieved oocytes ( A ), 2PN fertilized oocytes ( B ), available embryos ( C ), and high-quality embryos ( D ). Spearman’s correlation analyses were used to investigate the correlation between the mRNA levels of BMP6 and the number of retrieved oocytes ( E ), 2PN fertilized oocytes ( F ), available embryos ( G ), and high-quality embryos ( H ) The mRNA levels of BMAL1 and BMP6 in OGCs are correlated with ART outcomes of patients. Spearman’s correlation analyses were used to investigate the correlation between the mRNA levels of BMAL1 and the number of retrieved oocytes ( A ), 2PN fertilized oocytes ( B ), available embryos ( C ), and high-quality embryos ( D ). Spearman’s correlation analyses were used to investigate the correlation between the mRNA levels of BMP6 and the number of retrieved oocytes ( E ), 2PN fertilized oocytes ( F ), available embryos ( G ), and high-quality embryos ( H ) To investigate whether BMAL1 can bind to the promoter region of BMP6, we first used the AnimalTFDB v4.0 database ( https://guolab.wchscu.cn/AnimalTFDB4/#/ ) to predict the binding sites of BMAL1 on the BMP6 promoter region. A potential binding site was identified between positions 1550 and 1560. Consequently, we constructed wild-type (WT) and mutant-type (MUT) luciferase reporter plasmids at this site. According to the plasmid combinations shown in Table  1 , they were transfected into cells separately. After 48 h of transfection, the results were tested using a dual-luciferase reporter assay kit. Figure  3 A illustrates a schematic depiction of the binding sequence. The dual-luciferase assay results, as depicted in Fig.  3 B, demonstrated that BMAL1 overexpression dramatically reduced the relative activity of luciferase ( P  < 0.01) in the presence of BMP6-WT, as opposed to the NC group. In contrast, when the BMP6 binding site region was mutated (BMP6-MUT), the inhibitory effect of BMAL1 overexpression was abolished. Fig. 3 BMP6 is a downstream target of BMAL1. A Predicted binding site and mutated binding site of BMAL1 in the promoter of BMP6[created with figdraw.com]. B Direct interaction between BMAL1 and BMP6 detected by the dual-luciferase assay. * P  < 0.05, ** P  < 0.01, and *** P  < 0.001 BMP6 is a downstream target of BMAL1. A Predicted binding site and mutated binding site of BMAL1 in the promoter of BMP6[created with figdraw.com]. B Direct interaction between BMAL1 and BMP6 detected by the dual-luciferase assay. * P  < 0.05, ** P  < 0.01, and *** P  < 0.001 We investigated whether BMAL1 influences the levels of BMP6 at both mRNA and protein. The qRT-PCR results (Fig.  4 A) indicated that in contrast to the NC group, the cells transfected with the BMAL1 overexpression plasmid (OE-BMAL1 group) significantly increased BMAL1 mRNA levels ( P  < 0.01), while the cells transfected with the BMAL1 knockdown plasmid (Si-BMAL1 group) decreased BMAL1 mRNA levels ( P  < 0.01). This confirmed the successful transfection in the aforementioned groups. Furthermore, compared to the NC group, BMP6 mRNA levels were significantly reduced in the OE-BMAL1 group ( P  < 0.001), but significantly higher in the Si-BMAL1 group ( P  < 0.001) (Fig.  4 B). Western blot outcomes also indicated that overexpression of BMAL1 decreased the protein levels of BMP6, whereas downregulation of BMAL1 increased the protein levels of BMP6 (Fig.  4 C, D). These results suggested that BMAL1 regulates the expression of BMP6. Fig. 4 The impact of BMAL1 on the expression of BMP6 in KGN cells. A, B Expression levels of BMAL1 and BMP6 mRNA in KGN cells after transfection. C, D Expression levels of BMP6 protein in KGN cells after transfection. OE, overexpression; NC, negative control. * P  < 0.05, ** P  < 0.01, and *** P  < 0.001 The impact of BMAL1 on the expression of BMP6 in KGN cells. A, B Expression levels of BMAL1 and BMP6 mRNA in KGN cells after transfection. C, D Expression levels of BMP6 protein in KGN cells after transfection. OE, overexpression; NC, negative control. * P  < 0.05, ** P  < 0.01, and *** P  < 0.001 Flow cytometry and CCK-8 assays were conducted to evaluate the effects of BMAL1 in apoptosis, as well as cell proliferation in KGN cells. As demonstrated in Fig.  5 A, B, compared to that in the NC group, the apoptosis rate in the OE-BMAL1 group was significantly lower ( P  < 0.001), while the rate in the Si-BMAL1 group was significantly higher ( P  < 0.001). The CCK-8 results, as depicted in Fig.  5 C, indicated that the cell proliferation ability in the OE-BMAL1 group was considerably higher than that in the NC group ( P  < 0.001). In contrast, the cell activity of the Si-BMAL1 group was markedly lower than that of the NC group ( P  < 0.001). These findings suggest that BMAL1 suppresses apoptosis and enhances proliferation of KGN cells. Fig. 5 The impact of BMAL1 on KGN cells apoptosis and proliferation. A Representative images of KGN cells apoptosis after transfection. B Histogram representation of the apoptosis rate in KGN cells. C Histogram representation of the proliferative activity in KGN cells after transfection. OE, overexpression; NC, negative control. * P  < 0.05, ** P  < 0.01, and *** P  < 0.001 The impact of BMAL1 on KGN cells apoptosis and proliferation. A Representative images of KGN cells apoptosis after transfection. B Histogram representation of the apoptosis rate in KGN cells. C Histogram representation of the proliferative activity in KGN cells after transfection. OE, overexpression; NC, negative control. * P  < 0.05, ** P  < 0.01, and *** P  < 0.001

Materials

From January to October 2022, we enrolled 79 patients who underwent IVF/ICSI at Shandong University of Traditional Chinese Medicine Affiliated Hospital’s Reproductive and Genetic Department. Of these, 40 patients were identified with PCOS based on the 2003 updated diagnostic criteria formulated by the Rotterdam Society of Human Reproduction and Embryology in partnership with the American Society of Reproductive Medicine [ 26 ]. The remaining 39 patients, due to male factor infertility, served as the control group. Inclusion criteria required participants to be between 25 and 40 years old and to undergo ovulation induction using an antagonist regimen. Exclusion criteria included severe cardiovascular, neurological, hepatic, renal, or hematological diseases; infectious or sexually transmitted diseases; mental illnesses; and endocrine dysfunction affecting the thyroid, adrenal, or pituitary glands. Additionally, participants with structural abnormalities of the reproductive system (e.g., polyps, myomas, or abnormalities in the structure of the reproductive tract), couples with chromosomal abnormalities, or patients with RSA were excluded. All participants received a gonadotropin-releasing hormone (GnRH) antagonist procedure for controlled ovarian hyperstimulation (COH). Baseline serum reproductive hormones and a transvaginal ultrasonography were performed on the second day of menstruation. Based on individual conditions, patients were administered 150–300 IU/day of recombinant follicle-stimulating hormone β (r-FSH, Puregon, Merck, Canada) for COH. Transvaginal ultrasonography and assessments of serum reproductive hormone were conducted every 2–4 days, with adjustments to r-FSH doses according to the follicular growth. When the dominant follicle measured 12–14 mm in diameter, a GnRH antagonist (Ganirelix, Merck, Canada) was given and continued until the day of ovulation triggering. Once the desired follicle diameter reached 18 mm, 250 µg of recombinant human chorionic gonadotropin (rhCG, Ovidrel™) was given to induce ovulation. Thirty-four to thirty-six hours later, transvaginal oocyte retrieval was performed under ultrasound guidance, and all follicular fluid samples were collected. After collecting the follicular fluid, it was centrifuged for 10 min at 3000 rpm. The cellular middle layer was collected using a Pasteur pipette and transferred to a centrifuge tube containing 4 mL of phosphate-buffered saline (PBS) to create a cellular suspension. The cellular suspension was carefully transferred to the surface of 2.5 mL human lymphocyte separation medium (TBD), then centrifuged for 10 min at 2000 rpm. Then the OGCs, which formed a white cloudy cell mass between the suspension and the TBD, were aspirated into a 1.5-mL centrifuge tube and centrifuged for 10 min at 2500 rpm. The cells were stored at − 80 °C in a freezer for subsequent analysis, after discarding the supernatant. Two distinct pronuclei-containing nuclei (2PN) appear 17 h after insemination, confirming the success of fertilization. Seventy-two hours later, the embryos’ morphology and quality are assessed according to cell cleavage. Grade I embryos contain 7–9 cells, with uniform blastomeres, and a fragmentation rate below 10%. Grade II embryos have a fragmentation rate of 11–25%, whereas Grade III embryos exhibit irregular cell partitioning and a fragmentation rate above 25% [ 27 ]. Grade I and II embryos are considered available, with Grade I embryos being of high-quality. Suitable embryos are transferred into an extended culture medium to reach the blastocyst stage on the third day following fertilization. The Gardner scoring system is used to evaluate blastocyst quality. Blastocysts are graded from 1 to 6 based on cell density and the degree of hatching (division), with a score of 6 being the best. Blastocysts are also graded from high to low as AA, AB, BA, BB, AC, BC, etc., based on the attributes of the inner cell group and trophoblast layer [ 28 ]. Blastocysts graded as 3BB or above are classified as high-quality. KGN cells (Procell CL-0603) were provided by Procell Life Science & Technology Co., Ltd. KGN cells are cultivated in DMEM/F-12 medium with 10% fetal bovine serum and 1% penicillin–streptomycin added, and placed in an incubator at 37 °C with 5% CO 2 for growth. BMAL1 overexpression, knockdown, and negative control (NC) plasmids were synthesized and constructed by Beijing Qingke Biotechnology Co., Ltd. and Shandong Jinbai Ao Biotechnology Co., Ltd. The vectors of pGL3-Basic, pGL3-BMP6-WT, and pGL3-BMP6-MUT were synthesized by Beijing Qingke Biotechnology Co., Ltd. Well-grown KGN cells, after being plated in 24-well culture plates, were transfected with the corresponding vectors once they reached a confluence of 70 to 80%. Table 1 displays the plasmid combinations. The Dual-Luciferase Reporter Assay Kit (Promega) was utilized to evaluate the levels of firefly and Renilla luciferase activity 48 h post-treatment. Table 1 The combinations of transfected plasmids Serial number Plasmid combinations 1 pGL3-Basic + OE-NC 2 pGL3-Basic + OE-BMAL1 3 PGL3-BMP6-WT + OE-NC 4 PGL3-BMP6-WT + OE-BMAL1 5 PGL3-BMP6-MUT + OE-NC 6 PGL3-BMP6-MUT + OE-BMAL1 BMAL1 Brain and Muscle Arnt-Like Protein 1 gene, BMP6 Bone Morphogenetic Protein 6, OE overexpression, NC negative control The combinations of transfected plasmids BMAL1 Brain and Muscle Arnt-Like Protein 1 gene, BMP6 Bone Morphogenetic Protein 6, OE overexpression, NC negative control Well-grown KGN cells were plated in 6-well plates. Following a 70–80% confluence, Lipo3000 (Invitrogen, L3000-008) was used to transfect BMAL1 overexpression, knockdown and NC plasmids. The KGN cells were collected for further experiments after 48 h of transfection. Total RNA was extracted from OGCs and KGN cells (transfected with the overexpression, knockdown, or NC plasmids) using TRIzol reagent (Invitrogen) in accordance with the manufacturer’s instructions. cDNA was obtained by reverse transcription using HiScript II QRT SuperMix for qPCR (Vazyme, R223-01), and qPCR was performed using ChamQ SYBR qPCR Master Mix2 (Vazyme, Q311-02) on a real-time quantitative PCR instrument (Bio-Rad, CFX96 Touch). The relative expression of candidate genes was normalized to the expression of the reference gene and then calculated using the 2 −ΔΔCt method. All primer sequences are shown in Table  2 . Table 2 Primers used for quantitative real-time polymerase chain reaction Gene Primer sequence (5′ → 3′) Homo-BMAL1-F CAAGGGAAGCTCACAGTCAGATT Homo-BMAL1-R AGCCATCCTTAGCACAGTAAGTT Homo-BMP6-F GAATTTGACATCACGGCCACTAG Homo-BMP6-R TGCACCTCACTCACTTTGAAGAA Homo-GAPDH-F GGAAGCTTGTCATCAATGGAAATC Homo-GAPDH-R TGATGACCCTTTTGGCTCCC Primers used for quantitative real-time polymerase chain reaction Total protein was separated from OGCs and KGN cells (transfected with overexpression, knockdown, or NC plasmids). After treatment with RIPA lysis buffer (Servicebio, G2002) containing protease inhibitors for 30 min, the cells were centrifuged at 12,000 rpm for 10 min at 4 °C. Total cellular protein was isolated from the collected supernatant. The BCA Protein Assay Kit (CWBIO, CW0014) was applied to calculate the protein concentration. Subsequently, the samples underwent SDS-PAGE electrophoresis and were transferred onto polyvinylidene difluoride membranes. After 15 min of blocking with quick blocking solution (Genefist, GF1815), the membranes were incubated with the primary antibody for an extended period overnight at 4 °C and washed three times for 10 min each with TBST buffer the next day. After a 1-h incubation at room temperature with the secondary antibody, the membranes were washed again with TBST buffer three times for 10 min each. Proteins were visualized by an ECL chemiluminescence detection kit (Vazyme, E412-02), with GADPH as an internal reference. Protein expression was imaged using the Tanon gel imaging instrument and analyzed via ImageJ software. Antibodies’ information is shown in Table  3 . Table 3 Antibody information Antibody Product number Manufacturer Dilution ratio BMP6 Polyclonal antibody 55,421–1-AP Proteintech 1:1000 BMAL1(D2L7G) Rabbit mAb 14,020 CST 1:1000 GAPDH Rabbit pAb 10,494 Proteintech 1:40,000 Anti-rabbit IgG, HRP-linked antibody 7074 CST 1:3000 Antibody information The Annexin V-FITC/PI Apoptosis Detection Kit (Vazyme, A211-02) was utilized to assess cellular apoptosis. KGN cells were plated in 6-well plates, and once the cells adhered, they were transfected with BMAL1 overexpression, knockdown, or NC plasmids. Forty-eight hours later, the cells were collected using trypsin–EDTA digestion (Biosharp, BL512A). The resulting cellular suspension was transferred to EP tubes and centrifuged at 1000 rpm for 5 min. The cells were washed twice with pre-chilled PBS after the supernatant was removed. 100 μl of 1 × Binding Buffer was used to resuspend the cells; then the 5 μl of FITC Annexin V and 5 μl of propidium iodide (PI) were added. After properly vortexing the mixture, it was incubated for 15 min in the darkness. After resuspending the cells with 300 μl of Binding Buffer, the mixture was analyzed to detect apoptotic cells by the flow cytometer (BD, C6 Plus) within 1 h. KGN cells were plated in 96-well plates and incubated at 37 °C with 5% CO 2 overnight. Once the cells had adhered, they were transfected with BMAL1 overexpression, knockdown, or NC plasmids with three replicate wells for each group. The original culture media were discarded after 48 h of incubation, and the cells were washed with PBS. One-hundred microliter of serum-free medium containing 10% CCK8 solution (Vazyme, A311-02-AA) was incubated with each well at 37 °C with 5% CO 2 for 2 h. The absorbance was measured at 450 nm using a microplate reader (Bio-Rad, Imark-22353), and the cell viability rate was calculated. Data analysis was performed using IBM SPSS Statistics software (version 25.0), and graphs were plotted using GraphPad Prism 9.5.1. Quantitative data satisfying normal distribution were expressed as mean ± standard deviation ( X  ± SD), while skewed distribution was represented by median ( P 25 - P 75 ). For comparisons between two groups, an independent samples t -test was applied if the data met normality and homogeneity of variance criteria. When these conditions were not satisfied, the Mann–Whitney U test was used instead. Categorical data was presented as frequencies and analyzed using the chi-square test for R  ×  C contingency tables to assess the differences in rates between the two groups. The correlations between BMAL1/BMP6 levels and ART outcomes were assessed using Spearman’s correlation analysis. A two-tailed significance level of P  < 0.05 was used to assess statistical significance.

Discussion

Within this research, we observed that the levels of BMAL1 were decreased in OGCs of patients with PCOS, while BMP6 levels were increased. Concurrently, our analysis showed a positive relationship between BMAL1 mRNA levels and the number of 2PN fertilized oocytes, available embryos, and high-quality embryos. Conversely, the levels of BMP6 mRNA were negatively associated with these outcomes. Further experiments using plasmid transfection and the dual-luciferase reporter gene assay confirmed that BMP6 is a direct target of BMAL1. Flow cytometry and CCK8 also confirmed that BMAL1 regulates the KGN apoptosis by targeting BMP6, thereby playing a significant role in PCOS. As the most abundant cells in the ovary, OGCs are closely linked to ovarian function through their involvement in proliferation, apoptosis, and hormone synthesis. They communicate directly with oocytes via gap junctions and contribute to oocyte maturation, ovulation, and fertilization via paracrine signaling mechanisms [ 29 ]. Previous studies have found that OGCs from patients with PCOS exhibit abnormalities in apoptosis, autophagy, proliferation, mitochondrial function, and inflammatory responses [ 30 – 34 ]. These abnormalities may be detrimental to oocyte development and maturation, suggesting that OGCs play a crucial role in improving oocyte quality in patients with PCOS. Oocytes of high quality have greater potential to complete normal meiotic processes, mature, fertilize, and develop into viable embryos for transfer, thereby increasing the likelihood of pregnancy [ 35 ]. Although patients with PCOS have a high number of follicles, many of these follicles fail to mature properly, making them more susceptible to developmental arrest and ovulation disorders. Consequently, poor oocyte quality remains a significant challenge faced by patients with PCOS during IVF/ICSI. Our analysis of ART outcomes revealed that while the number of oocytes retrieved and 2PN fertilized oocytes in patients with PCOS was higher than the control group, the number of high-quality embryos was considerably lower, likely due to the decline in oocyte quality of patients with PCOS. Circadian clocks are present throughout the life of organisms and regulate the internal physiological rhythms and behaviors of the body. Imbalances in the expression of circadian clocks are involved in multiple reproductive diseases, such as PCOS [ 10 ], premature ovarian failure [ 36 ], and RSA [ 17 ]. Early research has demonstrated that BMAL1 is intimately linked to ovarian function, with changes in its expression during follicular development, luteinization, and atresia [ 37 ]. In porcine OGCs, suppression of BMAL1 promotes apoptosis and affects the expression of progesterone and estradiol [ 12 ]. In mice, although those lacking the BMAL1 can ovulate normally, it has been found that these mice have impaired steroidogenesis, poor luteal formation, reduced progesterone synthesis, and severely affected embryo implantation and development. Boden et al. suggested that exogenous supplementation with progesterone could improve this phenomenon [ 38 , 39 ]. However, one study has suggested that excessive reactive oxygen produced in the ovaries and fallopian tubes decreases fertilization rates, embryonic development, and implantation potential in BMAL1-deficient mice [ 15 ]. In recent years, clinical research has found that the expression of BMAL1 in PCOS patients’ OGCs [ 10 ] and peripheral blood mononuclear cells [ 40 ] are significantly decreased. Our findings align with these observations. In this study, we investigated the mechanism by which BMAL1 is involved in the pathogenesis of PCOS and found that BMAL1 expression is decreased in OGCs of patients with PCOS. In addition, we confirmed through cellular experiments that BMAL1 regulates apoptosis in KGN cells. These results suggest that dysregulation of BMAL1 expression may be a cause of PCOS. As members of the transforming growth factor-beta (TGF-β) superfamily, more than 20 types of BMPs have been identified to date [ 41 ]. Research indicates that BMPs are essential for maintaining fertility in mammals via autocrine and paracrine mechanisms [ 42 ]. BMP6, a member of the BMP family, has been confirmed to be highly expressed in the ovaries and can regulate follicle development, oocyte maturation, and luteal function in mammals through intercellular communication [ 22 , 43 , 44 ]. Research has found that BMP6 can induce AMH expression in OGCs, indicating that BMP6 is an important medium for supporting the healthy follicle growth [ 45 ]. Furthermore, BMP6 can affect the expression of glial cell-derived neurotrophic factors (GDNF) through the SMAD and ERK1/2 signaling pathways, thereby regulating oocytes maturation [ 46 ]. Research has suggested that the expression of BMP6 is increased in OGCs of patients with PCOS [ 23 , 47 ], which aligns with our preceding study. We demonstrated that BMP6 downregulates the expression of PTX3 in PCOS patients’ OGCs through the SMAD signaling pathway, leading to ovulation disorders [ 48 ]. Considering that BMP6 is abundant in OGCs of antral follicles in the human ovary but not in atretic follicles, the high expression of BMP6 in OGCs of patients with PCOS may indicate a disruption in follicle development [ 45 ], suggesting that the dysregulation of BMP6 expression may be correlated with the occurrence of PCOS. Recent research has revealed that BMAL1 not only directly participates in and regulates the expression of clock genes but also functions as a transcription factor, binding to the promoter regions of certain genes to modulate their expression. Li et al. [ 49 ] found that BMAL1 can bind to the promoter of the B-cell lymphoma 2 gene/adenovirus E1B 19,000-interacting protein 3 (BNIP3) gene. By controlling the expression of BNIP3, BMAL1 affects mitochondrial function, leading to a significant decrease in mitochondrial oxidative phosphorylation and ultimately causing myocardial cell dysfunction. Moreover, it has been found that BMAL1 can bind to the promoters of NRF2 [ 50 ], BCL-2 [ 51 ], WEE1 [ 52 ], CCNA1, and CDK1 [ 53 ] to directly regulate their expression levels, leading to abnormalities in cellular functions such as autophagy, apoptosis, and the cell cycle. However, the regulatory relationship between BMAL1 and BMP6 remains unclear. Tasaki et al. [ 25 ] found that in endometrial stromal cells transfected with si-BMAL1, the expression of BMP2 and BMP6 was upregulated, while that of BMP1, BMP7, and BMP8a remained unaffected. In our study, low levels of BMAL1 mRNA in patients with PCOS were negatively correlated with BMP6 expression. Our cellular experiments also confirmed that BMAL1 knockdown in KGN cells upregulated the expression of BMP6. Therefore, we speculate that there may be an interaction between BMAL1 and BMP6 in OGCs of patients with PCOS, which may result in a decline in oocyte quality and embryonic developmental potential. In order to further clarify the regulatory relationship between BMAL1 and BMP6, we predicted transcription factor binding sites and used a dual-luciferase reporter gene assay for verification. We found that BMP6 is a direct target of BMAL1. CCK-8 and flow cytometry results also indicated that BMAL1 regulates the proliferation and apoptosis of OGCs by targeting BMP6. Although PCOS patients have greater reproductive potential due to their superior number of follicles, female fertility is determined by a variety of factors. It remains unclear whether this advantage in follicle quantity can translate into better clinical outcomes. This highlights the complexity of the pathophysiology of PCOS, where factors such as high androgen levels, endometrial abnormalities, and luteal insufficiency interact with each other, collectively impacting pregnancy outcomes, including reducing pregnancy rates and increasing the risk of miscarriage. BMAL1 and BMP6 play significant roles in follicular development, ovarian steroidogenesis, and ovulation. The study has indicated that in Bmal1 gene knockout mice, there is a notable reduction in the number of ovarian corpora lutea, impaired progesterone production, and affected embryo implantation and development [ 39 ]. This suggests that BMAL1 is crucial for luteal function, and its dysregulation may lead to luteal insufficiency, impacting female ovarian function. In human ovary, BMP6 has been found to be upregulated in regressing corpora lutea and is involved in the regulation of luteolysis [ 54 ]. The study has shown that BMP6 increases the expression of CD68 by upregulating connective tissue growth factor (CTGF), playing an important role in the development of human ovarian corpora lutea [ 55 ]. In light of these findings, further studies are warranted to explore the precise roles of BMAL1 and BMP6 in PCOS. Such research may reveal novel molecular mechanisms underlying the disease and provide new avenues for therapeutic strategies to improve pregnancy outcomes in PCOS patients. This study provides a novel mechanism for the pathogenesis of PCOS that could guide future therapeutic approaches for patients with this condition. However, there are some limitations of this study. First, it only conducted in vitro experiments without in vivo animal studies to further confirm the findings. Second, the study involved a small number of patient samples and examined the expression of relevant factors in OGCs after pharmacological ovarian stimulation, which may influence the relationship between BMAL1, BMP6, and PCOS. In conclusion, our findings suggest that the downregulation of BMAL1 may lead to the upregulation of BMP6, thereby participating in the pathogenesis of PCOS. Furthermore, our experimental results indicate that BMAL1 and BMP6 are potential diagnostic markers and therapeutic targets for PCOS.

Introduction

Polycystic ovary syndrome (PCOS) is a disease of reproductive endocrine and metabolic disorder characterized by ovulatory dysfunction, polycystic ovary morphology, hyperandrogenism, and/or hyperandrogenemia [ 1 , 2 ]. Its complex pathogenesis involves environmental, genetic, immune, and endocrine factors [ 3 ]. PCOS affects approximately 5–10% of women of reproductive age and is one of the leading causes of infertility [ 4 ]. Although assisted reproductive technology (ART), including in vitro fertilization (IVF) and intracytoplasmic sperm injection-embryo transfer (ICSI), has become an effective treatment strategy for PCOS, the diminished quality of oocytes and the reduced embryonic development potential of patients with PCOS remain key factors contributing to unsatisfactory pregnancy and live birth outcomes [ 5 – 7 ]. As a core component of biological clock genes, Brain and Muscle Arnt-Like Protein 1 (BMAL1) can regulate female reproductive function at multiple levels of the hypothalamic-pituitary–gonadal axis and affect the synthesis and release of sex hormones, follicle growth and development, ovulation, and other physiological activities [ 8 – 11 ]. In ovarian granulosa cells (OGCs), BMAL1 knockdown reduces the expression of sex hormone receptor and key enzymes related to hormone production [ 10 – 12 ]. In female mice, the absence of BMAL1 can affect the estrous cycle and ovarian morphology; causes ovulation disorder; and reduces the fertilization rate of oocytes, early embryonic development, and implantation potential [ 13 – 15 ]. Ono et al. [ 16 ] reported that BMAL1 deficiency impairs placental vascular formation, preventing pregnancy maintenance after embryo transfer. Additionally, one study found that the BMAL1 expression in the endometrial tissue of patients with recurrent spontaneous abortion (RSA) was significantly decreased [ 17 ]. Bone Morphogenetic Protein 6 (BMP6) is expressed in both oocytes and GCs of mammals. It is a crucial intraovarian regulatory factor that maintains normal follicular growth and is indispensable to female reproductive health [ 18 ]. Studies have shown that mice with a deficiency in BMP6 can reduce ovulation, decrease embryonic developmental capabilities, and lead to a lower average number of offspring [ 19 ]. In caprine OGCs, BMP6 promotes the secretion of estradiol, progesterone, and anti-Müllerian hormone [ 20 , 21 ], thereby regulating the development of OGCs and follicles. Liu et al. [ 22 ] discovered an inverse association between BMP6 levels in OGCs and the oocyte maturity, implying that BMP6 might be utilized as a biological indicator of oocyte development. Additionally, clinical research has shown that abnormalities in BMP6 expression are associated with PCOS [ 23 ] and endometriosis [ 24 ]. Emerging evidence suggests that BMP gene promoters contain regulatory sites influenced by clock genes [ 25 ]. However, it remains uncharted territory that whether BMAL1 hinders the reproductive capabilities in patients with PCOS by affecting BMP6 expression. Therefore, this study aims to elucidate the correlation between BMAL1 and BMP6 in PCOS by clinical observations and cell experiments. We aim to understand the etiopathogenesis of PCOS and identify novel treatment targets by clarifying the molecular mechanism through which BMAL1 influences BMP6 expression in OGCs.

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: pmc-nxml

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-09-20T09:27:46.357103+00:00
unpaywall
last seen: 2026-05-21T05:10:58.409756+00:00
License: CC-BY-NC-ND-4.0