Follicular fluid-derived extracellular vesicles miR-34a-5p regulates granulosa cell glycolysis in polycystic ovary syndrome by targeting LDHA.

OA: gold CC-BY-NC-ND-4.0

Abstract

BackgroundPolycystic ovary syndrome (PCOS) is highly prevalent in women of reproductive age worldwide, exhibits highly heterogeneous clinical presentation and biochemical parameters, and has no cure. This study aimed to investigate the role of miR-34a-5p in PCOS, its effect on glycolysis in granulosa cells (GCs), and its potential contribution to follicular dysregulation.MethodsHerein, Follicular follicular fluid (FF) samples were collected from six patients with PCOS and six healthy controls undergoing in vitro fertilization-embryo transfer. The isolated extracellular vesicles were characterized by transmission electron microscopy, nanoparticle tracking analysis, and western blotting. Additionally, miRNA sequencing was performed to identify differentially expressed microRNAs, and their functions were analyzed through transcriptomics. The In vitro effects of miR-34a-5p on glycolysis, cell proliferation, and apoptosis were assessed in human ovarian granulosa tumour cell line (KGN cells). Targets of miR-34a-5p were identified by dual-luciferase reporter assays, and quantitative real-time polymerase chain reaction and western blotting were performed to determine gene and protein expression.ResultsThe level of miR-34a-5p in FF-derived extracellular vesicles derived from patients with PCOS was significantly higher than that of the control group. Transcriptomic analysis highlighted miR-34a-5p as a key regulator of glycolysis and apoptosis. Furthermore, in vitro analysis showed that miR-34a-5p targeted lactate dehydrogenase A (LDHA), inhibited glycolysis, reduced energy supply to GCs, and promoted apoptosis of KGN cells. Conversely, miR-34a-5p inhibition restored glycolysis function and cell viability.ConclusionThe findings of this study show that miR-34a-5p mediates GC apoptosis in PCOS by targeting LDHA and inhibiting glycolysis, suggesting its crucial role in PCOS pathophysiology, and offering potential therapeutic targets for improving follicular development and fertility outcomes in patients with PCOS. Further research is needed to explore the clinical implications of miR-34a-5p and its use as a biomarker for early diagnosis and prognosis of PCOS.
Full text 36,581 characters · extracted from pmc-nxml · 6 sections · click to expand

Results

The FF-derived extracellular vesicles were characterized by TEM, NTA, and western blotting. TEM and NTA results revealed that the extracellular vesicles were disc-shaped (diameter: 100–150 nm, structurally intact and of high purity) with well-defined margins and light staining in the center (Fig.  1 A), which is consistent with the results of previous studies [ 24 , 25 ]. Furthermore, the extracellular vesicle-specific markers, namely CD9 and CD63 were detected by western blotting in FF samples (Fig.  1 B). Quantitative analysis showed no significant difference in the extracellular vesicle content or their particle diameters between the control and PCOS groups. NTA revealed the presence of only exosomal vesicles in the field of view, with no contamination from other proteins (Fig.  1 C). The extracellular vesicle content was approximately 7 × 10 10 particles/mL (Fig.  1 D). The particle diameters predominantly ranged between 130 and 140 nm, displaying a normal distribution(Fig.  1 E). Fig. 1 Characterization of extracellular vesicles extracted from FF patients in the Control and PCOS groups. A TEM image of isolated extracellular vesicles. B Western blotting of extracellular vesicle surface markers CD9 and CD63. C NTA vision map. D Extracellular vesicle concentration in FF (the number of particles per milliliter of FF). E Particle diameter of FF extracellular vesicles (diameter/nm) Characterization of extracellular vesicles extracted from FF patients in the Control and PCOS groups. A TEM image of isolated extracellular vesicles. B Western blotting of extracellular vesicle surface markers CD9 and CD63. C NTA vision map. D Extracellular vesicle concentration in FF (the number of particles per milliliter of FF). E Particle diameter of FF extracellular vesicles (diameter/nm) The transcriptomic differences in FF-derived extracellular vesicles between the control and PCOS groups were significant, and the principal component analysis plot (Fig.  2 A) showed significant differences in genes between the two groups. In total, 64 differentially expressed miRNAs were identified between the two groups, with 21 miRNAs being upregulated and 43 miRNAs being downregulated in the PCOS group compared with that in the control group (Fig.  2 B). To verify the reliability of the miRNA-seq data, 10 miRNAs were randomly selected for qPCR analysis. Notably, the correlation coefficient of gene expression folding changes between miRNA-seq and RNA-qPCR results was high ( R  = 0.7950, P  = 0.006), indicating the good reliability of the miRNA-seq data (Fig.  2 C). Next, the differentially expressed miRNAs were clustered for analysis (Fig.  2 D), and miR-34a-5p was found to be significantly upregulated in the PCOS group. Notably, miR34a-5p upregulation has been reported to negatively regulate LDHA in various cells and tissues [ 26 , 27 ]. The functional GO and KEGG enrichment analyses (Fig.  2 E) revealed that compared with the control group, the regulation of apoptosis, such as positive regulation of neuronal apoptosis, B-cell apoptosis, and apoptotic mitochondrial changes by extracellular vesicle miRNAs was significantly increased in the PCOS group. In contrast, the glycolysis- and energy metabolism-related processes, such as glycogen granule, glycogen biosynthesis regulation, and glycogen catabolism regulation were significantly decreased. Additionally, the KEGG pathway analysis showed that differential miRNAs were significantly downregulated in pathways such as glycolytic gluconeogenesis and glycogenolysis. Fig. 2 Transcriptomic analysis of follicular fluid extracellular vesicles in the PCOS and Control groups. A PCA analysis was performed for all miRNAs expressed in the follicular fluid extracellular vesicles, with each data point representing one sample. B Volcano map of differentially expressed miRNA. C Correlation between changes in the expression of miRNA-seq (Y-axis) and qPCR (X-axis). D Heat maps of differentially expressed miRNAs. The color indicates relative abundance: red indicates increased levels and blue indicates decreased levels. E GO (gene ontology) analysis and KEGG enrichment analysis of miRNAs with different expressions. The color of the dots indicates upregulation or downregulation, and the size of the dots indicates the number of genes Transcriptomic analysis of follicular fluid extracellular vesicles in the PCOS and Control groups. A PCA analysis was performed for all miRNAs expressed in the follicular fluid extracellular vesicles, with each data point representing one sample. B Volcano map of differentially expressed miRNA. C Correlation between changes in the expression of miRNA-seq (Y-axis) and qPCR (X-axis). D Heat maps of differentially expressed miRNAs. The color indicates relative abundance: red indicates increased levels and blue indicates decreased levels. E GO (gene ontology) analysis and KEGG enrichment analysis of miRNAs with different expressions. The color of the dots indicates upregulation or downregulation, and the size of the dots indicates the number of genes The miRNA-seq analysis revealed that the expression of miR-34a-5p counts per million (CPM) readings of FF-derived extracellular vesicles was upregulated in the PCOS group compared with that in the control group (Fig.  3 A). The qPCR results confirmed that the upregulation of FF-derived miR-34a-5p was significant in the PCOS group compared with that in the control group (Fig.  3 B), whereas that of the key glycolytic enzyme LDHA was significantly lower than that in the control group (Fig.  3 C). Furthermore, miR-34a-5p expression was negatively correlated with LDHA expression (Fig.  3 D). To investigate the molecular mechanisms underlying miR-34a-mediated proliferation and apoptosis of GCs in PCOS, miR-34a-5p ability to regulate glucose metabolism, and thus, affect proliferation and apoptosis of GCs, was investigated by targeting the rate-limiting enzyme of glycolysis in FF. First, the potential targets of miR-34a-5p and LDHA were identified utilizing miRBD ( http://mirdb.org/ ) and TargetScan ( http://www.targetscan.org/vert_71/ ) (Fig.  3 E). To assess the LDHA-targeting ability of miR-34a-5p, wild-type (WT) and mutant (MUT) vectors were constructed for the luciferase reporter gene assays (Fig.  3 F) and co-transfected with the miRNA into KGN cells. Notably, miR-34a-5p was directly and specifically bound to the predicted binding site in the LDHA 3’UTR in KGN cells and inhibited the luciferase activity of WT 3’UTR of LDHA (Fig.  3 G). Fig. 3 LDHA in follicular fluid extracellular vesicles is a direct target of miR-34a-5p. A  The expression of miR-34a-5p in extracellular vesicles was analyzed by miRNA-seq.  B  The expression of miR-34a-5p in the follicular fluid extracellular vesicles was analyzed by qPCR. C The expression of LDHA in the follicular fluid extracellular vesicles was analyzed by qPCR. D  Correlation between LDHA (Y-axis) and miR-34a-5p (X-axis) expression changes in the follicular fluid extracellular vesicles. E  miR-34a-5p regulates the LDHA expression by binding to the 3’-UTR of LDHA mRNA. G: The inhibition rate of miR-34a-5p on the LDHA luciferase activity (** p  < 0.01) LDHA in follicular fluid extracellular vesicles is a direct target of miR-34a-5p. A  The expression of miR-34a-5p in extracellular vesicles was analyzed by miRNA-seq.  B  The expression of miR-34a-5p in the follicular fluid extracellular vesicles was analyzed by qPCR. C The expression of LDHA in the follicular fluid extracellular vesicles was analyzed by qPCR. D  Correlation between LDHA (Y-axis) and miR-34a-5p (X-axis) expression changes in the follicular fluid extracellular vesicles. E  miR-34a-5p regulates the LDHA expression by binding to the 3’-UTR of LDHA mRNA. G: The inhibition rate of miR-34a-5p on the LDHA luciferase activity (** p  < 0.01) Herein, KGN cells were treated with different concentrations of testosterone (200, 400, 600, 800, and 1,000 nM) to simulate the in vitro cell model of PCOS. Cell viability results measured by the CCK-8 assay showed that > 400 nM testosterone significantly reduced cell viability compared with that in the control group (Fig.  4 A). Therefore, 400 nM testosterone near half-maximal inhibitory concentration was selected to treat KGN cells, and for subsequent experiments. The qPCR results confirmed that miR-34a-5p expression in KGN cells cultured with 400 nM testosterone (PCOS group) was higher than that in cells cultured in normal full media (Fig.  4 B). The effects of miR-34a-5p on the glycolysis in KGN cells was investigated by transfecting miR-34a-5p mimics into the control medium and detecting the changes in the expression of glycolysis-related enzymes. Notably, miR-34a-5p overexpression significantly downregulated the expression of LDHA, HK2, and PKM2 compared with that in the control group (Fig.  4 C). To investigate if miR-34a-5p inhibition can improve glycolysis in PCOS environment, miR-34a-5p inhibitor was transfected into the PCOS group medium supplemented with testosterone (miR-34a-5p inhibitor group). Notably, miR-34a-5p deletion could upregulate the expression of LDHA, HK2, and PKM2 in the PCOS group (Fig.  4 D). Additionally, the evaluation of pyruvate-to-lactic acid conversion, a key step in glycolysis, revealed that miR-34a-5p overexpression significantly inhibited the pyruvate-to-lactic acid conversion compared with that in the control group, whereas miR-34a-5p inhibition reversed this process (Fig.  4 E and F). Similarly, the protein levels of key glycolytic enzymes such as LDHA, HK2, and PKM2 (Fig.  4 G–I) were significantly downregulated in miR-34a-5p-overexpressing KGN cells. Overall, these results suggest that miR-34a-5P inhibits glucose metabolism in KGN cells. Fig. 4 Effects of miR-34a-5p on glycolysis in PCOS cell models. The effect of testosterone treatment on KGN cell viability. B qRT-PCR analysis of the miR-34a-5p expression in KGN cells. C qRT-PCR analysis of the expression of key enzymes of glycolysis (HK2, PKM2, LDHA) in a cell model under a control environment. D qRT-PCR analysis of the expression of key enzymes of glycolysis (HK2, PKM2, LDHA) in cell models under “+ testosterone” environment. E Concentration of pyruvate in KGN cell culture medium. F Concentration of lactic acid in KGN cell culture medium. G  Western blotting of LDHA in KGN cells. H Western blotting of HK2 in KGN cells. I Western blotting of PKM2 in KGN cells. * p  < 0.05, ** p  < 0.01 Effects of miR-34a-5p on glycolysis in PCOS cell models. The effect of testosterone treatment on KGN cell viability. B qRT-PCR analysis of the miR-34a-5p expression in KGN cells. C qRT-PCR analysis of the expression of key enzymes of glycolysis (HK2, PKM2, LDHA) in a cell model under a control environment. D qRT-PCR analysis of the expression of key enzymes of glycolysis (HK2, PKM2, LDHA) in cell models under “+ testosterone” environment. E Concentration of pyruvate in KGN cell culture medium. F Concentration of lactic acid in KGN cell culture medium. G  Western blotting of LDHA in KGN cells. H Western blotting of HK2 in KGN cells. I Western blotting of PKM2 in KGN cells. * p  < 0.05, ** p  < 0.01 Changes in the apoptosis factors of different groups were assessed to verify the effects of miR-34a-5p on the proliferation and apoptosis of GCs via the inhibition of cellular glucose metabolism. Compared with the control group, the mRNA and protein expression of apoptotic factors BAX and Caspase-3 in the miR-34a-5p-overexpressing group were significantly increased, whereas compared with the PCOS group, their expression was inhibited in the miR-34a-5p inhibitor group (Fig.  5 A, C, D, and F). In contrast, the expression of anti-apoptotic factor BCL-2 showed an opposite trend in different groups (Fig.  5 B and E). Flow cytometry analysis of apoptosis in KGN cells revealed that compared with the control group, miR-34a-5p overexpression increased the number of late and total apoptotic cells. In contrast, compared with the PCOS group, apoptosis induction of KGN cells was inhibited in the miR-34a-5p inhibitor group (Fig.  5 G). The results of the CCK-8 assay showed that the proliferative activity of KGN cells in the miR-34a-5p-overexpressing group was significantly lower than that in the control group, whereas that in the miR-34a-5p inhibitor group was higher than that in the PCOS group (Fig.  5 H). Altogether, these results indicate that when glycolysis was inhibited, the proliferation activity of KGN cells decreased and apoptosis increased. Fig. 5 Effects of miR-34a-5p inhibition of glycolysis on KGN cell viability and apoptosis. A qRT-PCR analysis of the mRNA expression of BAX in KGN cells. B qRT-PCR analysis of the mRNA expression of BCL-2 in KGN cells. C qRT-PCR analysis of the mRNA expression of Caspase-3 in KGN cells. D Western blotting of BAX in KGN cells. E Western blotting of BCL-2 in KGN cells. F Western blotting of Caspase-3 in KGN cells. G Flow cytometry assay displayed the apoptosis level in four groups. H Proliferative viability of the four groups of cells was detected by CCK-8 assay. * p  < 0.05, ** p  < 0.01 Effects of miR-34a-5p inhibition of glycolysis on KGN cell viability and apoptosis. A qRT-PCR analysis of the mRNA expression of BAX in KGN cells. B qRT-PCR analysis of the mRNA expression of BCL-2 in KGN cells. C qRT-PCR analysis of the mRNA expression of Caspase-3 in KGN cells. D Western blotting of BAX in KGN cells. E Western blotting of BCL-2 in KGN cells. F Western blotting of Caspase-3 in KGN cells. G Flow cytometry assay displayed the apoptosis level in four groups. H Proliferative viability of the four groups of cells was detected by CCK-8 assay. * p  < 0.05, ** p  < 0.01

Conclusion

Altogether, the findings of this study provide valuable insights into the molecular mechanisms underlying PCOS, highlighting the pivotal role of miR-34a-5p in regulating glycolysis and apoptosis in GCs. Furthermore, miR-34a-5p upregulation and its inhibitory effect on LDHA suggest that it is a key factor in PCOS-associated metabolic dysregulation. This study suggests targeting miR-34a-5p may offer a novel therapeutic approach to restore normal glycolytic function and improve follicular development in patients with PCOS. These findings provide a basis for further research into miRNA-mediated regulatory pathways and their potential as therapeutic targets in PCOS. Future studies need to focus on exploring the therapeutic efficacy of miR-34a-5p inhibitors and other related miRNAs to develop targeted treatments for PCOS and improve ovarian function and overall reproductive health in affected individuals.

Discussion

Herein, FF-derived extracellular vesicles of both the control and PCOS groups were thoroughly characterized by TEM, NTA, and western blotting. The extracellular vesicles exhibited typical morphology, including well-defined, disc-shaped vesicles with diameters ranging from 100 to 150 nm, along with being structurally intact and of high purity. The presence of specific extracellular vesicle markers, namely CD9 and CD63 [ 28 ], was confirmed through western blotting and further validated the successful isolation of extracellular vesicles from the FF samples. Quantitative analysis showed no significant differences in either the concentration or particle diameters of extracellular vesicles between the control and PCOS groups, thus, establishing a reliable foundation for subsequent functional analyses. Extracellular vesicles have abundant miRNAs and biomolecules, which mediate different cellular functions via intercellular transfer [ 29 , 30 ]. Advances in therapies and inhibitors based on extracellular vesicle miRNA [ 31 – 33 ] underscore the urgent need to elucidate FF-derived miRNA-mediated regulation of PCOS. Reportedly, miRNAs regulate glycolysis via the Warburg effect in cells by modulating key enzymes such as HK2, PKM2, and LDHA [ 26 , 34 , 35 ]. Herein, miR-34a-5p in extracellular vesicles suppressed the glycolysis in KGN cells by silencing crucial enzymes, thereby reducing the overall glycolytic activity. Reduced ATP production during glycolysis impedes the energy supply for follicular development, which is a key factor in PCOS-associated follicular dysplasia. Although KGN cells are a robust model for investigating the molecular mechanisms of miR-34a-5p, primary human GCs or in vivo studies are needed to validate the effects of miR-34a-5p in a more physiologically relevant context in future investigations. The lactate level, a glycolysis metabolite, is widely used as a marker to assess the Warburg effect in cells [ 36 , 37 ]. Reportedly, both pyruvic acid and lactic acid play crucial roles in supporting follicular growth and development. Harris et al. observed a high pyruvate demand in the follicles of patients with PCOS for their growth compared with those in women without PCOS [ 38 , 39 ]. Additionally, metabolomic studies in a rat model of PCOS confirmed pyruvate accumulation and reduced lactate levels in the culture medium of the PCOS group [ 40 ]. Herein, transcriptomic analysis revealed marked differences in miRNA expression profiles between the control and PCOS groups, identifying 64 differentially expressed miRNAs. Notably, miR-34a-5p was significantly upregulated in the PCOS group and negatively correlated with LDHA expression, suggesting its crucial role in the disrupted energy metabolism observed in GCs. Herein, miR-34a-5p inhibited glycolysis in KGN cells, leading to lower lactate levels, thereby reducing the environmental stimulation necessary for follicular development; this phenomenon was regarded as the second factor of follicular dysplasia in patients with PCOS. Apoptosis of GCs is recognized as the primary mechanism of follicular atresia [ 41 ]. The results of this study showed that upregulation of FF-derived miR-34a-5p expression was associated with both glycolysis inhibition and increased GC apoptosis in the PCOS cell model. However, the exact relationship between these changes and PCOS-associated follicular dysplasia development could not be elucidated and needs further investigation. Future research needs to focus on elucidating the biological functions of glycolysis-related mediators, apoptosis, and their potential roles in follicular dysplasia in patients with PCOS. Due to the small sample size, the majority of the genes did not remain significant after FDR adjustment. We recognize that this is a limitation of our study, as the low statistical power likely impacted the ability to detect significant results after correction. in spite of this, the miRNA-seq findings were validated through qPCR. Notably, in clinical samples of extracellular vesicles, miR-34a-5p expression in the PCOS group was more than two times higher than that in the control group, indicating strong inhibition of glycolysis in the patients with PCOS. Additionally, luciferase reporter assays showed that miR-34a-5p directly targeted the LDHA gene, further validating its role in glycolysis regulation. KEGG and GO enrichment analyses provided further insights into the functional implications of the identified differentially expressed miRNAs. Herein, miRNAs in the extracellular vesicles of the PCOS group considerably affected apoptosis and metabolic pathways. Specifically, the regulation of apoptosis was increased, and glycolytic activity decreased, indicating a higher propensity for cell death and impaired energy metabolism in PCOS. Altogether, these findings contribute to our understanding of the pathophysiology of PCOS. Subsequent in vitro analysis of the PCOS cell model, testosterone-treated KGN cells, indicated that miR-34a-5p overexpression inhibited glycolysis by downregulating LDHA and other key glycolytic enzymes, such as HK2 and PKM2. Conversely, inhibiting miR-34a-5p in the PCOS environment restored the glycolytic function, underscoring the therapeutic potential of miR-34a-5p. Reportedly, miR-34a-5p can negatively regulate glycolysis by targeting LDHA in various cells such as liver cancer cells [ 42 ] and cervical cancer cells [ 43 ]. This regulatory mechanism was consistent with the mechanism found in KGN cells. Herein, upregulating miR-34a-5p expression reduced glycolysis in KGN cells and indirectly promoted cell apoptosis. Conversely, inhibiting miR-34a-5p in the PCOS environment significantly enhanced glycolysis and proliferation of KGN cells, elucidating the role of miR-34a-5p in extracellular vesicles in regulating glycolysis-mediated GC dysplasia and offering a new strategy for the alleviation of PCOS. These findings suggest that clinical detection of miR-34a-5p levels may be used for early prediction of PCOS.

Introduction

Polycystic ovary syndrome (PCOS) is an endocrine disorder with a widespread prevalence in women of reproductive age, and it is mainly characterized by excessive androgen secretion, ovulatory dysfunction, and the presence of polycystic ovaries [ 1 , 2 ]. Furthermore, PCOS increases the risk of complications such as cardiovascular disease [ 3 ], type 2 diabetes mellitus [ 4 ], metabolic syndrome [ 5 ], depression, and anxiety [ 6 ]. Reportedly, low reproductive fertility, infertility, and pregnancy complications have been associated with PCOS [ 7 ]. Follicular dysplasia is an important cause of infertility in patients with PCOS, and improving follicular dysplasia is one of the most important strategies for preventing and treating PCOS. Adequate energy supply, primarily met through glycolysis, is critical for follicular development in the ovaries [ 8 ], and granulosa cells (GCs) within the ovarian follicles heavily rely on glycolytic metabolism for their rapid proliferation and function [ 9 ]. Energy requirements of various cellular processes, including the synthesis of nucleotides, amino acids, and lipids necessary for cell growth and division, are met by glycolysis, in which glucose is converted to pyruvate [ 10 ]. Notably, in GCs, glycolysis facilitates redox balance maintenance and provides intermediates for the tricarboxylic acid cycle [ 11 ]. Insufficient glycolytic activity in GCs can increase apoptosis through various mechanisms, including pro-apoptotic protein activation and reactive oxygen species generation, thereby impairing normal follicular development and promoting PCOS development through anovulation and the formation of cystic follicles [ 12 – 15 ]. Follicular development can be denoted by analyzing follicular fluid (FF), which surrounds the oocyte within the follicle. FF contains various biomolecules, including hormones, cytokines, growth factors, and extracellular vesicles, facilitating the creation of an optimal environment for oocyte maturation [ 16 ]. Notably, changes in FF composition have been associated with follicular dysplasia and reproductive dysfunction in PCOS. Moreover, microRNAs (miRNAs) found in FF-derived extracellular vesicles have emerged as important regulators of intercellular communication within the follicle [ 17 , 18 ]. GCs and other follicular cells secrete these extracellular vesicles to transfer miRNAs to target cells, where they regulate gene expression and cellular functions. Reportedly, dysregulated miRNA expression in FF has been implicated in PCOS pathophysiology, potentially affecting key processes such as glycolysis and GC function [ 19 , 20 ]. KGN cells, a reliable in vitro model and human granulosa-like tumor cell line that closely mimics the characteristics of primary GCs, are often used to study disrupted metabolic pathways, including glycolysis, and explore the cellular and molecular mechanisms underlying follicular dysplasia and GC dysfunction in PCOS [ 9 ]. Furthermore, they are used in investigating the effects of FF-derived extracellular vesicle miRNAs on GC function, offering insights into disease development owing to altered cellular communication within the follicle [ 21 , 22 ]. The interaction between FF-derived extracellular vesicle miRNAs and GC metabolism needs to be elucidated, especially their effects on glycolysis, to potentially establish new biomarkers and therapeutic targets for managing PCOS-related infertility. Hence, this study aimed to elucidate the mechanisms underlying the contribution of glycolysis and miRNA-mediated communication in GCs to follicular dysplasia in PCOS. The findings of this study may identify key molecular pathways involved and potential biomarkers for early detection and novel therapeutic targets for improving fertility outcomes in patients with PCOS.

Materials|Methods

Clinical samples of FF were obtained from six patients with PCOS and six healthy individuals with normal ovarian function who were undergoing in vitro fertilization-embryo transfer in the Department of Reproductive Medicine. The PCOS group was subgrouped using the Rotterdam Consensus (2003) [ 23 ]. The exclusion criteria for both groups were as follows: age > 35 years; a history of ovarian surgery or treatment with radiation and chemotherapy, endometriosis, hyperprolactinemia, thyroid disorders, genetic abnormalities, congenital adrenal hyperplasia, Cushing’s syndrome, androgen-producing tumors, and other conditions that might affect follicular development; and patients who consumed drugs affecting hormone levels or glucolipid metabolism within 6 months before treatment. All analyses involving human samples were approved by the Clinical Ethics Review Committee of the Affiliated Hospital of Guilin Medical College. All methods were performed per the relevant guidelines and standardized methodology. All participants provided signed informed consent. All patients were treated for controlled ovarian hyperstimulation. Herein, 36 h after the injection of human chorionic gonadotropin (hCG 2000 U, Lizong Medicine Factory, Zhuhai, China), FF was collected by transvaginal ultrasound-guided aspiration of follicles (bilateral diameter > 14 mm). The FF was centrifuged at 1500 × g for 15 min, and the supernatant (16 mL) was extracted by ultracentrifugation per the instructions of the Qiagen exoEasy Maxi kit (Qiagen, Hilden, Germany). Extracellular vesicle-specific antibodies, namely cluster of differentiation (CD)63(# R23327 , 1:1,000 dilution; ZenBio, China) and CD9 (#ab92726, 1:1,000 dilution; Abcam USA) were used to detect the presence of extracellular vesicles by western blotting. Transmission electron microscopy (TEM) and nanoparticle tracking analysis (NTA) of extracellular vesicles were performed at QIAGEN (Suzhou) Translational Medicine Co. Ltd. Particle size and the concentration of extracellular vesicles were analyzed through NTA. Brownian motion trajectories of extracellular vesicles were observed using the Nanosight NS300, and the diameter of extracellular vesicles was measured in NTA2.1 using Zetaview. The parameters in Naonosight were set as follows: laser type, blue laser (488 nm); particle size range, 10–1,000 nm; recommended concentration range, 10 6 –10 9 particles/mL; video capture settings, sCMOS camera, 25 frames per second, 45-second video capture; measurement duration, five measurements; and optical settings, sensitivity threshold set at 5. The parameters in ZetaView were set as follows: sensitivity, 70; shutter, 70; minimum brightness, 20; maximum area, 1,000; and minimum area, 5. For TEM, tweezers were used to hold the edge of the copper grid, paying attention to distinguish the front and back sides. The front side of the grid was coated with a carbon film, and the sample was added, namely 10 µL of extracellular vesicles, which was then allowed to settle for 1–2 min. Next, filter paper was used to remove the excess liquid, and 10 µL of 5% phosphotungstic acid solution was applied for negative staining of the sample for 1–2 min. After absorbing the excess liquid using filter paper, the grid was air-dried at room temperature for approximately 10 min and TEM imaging was performed at 100 kV (JEOL, Tokyo, Japan). miRNA sequencing (miRNA-seq) analysis of FF extracellular vesicle samples was performed by Aksomics (Shanghai, China). Total RNA was extracted with TRIzol reagent (Invitrogen, Carlsbad, CA, USA), and its quality was assessed by agarose gel electrophoresis. After measuring the RNA concentration using a NanoDrop ND-1000 spectrophotometer, a total of 1,000 ng of total RNA was used to enrich small RNAs using the NEBNext ® Poly(A) mRNA Magnetic Isolation Module (New England Biolabs) and the RiboZero Magnetic Gold Kit (Human/Mouse/Rat) (Epicentre, an Illumina Company). Next, the enriched small RNAs were used to construct small RNA libraries with the NEBNext Multiplex Small RNA Sample Prep Set for Illumina (NEB, Cat E7580), and their quality and quantity were evaluated using the Agilent 2100 Bioanalyzer and quantitative real-time polymerase chain reaction (qPCR) analysis. Raw amplification clusters were captured on an Illumina Flow Cell and cycled for sequencing on an Illumina NextSeq 500 Sequencer per the instructions of the manufacturer (miRNA-seq read length was 50 bp; single-ended sequencing). After quality control, intergroup differences were analyzed using EdgeR (R 4.2.3). For clustering analysis, differentially expressed genes were screened based on log2|fold change| ≥ 1 and p-value < 0.05, following which, the Database for Annotation, Visualization, and Integrative Discovery v6.7 was utilized to perform Gene Ontology (GO) term and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis. The KGN cell line was obtained from Wuhan Punosai Life Science and Technology Co. It was cultured as the in vitro cellular model of PCOS in Dulbecco’s modified Eagle medium (DMEM)/F12 supplemented with 10% fetal bovine serum and 400 nM testosterone (#M6105, AbMole BioScience, Houston, USA) at 37 °C and 5% CO 2 under humid conditions. After reaching 60–70% confluence, the cells were transiently transfected with 50 nM miR-34a-5p mimic, mimic negative control (NC), 100 nM miR-34a-5p inhibitor, and inhibitor NC using the riboFECT CP Transfection Kit (#C10511-05, RiboBio, Guangzhou, China) per the instructions of the manufacturer (RiboBio). At 24 h post-transfection, KGN cell messenger RNA (mRNA) was extracted for qPCR to verify the transfection effect. All operations are performed in a sterile environment and cells are regularly monitored for signs of bacterial or fungal contamination through microscopic examination and evaluation of cell morphology. KGN cells were inoculated in 24-well plates and incubated for 24 h to achieve 60–70% fusion. Wild-type (WT) or mutant (MUT) mRNA fragments were then constructed in advance and inserted downstream of the psiCheck2 luciferase reporter gene. miR-34a-5p mimic (50 nM) and psiCHECK2 - LDHA- 3’UTR-WT (15 mg/L) or psiCHECK2 - LDHA − 3’UT R- MUT (15 mg/L) were co-transfected into KGN cells. After 36 h, the luciferase activities of the firefly and Renilla were detected by using the Dual-Luciferase Reporter Assay System (#E1910, Promega), and the relative luciferase activity was calculated by normalizing the Renilla luciferase activity to the firefly luciferase activity. Cell proliferation assays were performed according to the instructions of Cell Counting Kit-8 (#BS350A, Biosharp). KGN cells were spread in a 96-well plate at a concentration of 5000 cells/well and incubated in a 37 °C, 5% CO 2 cell culture incubator for 24 h. Then, 10 µL of the Cell Counting Kit-8 (CCK-8) solution was added to each well, and the cells were further incubated with CCK8 for another hour. Finally, the absorbance at 450 nm was measured using a microplate reader. After 24 h of pretreatment, the cells were collected and diluted to a density of 1 × 10 5 and resuspended in binding buffer (10X Annexin v Binding Buffer: 0.1 M Hepes/NaOH (pH 7.4), 1.4 M NaCl, 25 mM CaCl 2 . For a 1X working solution, dilute 1 part of the 10X Annexin V Binding Buffer to 9 parts of distilled water). FITC Annexin V Apoptosis Detection Kit I was used according to the manufacturer’s instructions (BD Biosciences Pharmingen, San Diego, US). Fluorescence signals were sorted using a flow cytometer (FACSCalibur, BD Biosciences, USA) and the results were analyzed by using FlowJo software. Total RNA was extracted using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA), and 1 µg of RNA was reverse transcribed into complementary DNA per the instructions of the miRNA 1st Strand cDNA Synthesis Kit (by stem-loop; #MR101-02, Vazyme). For qPCR, miRNA was amplified using miRNA Universal SYBR qPCR Master Mix (#MQ101-02, Vazyme) per the protocol of the manufacturer. The Homo-U6 gene served as the internal reference gene for miR. The cycle threshold values were determined using the 2 −ΔΔCt method. The primer sequences are listed in Table  1 . Table 1 Primers for real-time quantitative PCR Gene 5′–3′ Sequence Homo Caspase-3 F: CAGTGATGCTGTGCTATGAAT R: CAGATGCCTAAGTTCTTCCAC Homo Bax F: GCGACTGATGTCCCTGTCT R: TGAGTGAGGCGGTGAGC Homo Bcl-2 F: CCCTGTGGATGACTGAGTACC R: AGACAGCCAGGAGAAATCAAA Homo HK2 F: CGAGAGCATCCTCCTCAAGTG R: AGCCACAGGTCATCATAGTTCC Homo PKM2 F: TGGGAGAGAAGGGAAAGAACATC R: GCACCGTCCAATCATCATCTTC Homo LDHA F: ATGAGTTGGACTGTGCCTGTTGTG R: GTGAAGAGCCAGGTGCCGTTG Homo GAPDH F: GAGTCCACTGGCGTCTTCAC R: GAGGCATTGCTGATGATCTTGAG hsa-miR-34a-5p stem ring primer F: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACAACC R: AGTGCAGGGTCCGAGGTATT hsa-miR-34a-5p F: CGCTGGCAGTGTCTTAGCT R: AGTGCAGGGTCCGAGGTATT U6 F: GGAACGATACAGAGAAGATTAGC R: TGGAACGCTTCACGAATTTGCG Primers for real-time quantitative PCR F: CAGTGATGCTGTGCTATGAAT R: CAGATGCCTAAGTTCTTCCAC F: GCGACTGATGTCCCTGTCT R: TGAGTGAGGCGGTGAGC F: CCCTGTGGATGACTGAGTACC R: AGACAGCCAGGAGAAATCAAA F: CGAGAGCATCCTCCTCAAGTG R: AGCCACAGGTCATCATAGTTCC F: TGGGAGAGAAGGGAAAGAACATC R: GCACCGTCCAATCATCATCTTC F: ATGAGTTGGACTGTGCCTGTTGTG R: GTGAAGAGCCAGGTGCCGTTG F: GAGTCCACTGGCGTCTTCAC R: GAGGCATTGCTGATGATCTTGAG F: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACAACC R: AGTGCAGGGTCCGAGGTATT F: CGCTGGCAGTGTCTTAGCT R: AGTGCAGGGTCCGAGGTATT F: GGAACGATACAGAGAAGATTAGC R: TGGAACGCTTCACGAATTTGCG Protein samples were extracted using the radioimmunoprecipitation assay lysis buffer (Beyotime, China) containing protease and phosphatase inhibitors. Next, protein concentrations were quantified using the BCA Protein Assay Kit (Solarbio, China). The extracted proteins were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (The 60 V voltage lasts for 50 min, Then adjust the voltage to 120 V and continue electrophoresis for 60 min) and transferred to polyvinylidene fluoride, membranes. The membranes were then blocked with 5% skimmed milk for 2 h, washed with phosphate-buffered saline with Tween 20, and incubated with primary antibodies at 4 °C overnight. The following primary antibodies were used: CD63 (# R23327 , 1:1,000 dilution; ZenBio), CD9 (#ab92726, 1:1,000 dilution; Abcam USA), β-actin (A5441, 1:10,000; Sigma-Aldrich), hexokinase 2 (HK2; A0994, 1:1,000 dilution; ABclonal, Wuhan, China), pyruvate kinase muscle isozyme M2 (PKM2; #4053, 1:1,000 dilution; Cell Signaling Technology, Massachusetts, USA), LDHA (#3558, 1:1,000 dilution; Cell Signaling Technology), BAX (RT40051, 1:1,000 dilution; Abmart), BCL-2 (13-8800, 1:1,000 dilution; Invitrogen), Caspase-3 (#9662, 1:1,000 dilution; Cell Signaling Technology), and β-Tubulin (#5568, 1:5,000 dilution; Cell Signaling Technology). Following this, the membranes were further incubated with horseradish peroxidase-conjugated affinipure goat anti-rabbit IgG (H + L) (SA00001-2, 1:5,000 dilution; Protein Tech Group Inc.) for 2 h at room temperature. Finally, the chemiluminescence of protein bands was detected by adding eECL (CW0049M, CWBIO) and using the Tanon-5500 Chemiluminescence Imaging System. The lactate and pyruvate contents in the culture medium were determined 36 h after the different treatments using a lactate test kit (#A019-2-1, Nanjing Jianjian Institute of Bioengineering, China) and a pyruvate assay kit (#A081-1-1, Nanjing Jianjian Institute of Bioengineering), respectively. The plates were read using a VersaMax microplate reader at 505 nm (pyruvate) and 530 nm (lactic acid) wavelengths. Data were analyzed using GraphPad Prism 8.0 (GraphPad Software, CA, USA) and presented as the mean ± standard deviation. Significant differences between/within groups were evaluated by the unpaired t-test or one-way ANOVA followed by Bonferroni’s post-hoc test. * p  < 0.05, ** p  < 0.01, and *** p  < 0.001 were considered statistically significant.

Supplementary Material

Supplementary Material 1. Supplementary Material 1.

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: pmc-nxml

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-08-16T09:21:09.727480+00:00
unpaywall
last seen: 2026-05-21T05:10:58.409756+00:00
License: CC-BY-NC-ND-4.0