Exosomal miR-199a-3p derived from follicular fluid modulates the immune microenvironment in polycystic ovary syndrome by regulating macrophage polarization.

OA: gold CC-BY-NC-ND-4.0
AI-generated deep summary by claude@2026-07, 2026-07-06 · read from full text

This study investigated whether follicular-fluid (FF) exosomes from women with polycystic ovary syndrome (PCOS) regulate the immune microenvironment by modulating macrophage polarization, focusing on exosomal miR-199a-3p. FF was collected synchronously with oocyte retrieval after standardized hCG trigger from 30 Rotterdam-criterion PCOS patients and 30 IVF/ICSI–ET controls for male-factor infertility, and FF exosomes were isolated (ultracentrifugation) and characterized (CD9/CD81/TSG101 by Western blot, TEM, nanoparticle tracking). The paper reports a disease-control framework aimed at linking exosomal miR-199a-3p to macrophage polarization states (M1/M2) as part of chronic low-grade inflammation mechanisms in PCOS, while acknowledging that the regulatory relationship of miR-199a-3p to macrophage phenotypes across diseases has not been clarified. This paper does not explicitly discuss endometriosis or adenomyosis; it was included in the corpus via a keyword match in the upstream search index.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

BACKGROUND: Polycystic ovary syndrome (PCOS) is characterized by chronic low-grade inflammation of the ovaries. This disorder of the immune microenvironment is closely related to abnormal follicular development and ovulation disorders. This study aims to investigate whether the exosomes derived from the follicular fluid of PCOS patients regulate macrophage polarization by delivering miR-199a-3p, and further participate in the molecular mechanism of ovarian immune microenvironment imbalance. METHODS: Exosomes were extracted from the follicular fluid of both PCOS patients and control subjects. The expression levels of miR-199a-3p in exosomes were quantified through Quantitative reverse transcription PCR, while the concentrations of inflammatory cytokines were measured through ELISA. Bioinformatics analysis predicted mTOR as a potential target of miR-199a-3p. To investigate functional interactions, PCOS-derived exosomes were co-cultured with THP-1-derived macrophages, either in the presence or absence of miR-199a-3p mimics. After 48 h of incubation, the expression profiles of inflammatory factors(TNF-α, IL-6, IL-10 and TGF-β1), miR-199a-3p, M1/M2 macrophage polarization markers (CD86 and CD206), and mTOR were systematically analyzed. RESULTS: PCOS patients exhibited significantly upregulated miR-199a-3p in follicular fluid exosomes, along with elevated pro-inflammatory factors (TNF-α, IL-6) and decreased levels of anti-inflammatory cytokines (IL-10, TGF-β1). In an in vitro exosome-macrophage co-culture experiment, miR-199a-3p overexpression enhanced the pro-inflammatory phenotype, further increasing TNF-α and IL-6 while decreasing IL-10 and TGF-β1. It also promoted M1 polarization (upregulated expression of CD86) and suppressed M2 polarization (downregulation of CD206 expression) through mTOR downregulation. These findings demonstrate that exosomes derived from the follicular fluid of PCOS patients transfer miR-199a-3p to macrophages. This transfer disrupts the delicate balance of M1/M2 polarization, thereby fostering the establishment of a pro-inflammatory microenvironment within the ovarian tissue. CONCLUSIONS: Follicular fluid exosomes from PCOS patients may target and inhibit the expression of mTOR in macrophages by delivering highly expressed miR-199a-3p, thereby hindering M2 polarization and promoting M1 polarization, ultimately leading to a shift of the local ovarian immune microenvironment towards a pro-inflammatory state. These findings offer novel molecular insights into exosome-mediated immune regulation within the pathogenesis of PCOS, highlighting a promising direction for the development of cell-free therapeutic strategies. TRIAL REGISTRATION: This study has been registered with the International Traditional Medicine Clinical Trial Registry under the registration number ITMCTR2025001857, with the registration date recorded as September 26, 2025.
Full text 46,016 characters · extracted from pmc-nxml · 6 sections · click to expand

Methods

This study was approved by the Ethics Committee of the Affiliated Hospital of Shandong University of Traditional Chinese Medicine (2025–036-YJS), and informed consent was obtained from all patients. This study included patients who underwent in vitro fertilization/intracytoplasmic sperm injection—embryo transfer (IVF/ICSI—ET) at the Reproductive and Genetic Center of the Affiliated Hospital of Shandong University of Traditional Chinese Medicine from September 2025 to November 2025. Among them, 30 patients who met the diagnosis of PCOS were included, and another 30 patients who underwent IVF/ICSI—ET solely due to male factors were included as a control group for reference. The included PCOS patients met the Rotterdam diagnostic criteria [ 22 ]: Oligomenorrhea, amenorrhea, or irregular uterine bleeding is a necessary condition for diagnosis. In addition, they should meet one of the following conditions: (1) Clinical symptoms or biochemical indicators of hyperandrogenism; (2) Polycystic ovarian morphology detected by ultrasound; (3) Other diseases causing clinical/biochemical. The inclusion criteria for the control group were normal ovarian morphology and function, regular menstrual cycles, normal androgen levels, and their spouses had oligoasthenospermia and had failed to conceive after ≥ 2 cycles of artificial insemination. The exclusion criteria are as follows: those with a history of recurrent miscarriage; those with ovarian function decline, such as premature ovarian failure, hyperprolactinemia, thyroid diseases, uterine fibroids and endometriosis; those who cannot or cannot tolerate pregnancy due to uterine or physical diseases; those with abnormal results of chromosomal examination of the couple's peripheral blood; those suffering from cardiovascular and cerebrovascular diseases or liver and kidney diseases; those with hematopoietic and coagulation system dysfunction; those with serious bad habits such as drug abuse; those who have used hormonal or immunologicaldrugs in the past three months; those with immune—related diseases; and those with incomplete case data. Ovulation has been demonstrated to share hallmark features with inflammatory cascades [ 23 ]. Triggering of oocyte maturation for oocyte pickup did trigger a pro inflammatory state similar to maturation of eggs and preparation for ovulation [ 24 ]. To minimize the interference factors in the experiment, the following standardized protocol was implemented in this study: All subjects were injected with the same human chorionic gonadotropin (hCG; Chorionic Gonadotropin for Injection, Livzon Pharmaceutical Group Co., Ltd., Zhuhai, China) to induce the final maturation of follicles. Oocyte retrieval was strictly performed 36 h after hCG administration, and follicular fluid samples were synchronously collected for data analysis. At the same time, fasting peripheral venous blood was collected from all subjects before the initiation of ovulation—inducing drugs (at 08:00 a.m. on the second day of the menstrual cycle). The blood samples were immediately centrifuged, aliquoted, and stored at—80°C for the unified detection of inflammatory factors. All subjects underwent ovulation stimulation using different ovulation induction protocols according to their own conditions. Oocytes were retrieved 36 h after injection of hCG (Livzon Pharmaceutical Group Co., Ltd., batch number: 161228). Professional staff from the specimen bank of the Reproductive and Genetic Center of the Affiliated Hospital of Shandong University of Traditional Chinese Medicine collected FF without blood from follicles with a diameter of more than 17 mm. The first tube of clear FF from each enrolled patient was collected in a timely manner. A low—temperature centrifuge was used to centrifuge at 1500 × g for 15 min at 4°C. The supernatant obtained after centrifugation was stored at—80°C. FF exosomes were extracted by ultracentrifugation strictly following the instructions of the ExoSmart High-efficiency Exosome Extraction Kit (JEKAIYEK, China). After extraction, the exosomes were stored at −80°C for subsequent experiments. The identification of exosomes was completed by the following three methods: Western blot (WB) was used to detect the exosome positive marker proteins CD9 (# 60,232—1—Ig, 1:2000 dilution, Proteintech, Rosemont, IL, USA), CD81 (# 66,866—1—Ig, 1:2000 dilution, Proteintech, Rosemont, IL, USA), and TSG101 (# 14,497—1—AP, 1:2000 dilution, Proteintech, Rosemont, IL, USA). The morphology of exosomes was observed and identified by transmission electron microscopy (TEM): 10 μL of exosome suspension was adsorbed onto a 200—mesh carbon—coated grid. After absorbing the liquid, 2% uranyl acetate staining solution was added dropwise for 2 min of staining. Then the staining solution was absorbed, the grid was dried, and images were observed and collected under a transmission electron microscope (HITACHI, Tokyo, Japan) at an accelerating voltage of 80 kV. Nanoparticle Tracking Analysis (NTA) was used to analyze the particle size of exosomes: 10–50 μL of exosome samples were appropriately diluted with phosphate-buffered saline (PBS), and then the particle size distribution and concentration were measured by the nanoparticle tracking analysis system. Thaw the FF exosome samples, which had been stored at −80°C, on ice. Total RNA was extracted from the exosomes using the TRIzon Total RNA Extraction Reagent (Catalog No. CW0580, CoWin Biosciences, China) in accordance with the manufacturer's protocol. A total of 2 μg RNA was used as the template for reverse transcription. The 20 μL reverse transcription reaction mixture consisted of 2 μL Primer Mix, 4 μL 5 × RT Buffer, 2 μL 0.1 M DTT, 1 μL HiFiScript (200 U/μL), and nuclease-free water up to the final volume. The reaction was carried out at 42 °C for 15 min, followed by enzyme inactivation at 85 °C for 5 min to obtain complementary DNA (cDNA). Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed using the SYBR Green method in a 20 μL reaction volume containing 2 × premix, specific primers, and cDNA. Amplification was conducted on a Hocybio H9800 Real-time PCR System (Hocybio Biotechnology Co., Ltd., China) under the following cycling conditions: initial denaturation at 95 °C for 10 min; 40 cycles of denaturation at 95 °C for 15 s, and annealing/extension at 60 °C for 1 min; followed by melting curve analysis. The relative expression level of miR-199a-3p was calculated using the 2^–ΔΔCt method. The concentrations of TNF-α, IL-6, IL-10, and TGF-β1 in FF and peripheral blood were quantified using a commercially available human enzyme-linked immunosorbent assay (ELISA) kit (MULTI SCIENCES, Hangzhou, China), in strict accordance with the manufacturer's protocol. Briefly, standards were serially diluted twofold. Following pre-treatment, standards, samples (50 μL of FF combined with 50 μL of detection buffer), and detection antibodies were sequentially added to the plate. After a 2-h incubation at room temperature and subsequent washing, enzyme-conjugated streptavidin was introduced, followed by another incubation and wash step. Subsequently, the substrate solution was added for color development under light-protected conditions, and the reaction was terminated using stop solution. Absorbance was measured at 450 nm using a microplate reader (HBS-1096C, Nanjing DeTie Biotechnology Co., Ltd., Nanjing, China), and protein concentrations were determined based on the standard curve. Exosomes were isolated from the FF of PCOS patients using the previously described method and utilized as carriers for miR-199a-3p mimic delivery via electroporation. Briefly, exosomes (2000 μg/mL) were mixed with miR-199a-3p mimics at a final concentration of 50 nM and incubated on ice for 10 min. The mixture was transferred to a pre-chilled 2 mm electroporation cuvette, and electroporation was performed using a Gene Pulser Xcell system (BIO-RAD Laboratories, Hercules, CA, USA) with five pulses at 400 V, 125 μF, and a pulse width of 5 ms. Following electroporation, samples were incubated on ice for 10 min to allow membrane recovery. The electroporated exosomes were then purified using a 100 kDa ultrafiltration device through centrifugation at 4000 × g for 10 min at 4 °C, washed four times with 2 mL PBS, and concentrated to a final volume of 500 μL. Total RNA was extracted from transfected exosomes using the TRIzon method, as previously described. After reverse transcription into cDNA, the expression level of miR-199a-3p was quantified using qRT-PCR. Transfection efficiency was evaluated by calculating the fold change in miR-199a-3p expression. The experiment comprised two groups: the PCOS group, incubated with exosomes derived from PCOS patients without miR-199a-3p electrotransfection, and the PCOS + miR-199a-3p mimics group, incubated with exosomes transfected with miR-199a-3p mimics. Exosomes were labeled using the green fluorescent membrane dye PKH67 and sterilized by filtration through a 0.22 µm filter. THP-1 monocytes were differentiated into macrophages (hereafter referred to as THP-1 macrophages) using 100 ng/mL phorbol 12-myristate-13-acetate, and subsequently co-cultured with exosomes from the two experimental groups. Cells were harvested at two time points: 0 h and 48 h. At each time point, cells were gently washed with PBS, followed by cytoskeletal staining with phalloidin and nuclear staining with 4',6-diamidino-2-phenylindole (DAPI). Multichannel fluorescence imaging and analysis were performed using a fluorescence microscope. The supernatant from the co-culture systems of cells and exosomes was carefully collected from each experimental group. To remove cellular debris, the supernatant was centrifuged at 300 ×  g  for 10 min at 4 °C. The resulting clarified supernatant was then analyzed using a commercial ELISA kit (MULTI SCIENCES, Hangzhou, China) according to the manufacturer’s instructions to quantify the concentrations of the inflammatory cytokines TNF-α, IL-6, IL-10, and TGF-β1. Detailed procedures followed the protocol described in previous sections. The putative target genes of miR-199a-3p were initially predicted using four online databases: Tarbase, miRWalk, miRDB, and TargetScan. The overlapping predictions were subsequently identified using the Venn online tool and visualized by means of a Venn diagram. Concurrently, genes associated with macrophage polarization were retrieved from the GEO database. Finally, the intersection between the predicted target genes of miR-199a-3p and macrophage polarization-related genes was analyzed to identify candidate targets through which miR-199a-3p may regulate macrophage polarization. Total RNA was extracted from cells following 48 h of co-culture using the TRIzon reagent and subsequently reverse-transcribed into cDNA. The mRNA expression levels of mechanistic target of rapamycin (mTOR), CD86, and CD206, along with the expression level of miR-199a-3p, were quantified in both experimental groups using qRT-PCR, following the methodology detailed in previous sections. Total protein was extracted from the co-cultured cells using radioimmunoprecipitation assay lysis buffer, and the protein concentration was quantified using the bicinchoninic acid assay. Proteins were separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis and subsequently transferred onto a polyvinylidene fluoride membrane. After blocking with 5% non-fat milk, the membrane was incubated overnight at 4 °C with the following primary antibodies: CD86 (1:5000, HUABIO, China), CD206 (1:1000, HUABIO, China), mTOR (1:5000, HUABIO, China), and phospho-mTOR (p-mTOR; 1:1000, HUABIO, China). The membrane was then washed three times with Tris-buffered saline with 0.1% tween 20 (TBST) for 10 min each. Thereafter, it was incubated with a rabbit secondary antibody (1:70,000, HUABIO, China) diluted in antibody dilution buffer (Cat. No. P0023D, Beyotime, China) for 1 h at room temperature with gentle shaking. After three additional TBST washes, the protein bands were visualized using a chemiluminescence substrate and imaged with a Tanon 4800 Chemiluminescent Imaging System (Tanon, China). The primer sequences used are listed in Table  1 . Table 1 Primers for real-time quantitative PCR Primer designation Primer sequences (5’−3’) H-GAPDH-138F GCACCGTCAAGGCTGAGAAC H-GAPDH-138R TGGTGAAGACGCCAGTGGA H-CD206-124F GATTGCAGGGGGCTTATGGG H-CD206-124R CGGACATTTGGGTTCGGGAG H-CD86-87F CGACGTTTCCATCAGCTTGTC H-CD86-87R CGCGTCTTGTCAGTTTCCAG H-MTOR-244F TCCTGACCCTGACATTCGCT H-MTOR-244R TCCAATCCCACTGTGCTCCA miR-199a-3pRT GTCGTATCCAGTGCAGGGTCCGA GGTATTCGCACTGGATACGACTAA CCAAT miR-199a-3p-F GCTCCACGACAGTAGTCTGCAC miR-199a-3p-R GTGCAGGGTCCGAGGTATTC U6-RT CGCTTCACGAATTTGCGTGTCAT U6-F CAGCACATATACTAAAATTGGAACG U6-R ACGAATTTGCGTGTCATCC Primers for real-time quantitative PCR GTCGTATCCAGTGCAGGGTCCGA GGTATTCGCACTGGATACGACTAA CCAAT Experimental data are presented as either the mean ± standard deviation or the median (interquartile range), depending on the distribution characteristics of the variables. All statistical analyses were performed using SPSS software (version 27.0; IBM Corp., Armonk, NY, USA). For graphical representation and visualization, GraphPad Prism (version 10.5; GraphPad Software, San Diego, CA, USA) was employed. Intergroup comparisons were conducted using appropriate statistical methods: the independent samples t-test for normally distributed continuous variables, the chi-square test for categorical variables, and the Mann–Whitney U test for non-normally distributed data. All statistical tests were two-tailed, with a significance threshold set at P  < 0.05.

Results

Comparison of baseline clinical characteristics between the control and PCOS groups is presented in Table  2 . No statistically significant differences were observed between the two groups in terms of age, duration of infertility, infertility type, baseline peripheral blood levels of estradiol (E₂), progesterone (P), duration of gonadotropin (Gn) treatment, or total Gn dosage (all P  > 0.05). The PCOS group exhibited significantly elevated levels of peripheral blood luteinizing hormone (LH), anti-Müllerian hormone (AMH), LH/FSH ratio, body mass index (BMI), and antral follicle count (AFC) compared to the control group (all P  < 0.05). In contrast, the levels of peripheral blood follicle-stimulating hormone (FSH) were markedly lower in the PCOS group than in the control group ( P  < 0.05). The expression levels of serum TNF-α and IL-6 in patients with PCOS were significantly higher than those in the control group, and the expression level of serum IL-10 was significantly lower than that in the control group (all P   0.05). Table 2 Characteristics of PCOS patients and healthy controls Clinical Parameters Control ( n  = 30) PCOS ( n  = 30) t/X 2 /Z P Age 30.57 ± 3.06 29.17 ± 3.68 −1.60 a 0.114 Years of infertility 3.50 ± 2.08 3.57 ± 2.21 0.12 a 0.905 Types of infertility 0 b 1 Primary infertility(%) 76.7(23/30) 23.3(7/30) Secondary infertility(%) 76.7(23/30) 23.3(7/30) FSH (mIU/ml) 7.13 ± 1.65 5.54 ± 1.27 −4.16 a  < 0.001 LH(mIU/ml) 4.43 ± 1.65 8.11 ± 3.31 5.449 a  < 0.001 LH/FSH 0.65 ± 0.25 1.53 ± 0.73 6.283 a  < 0.001 E2(pg/ml) 42.00 ± 31.79 47.95 ± 39.82 0.64 a 0.525 P(ng/ml) 0.51 ± 0.33 0.49 ± 0.45 −0.15 a 0.878 BMI 22.69 ± 3.19 30.91 ± 4.67 7.97 a  < 0.001 AMH 3.39 ± 2.02 6.49 ± 4.09 3.47 a 0.001 AFC 21(18.25, 24) 44(30.75, 59) −5.02 c 0.001 Duration of Gn use (days) 8.77 ± 1.33 9.23 ± 1.74 1.17 a 0.247 Total dose of Gn 1946.67 ± 540.70 2278.75 ± 1037.61 1.56 a 0.125 Serum TNF-α (pg/ml) 173.23 ± 43.96 410.88 ± 155.17 3.61 a 0.012 Serum IL-6 (pg/ml) 0.36 ± 0.23 0.92 ± 0.13 5.12 a  < 0.001 Serum TGF-β1 (pg/ml) 5289.63 ± 709.79 5917.36 ± 741.64 1.5 a 0.165 Serum IL-10 (pg/ml) 2.14 ± 0.54 1.00 ± 0.49 −3.83 a 0.003 a represents the t-value, b represents the χ 2 -value (chi-square value), and c represents the Z-value Characteristics of PCOS patients and healthy controls a represents the t-value, b represents the χ 2 -value (chi-square value), and c represents the Z-value Exosomes were isolated from the FF of both control subjects and patients with PCOS. The isolated vesicles were characterized using WB, TEM, and NTA. WB analysis confirmed the expression of exosomal marker proteins (CD9, CD81, and TSG101) in all samples (Fig.  1 a). TEM analysis revealed that the isolated vesicles exhibited a characteristic cup-shaped or spherical morphology with intact membranes and well-defined boundaries (Fig.  1 b). NTA revealed that the isolated exosomes exhibited a peak particle size distribution centered at approximately 160 nm, with a mean concentration of 3 × 10⁷ particles/mL (Fig.  1 c). qRT-PCR analysis revealed a significantly higher expression level of miR-199a-3p in FF-derived exosomes from the PCOS group compared with those from the control group (Fig.  1 d) ( P  < 0.05). ELISA was performed to quantify the levels of inflammatory cytokines TNF-α, IL-6, IL-10, and TGF-β1 in FF. The results demonstrated that the PCOS group exhibited significantly elevated levels of TNF-α and IL-6, along with a significantly reduced level of IL-10, compared to the control group (Fig.  1 e) ( P  < 0.05). Fig. 1 The levels of exosomal miR-199a-3p and inflammatory factors in the follicular fluid of PCOS group were elevated compared to the control group. a The WB results of the positive marker proteins in the follicular fluid exosomes of the two groups. The complete and uncropped original data are shown in Fig. S1. b TEM image of exosomes; c NTA results of exosomes; d Comparison of miR-199a-3p relative expression levels in follicular fluid exosomes between the two groups; e Comparison of TNF-α, IL-6, TGF-β1, and IL-10 expression levels in follicular fluid between the two groups. ( * P  < 0.05, ** P  < 0.01) The levels of exosomal miR-199a-3p and inflammatory factors in the follicular fluid of PCOS group were elevated compared to the control group. a The WB results of the positive marker proteins in the follicular fluid exosomes of the two groups. The complete and uncropped original data are shown in Fig. S1. b TEM image of exosomes; c NTA results of exosomes; d Comparison of miR-199a-3p relative expression levels in follicular fluid exosomes between the two groups; e Comparison of TNF-α, IL-6, TGF-β1, and IL-10 expression levels in follicular fluid between the two groups. ( * P  < 0.05, ** P  < 0.01) qRT-PCR analysis demonstrated that the expression of miR-199a-3p in exosomes of the group transfected with miR-199a-3p mimics was significantly upregulated. (Fig.  2 a). To verify the uptake of FF-derived exosomes by macrophages, we conducted a 48-h co-culture of isolated exosomes with macrophages. Exosomes were fluorescently labeled with PKH67, while macrophages were stained with phalloidin for cytoskeletal visualization and DAPI for nuclear identification. Fluorescence microscopy confirmed the internalization of exosomes by macrophages in both experimental groups (Fig.  2 b). To elucidate the underlying molecular mechanisms of exosome-macrophage interactions, we performed target gene prediction for miR-199a-3p using four bioinformatic databases: Tarbase, miRWalk, miRDB, and TargetScan. Intersection analysis via Venn diagram identified 84 potential target genes of miR-199a-3p, including mTOR (Fig.  2 c). Furthermore, we retrieved 567 macrophage polarization-associated genes from the GEO database and intersected them with the predicted target genes of miR-199a-3p, yielding two overlapping candidates: mTOR and lysine methyltransferase 2 A (Fig.  2 d). Based on existing literature indicating a strong association between mTOR and the pathogenesis of PCOS [ 25 ], we focused subsequent investigations on the role of miR-199a-3p and mTOR signaling in FF macrophages within the context of PCOS. Fig. 2 Fluorescence microscopy observation of macrophages co-cultured with electroporation-transfected miR-199a-3p mimics-loaded exosomes for 48 h, along with the prediction results of miR-199a-3p target genes. a Transfection efficiency verification of miR-199a-3p electroporated exosomes; b Fluorescence microscopy of macrophage-exosome co-culture at 0 h and 48 h; c Venn diagram of miR-99a-3p target gene predictions from four online databases; d Venn diagram of online database-predicted target genes of miR-199a-3p and macrophage polarization-related genes. ( ** P  < 0.01) Fluorescence microscopy observation of macrophages co-cultured with electroporation-transfected miR-199a-3p mimics-loaded exosomes for 48 h, along with the prediction results of miR-199a-3p target genes. a Transfection efficiency verification of miR-199a-3p electroporated exosomes; b Fluorescence microscopy of macrophage-exosome co-culture at 0 h and 48 h; c Venn diagram of miR-99a-3p target gene predictions from four online databases; d Venn diagram of online database-predicted target genes of miR-199a-3p and macrophage polarization-related genes. ( ** P  < 0.01) mTOR has been well established as a direct target of miR-199a-3p, with its binding site experimentally validated through dual-luciferase reporter assays in previous studies [ 18 , 21 , 26 – 28 ]. Building upon this consensus, the present study did not reiterate the targeting verification. Instead, it focused on elucidating the functional role of the miR-199a-3p–mTOR axis in regulating macrophage polarization within the FF of PCOS patients. ELISA of inflammatory cytokines in the supernatant after 48 h of co-culture revealed that the PCOS + miR-199a-3p mimics group exhibited significantly elevated levels of TNF-α, IL-6, and IL-10, along with a marked reduction in TGF-β1, compared to the PCOS group (Fig.  3 a) ( P  < 0.05). qRT-PCR analysis further demonstrated that macrophages co-cultured with exosomes for 48 h showed significantly higher mRNA expression of miR-199a-3p and the M1 marker CD86 in the PCOS + miR-199a-3p mimics group relative to the PCOS group ( P  < 0.05). Conversely, expression of the M2 marker CD206 and mTOR was significantly downregulated (Fig.  3 b) ( P  < 0.05). These transcriptional findings were corroborated at the protein level, as Western blot analysis yielded consistent results (Fig.  3 c) ( P  < 0.05). Fig. 3 Co-culture with miR-199a-3p mimic-electroporated exosomes for 48 h altered macrophage polarization and elevated inflammatory cytokine levels. a Supernatant inflammatory cytokine profiles post 48 h co-culture; b The relative expression level of miR-199a-3p and the relative mRNA expression levels of CD86, CD206, and mTOR. c Western blot analysis of CD86, CD206, mTOR, and p-mTOR expression in macrophages co-cultured with exosomes for 48 h. Quantification data represent relative grayscale values of protein bands. Uncropped original blots are provided in Fig. S2. ( ** P  < 0.01) Co-culture with miR-199a-3p mimic-electroporated exosomes for 48 h altered macrophage polarization and elevated inflammatory cytokine levels. a Supernatant inflammatory cytokine profiles post 48 h co-culture; b The relative expression level of miR-199a-3p and the relative mRNA expression levels of CD86, CD206, and mTOR. c Western blot analysis of CD86, CD206, mTOR, and p-mTOR expression in macrophages co-cultured with exosomes for 48 h. Quantification data represent relative grayscale values of protein bands. Uncropped original blots are provided in Fig. S2. ( ** P  < 0.01)

Background

Polycystic ovary syndrome (PCOS) is the most common endocrine and metabolic disorder among women of reproductive age, with a prevalence of 5%—15% in the global non-menopausal female population [ 1 ]. It presents clinical manifestations such as oligomenorrhea or amenorrhea, ovulatory dysfunction, hyperandrogenism symptoms like hirsutism and acne, insulin resistance (IR), and obesity, and increases the risk of long-term complications including type 2 diabetes and cardiovascular diseases, being also the main cause of anovulatory female infertility [ 1 ]. The pathogenesis of PCOS remains unclear, although several mechanisms have been widely studied, including chronic low-grade inflammation (CLGI), hyperandrogenism (HA), and IR. Notably, the endocrine and metabolic disorders associated with CLGI play a crucial role in ovulatory dysfunction [ 2 ]. As the core of innate immunity, macrophages play an important role in the systemic inflammatory response. Macrophage polarization refers to the activation state of macrophages at a single time point. Generally speaking, the phenotypes of macrophage polarization can be divided into classically activated M1 type and alternatively activated M2 type, and the two are reversible. M1 macrophages are also known as pro—inflammatory macrophages, which can secrete pro—inflammatory cytokines, such as tumor necrosis factor (TNF)—α, interleukin (IL)—6, IL—1β [ 3 ]. M2 macrophages are also known as anti-inflammatory macrophages, which secrete anti-inflammatory cytokines and growth factors, such as IL-10 and transforming growth factor (TGF)-β [ 4 ]. If there is an imbalance in the polarization of M1/M2 macrophages and pro—inflammatory macrophages persist, it will lead to the continuous production of pro—inflammatory factors, resulting in the persistence of chronic inflammation and further promoting the progression of the disease [ 5 ]. Macrophages are the most abundant immune cells in ovarian tissue and are involved in maintaining ovarian function [ 6 ]. Studies have shown that systemic CLGI and chronic ovarian tissue inflammation are typical pathological features of PCOS. Moreover, in experimental studies on PCOS animal models, it has been found that the proportion of M1 macrophages in antral follicles and pre—ovulatory follicles increases significantly [ 7 ], which plays an important role in folliculogenesis and ovulation [ 8 ]. Follicular fluid (FF) is an important microenvironment for follicular growth and development. Research indicates that the elevated pro-inflammatory level in the FF of PCOS patients, caused by the increased release of inflammatory factors from immune cells, can impair the regulatory function of ovarian granulosa cells (GCs) on oocyte growth and development, ultimately leading to ovulation dysfunction [ 9 ]. However, the specific molecular mechanism remains unclear. GCs represent one of the crucial cell populations surrounding oocytes, where accurate information exchange between GCs and oocytes is essential for oocyte growth, development, and proliferation. Exosomes carrying a variety of genetic materials and signaling molecules can transmit information between oocytes and cell populations such as GCs through FF [ 10 ]. Therefore, sampling and analyzing FF exosomes can help discover molecules meaningful for the study of the pathogenesis of PCOS and promote the improvement of the research on the pathogenesis of PCOS. Exosomes are nanoscale extracellular vesicles. As a mode of intercellular communication, they can carry and transfer substances such as microRNA (miRNA) and proteins to recipient cells to regulate the survival state of recipient cells. miRNAs are non-coding regulatory RNAs with a phosphate group at the 5' end and a hydroxyl group at the 3' end, and are approximately 19—25 nucleotides in length. They can bind to the 3' untranslated region of the target mRNA, prevent the translation of the target mRNA, affect the protein expression level, and thus inhibit gene expression [ 11 ]. Current research has found that many miRNAs are differentially expressed in PCOS, such as miR-199a-5p [ 12 ], miR-143-3P [ 13 ], miR-155 [ 14 ], miR-379-5p [ 15 ]. Moreover, most studies have focused on the relationship between miRNAs and ovarian GCs in PCOS patients. According to the previous high-throughput sequencing results of our research team, it was found that miR-199a-3p may have differential expression in PCOS. miR-199a-3p is located on chromosome 19 and has been confirmed to be related to the pathogenesis of various diseases such as cancer [ 16 , 17 ], cardiovascular diseases [ 18 ], respiratory diseases [ 19 , 20 ] and osteoarthritis [ 21 ]. In a study on lung function damage after ozone exposure, it was found that the up-regulation of miR-199a-3p expression in diseased tissues can promote the polarization of M1 macrophages, thereby aggravating the inflammatory response [ 20 ]. However, a study on the immune microenvironment of bladder cancer showed that the expression of miR-199a-3p is positively correlated with the polarization of M2 macrophages [ 17 ]. The specific regulatory relationship between miR-199a-3p and macrophage polarization phenotypes in different diseases has not been clarified. Therefore, this study aims to explore the role of the regulatory relationship between FF-derived exosomal miR-199a-3p and macrophage polarization in the pathogenesis of PCOS, in order to provide new ideas for the research on the pathogenesis related to the CLGI immune microenvironment of PCOS and the exploration of treatment methods.

Discussion

Analysis of baseline characteristics in this study revealed that serum AMH levels and AFC during the menstrual phase were significantly higher in the PCOS group compared to the control group ( P  < 0.05), indicating enhanced ovarian reserve in PCOS patients. However, serum LH levels and the LH/FSH ratio were significantly elevated, while FSH levels were significantly lower in PCOS patients (all P  < 0.05). These findings suggest a disturbance in basal gonadotropin levels in PCOS, which may impair follicular development and dominant follicle selection, leading to compromised follicular quality and ovulatory dysfunction, consistent with previous reports [ 29 ]. Furthermore, BMI of PCOS patients was significantly higher than that of the controls ( P  < 0.05), aligning with existing literature [ 30 ]. Additionally, serum levels of the inflammatory cytokines TNF-α and IL-6 were markedly increased, whereas IL-10 levels were significantly reduced in PCOS patients during the menstrual phase (all P  < 0.05), which is also in agreement with prior studies [ 31 ]. It has been further demonstrated that CLGI represents an independent factor contributing to the pathogenesis of PCOS, irrespective of obesity status [ 32 ]. In the present study, comparative analysis of cytokine profiles in FF revealed significantly elevated levels of the pro-inflammatory cytokines TNF-α and IL-6 in the PCOS group ( n  = 30) compared with the control group ( n  = 30) ( P  < 0.05). Conversely, the anti-inflammatory cytokines TGF-β1 and IL-10 were significantly reduced in the PCOS cohort ( P  < 0.05). These findings suggest a pronounced pro-inflammatory immune microenvironment within the FF of PCOS patients, which aligns with and reinforces the outcomes reported in previous studies [ 33 ]. Exosomes were isolated from the FF of both patient groups and characterized based on specific exosomal markers (CD9, CD81, and TSG101) and TEM. The results confirmed positive expression of all three exosomal marker proteins. TEM imaging revealed typical cup-shaped vesicular structures with an average diameter of approximately 160 nm, consistent with the well-documented morphological features of exosomes reported in previous studies [ 34 , 35 ]. Analysis of miR-199a-3p expression levels in isolated exosomes revealed a significant upregulation in exosomes derived from the FF of PCOS patients compared with the control group ( P  < 0.05). This expression pattern paralleled the elevated profile of pro-inflammatory cytokines observed in PCOS FF, suggesting a potential association between exosomal miR-199a-3p and the pro-inflammatory microenvironment in PCOS. To further investigate this putative mechanism, we conducted additional in vitro cellular validation experiments. Previous studies have indicated that miR-199a-3p plays a significant regulatory role in modulating macrophage polarization states. However, its regulatory effects may exhibit disease-specific directional differences [ 17 , 20 ]. In the present study, bioinformatic predictions from online databases suggested that miR-199a-3p may regulate macrophage polarization by targeting mTOR. This interaction is supported by multiple independent studies, in which the targeting relationship between miR-199a-3p and mTOR has been consistently validated using dual-luciferase reporter assays, confirming a repressive regulatory mechanism without substantial controversy in the literature [ 18 , 21 , 26 – 28 ]. To investigate whether exosomal miR-199a-3p derived from FF of PCOS patients regulates macrophage polarization via targeting mTOR, we conducted an in vitro validation experiment. Exosomes isolated from PCOS FF were divided into two groups: a PCOS group and a PCOS group transfected with miR-199a-3p mimics. Both groups were co-cultured with macrophages. The results demonstrated that exosomes from both groups were internalized by macrophages and functionally active. Compared to the PCOS group, the PCOS + miR-199a-3p mimics group exhibited significantly elevated secretion of pro-inflammatory cytokines TNF-α and IL-6, along with markedly reduced levels of anti-inflammatory cytokines IL-10 and TGF-β1. These findings suggest that miR-199a-3p promotes a pro-inflammatory phenotype in macrophages, shifting the immune microenvironment toward a pro-inflammatory state, which aligns with the results reported by Carnino et al. [ 20 ] in the context of ozone exposure. Furthermore, to validate the regulatory effect of miR-199a-3p on its target gene mTOR and its functional impact on macrophage polarization, we performed WB and qRT-PCR analyses of mTOR and the polarization markers CD86 (M1) and CD206 (M2). The results demonstrated that, compared with the PCOS group, the PCOS + miR-199a-3p mimics group exhibited significantly decreased expression of both mTOR and CD206, along with a marked increase in CD86 expression. Therefore, our findings demonstrate that exosomes derived from FF of PCOS patients deliver overexpressed miR-199a-3p into macrophages, where it suppresses M2 polarization through targeted inhibition of the mTOR signaling pathway. Concurrently, we observed a relative enhancement in M1 macrophage polarization. This shift in macrophage phenotype resulted in diminished secretion of anti-inflammatory cytokines alongside increased production of pro-inflammatory cytokines, collectively contributing to the establishment of a pro-inflammatory microenvironment (Fig.  4 ). Fig. 4 In FF from PCOS patients, exosomes carrying miR-199a-3p are taken up by macrophages, where miR-199a-3p is released into the macrophage cytoplasm. Within macrophages, miR-199a-3p induces mRNA degradation of mTOR, leading to downregulation of mTOR protein and its phosphorylated form (p-mTOR). This signaling alteration promotes the increased polarization of M1-type macrophages and enhances the secretion of pro-inflammatory cytokines (TNF-α, IL-6), while suppressing the polarization of M2-type macrophages and reducing the production of anti-inflammatory cytokines (IL-10, TGF-β). Collectively, these changes contribute to a pro-inflammatory microenvironment in PCOS. (Created with BioGDP.com) In FF from PCOS patients, exosomes carrying miR-199a-3p are taken up by macrophages, where miR-199a-3p is released into the macrophage cytoplasm. Within macrophages, miR-199a-3p induces mRNA degradation of mTOR, leading to downregulation of mTOR protein and its phosphorylated form (p-mTOR). This signaling alteration promotes the increased polarization of M1-type macrophages and enhances the secretion of pro-inflammatory cytokines (TNF-α, IL-6), while suppressing the polarization of M2-type macrophages and reducing the production of anti-inflammatory cytokines (IL-10, TGF-β). Collectively, these changes contribute to a pro-inflammatory microenvironment in PCOS. (Created with BioGDP.com) PCOS is an important cause of anovulatory infertility [ 36 ]. In patients with PCOS, the quality of oocytes is impaired, making it difficult to obtain high-quality embryos [ 37 ]. Therefore, improving the quality of oocytes in PCOS patients is a key measure to optimize the treatment effect. Currently, clinical management of PCOS primarily relies on lifestyle modifications and symptomatic treatment as first-line strategies [ 38 ]. Letrozole, metformin, and vitamin D are among the most commonly prescribed pharmacological agents, however, their therapeutic applications are constrained by limited indications and notable side effects [ 39 ]. In light of these challenges, it becomes imperative to explore novel treatment modalities that can overcome these limitations while offering safer and more effective alternatives. mTOR is an evolutionarily conserved serine/threonine kinase that senses diverse extracellular and intracellular signals, thereby coordinating a broad spectrum of physiological and pathological processes in a cell type-specific manner [ 40 ]. Studies have demonstrated that mTOR serves as a critical regulator of cellular homeostasis, immune function, and innate antibacterial responses, with a central role in modulating cellular metabolism [ 41 ]. In the pathogenesis of PCOS, mTOR represents a crucial regulatory component. It facilitates autophagy in ovarian granulosa cells through autophagy-related signaling pathways, thereby impairing oocyte development and promoting follicular atresia, which leads to ovulatory dysfunction. Additionally, mTOR dysregulation disrupts steroid hormone synthesis, contributing to HA and IR, both of which are closely associated with CLGI in the ovaries of PCOS patients [ 42 ]. Substantial evidence indicates that a pro-inflammatory intraovarian environment contributes significantly to the pathogenesis of PCOS. As a key regulator of ovarian function, macrophages can modulate crucial processes such as follicular development, ovulation, and corpus luteum formation, and play a pivotal role in maintaining the homeostasis of the ovarian immune microenvironment through their polarization states [ 43 ]. Studies suggest that targeting the regulation of macrophage polarization, either by inhibiting M1 macrophage activation or promoting their shift towards the M2 phenotype, is a promising therapeutic strategy for improving PCOS symptoms through promoting GCs proliferation and inhibiting apoptosis [ 44 ]. Furthermore, evidence indicates that mTOR activation promotes the secretion of TGF-β1, thereby facilitating macrophage polarization toward the M2 phenotype [ 45 ]. This study further reveals that miR-199a-3p in the follicular fluid exosomes of PCOS patients may affect the polarization balance of macrophages by regulating the mTOR signaling pathway. Based on this finding, this study provides a new potential target for the treatment of PCOS: by inhibiting the expression of miR-199a-3p or activating the mTOR signaling pathway, the excessive activation of M1 macrophages can be effectively inhibited, and their transformation to the M2 phenotype can be promoted, thereby regulating the polarization balance of macrophages. This regulatory mechanism is expected to improve the local ovarian inflammatory state in PCOS patients, optimize the microenvironment for follicular development, and thus promote the recovery of ovulatory function. Exosomes are lipid-bilayer membrane vesicles secreted into the extracellular space via exocytosis, capable of carrying nucleic acids, proteins, and other biomolecules. They facilitate communication with target cells through mechanisms such as ligand–receptor interaction, membrane fusion, or receptor-mediated endocytosis to deliver their cargo. As a ubiquitous and efficient form of intercellular communication, exosomes play critical roles in various physiological and pathological processes across different tissues and systems in the human body [ 46 ]. Mesenchymal stem cells (MSCs) represent a major cellular source for exosome production [ 47 ]. Studies have indicated that exosomes derived from MSCs exhibit immunomodulatory properties in various diseases, including those affecting the cardiovascular, pulmonary, digestive, renal, and central nervous systems, primarily through modulation of M1/M2 macrophage polarization. Nevertheless, the precise molecular mechanisms underlying these regulatory effects remain to be fully elucidated [ 48 ]. Recent studies have highlighted exosomes as promising drug delivery vehicles with superior clinical potential compared to liposomes, owing to their high biological stability, ease of storage, efficient tissue penetration, low toxicity, and minimal immunogenicity. Studies have demonstrated that exosomes, which transport a diverse array of substances including miRNAs, hold promise not only as diagnostic markers for PCOS but also as therapeutic agents. These nanosized vesicles exert their effects through multiple mechanisms, such as suppressing inflammatory responses, modulating cell apoptosis, and regulating steroid hormone synthesis. Animal experiments have demonstrated that the intravenous or localized ovarian injection of exosomes derived from MSCs can markedly improve hormone levels and promote follicular development in mice models of PCOS [ 49 ]. Notably, Zhao et al. [ 50 ] demonstrated in experiments on PCOS model mice that exosomal miR-323-3p derived from adipose-derived MSCs attenuates PCOS progression by targeting programmed cell death protein 4 and subsequently inhibiting cumulus cell apoptosis. The present study demonstrates that exosomes derived from the FF of PCOS patients may regulate M1/M2 macrophage polarization through the delivery of miR-199a-3p and subsequent targeting of mTOR, thereby improving the ovarian immune microenvironment. This study reveals for the first time that exosomes derived from FF of patients with PCOS can deliver miR-199a-3p to macrophages, target and regulate the mTOR signaling pathway, thereby mediating the process of macrophage polarization, and ultimately participating in the regulation of the ovarian inflammatory immune microenvironment. These findings not only provide a novel perspective for in—depth exploration of the immune—related pathological mechanisms of PCOS, but also establishes a theoretical foundation for developing cell-free therapeutic strategies based on exosome drug delivery systems. Future studies should prioritize elucidating the precise molecular mechanisms of exosomes, optimizing protocols for their large-scale production and drug loading, and rigorously evaluating the safety and efficacy of exosome-based therapies through clinical trials. These efforts will be essential to facilitate the translation of exosome research from bench to bedside. Research shows that traditional Chinese medicine (TCM) treatment of PCOS has the regulatory advantages of multi-targets and multi-pathways [ 51 ]. Animal experiments indicate that TCM compound Malt Pill can reduce the expression of IL-6 and TNF-α in PCOS rats [ 52 ]. TCM Guizhi Fuling Pill can control inflammation by regulating the gut microbiota, thereby improving insulin resistance in PCOS [ 53 ]. TCM Bushen Huazhuo Formula can relieve the inflammatory state of PCOS by improving the function of the gut microbiota and inhibiting the Lipopolysaccharide/Toll-like Receptor 4 signaling pathway [ 54 ]. Network pharmacology research has found that the immune-related multi-targets of TCM Cangfu Daotan Decoction for treating PCOS include Tumor Protein p53, Protein Kinase B1, Signal Transducer and Activator of Transcription 3, Jun Proto – Oncogene and SRC Proto – Oncogene [ 55 ]. This study also provides new ideas for the research of molecular targets of traditional Chinese medicine prescriptions and is expected to develop new treatment methods for PCOS by combining the research strategy based on the mTOR signaling pathway with traditional Chinese medicine. This study provides the first evidence that exosomes derived from the FF of PCOS patients may modulate the ovarian immune microenvironment by delivering overexpressed miR-199a-3p to macrophages and regulating macrophage polarization through mTOR targeting. However, several limitations should be acknowledged. First, the utilization of a single-center cohort comprising 60 cases may potentially introduce selection bias. To ensure the generalizability of these findings, future studies should prioritize multi-center investigations with larger sample sizes for validation. Second, owing to time limitations, the in vivo validation using PCOS animal models was not conducted. To enhance the robustness of the evidence, subsequent studies should prioritize incorporating such experiments into their design. Third, while this study demonstrates that miR-199a-3p modulates macrophage polarization by targeting mTOR, the precise downstream signaling pathways of mTOR remain to be fully elucidated. A more comprehensive understanding of these mechanisms is essential for clarifying the underlying molecular processes involved.

Conclusions

This study demonstrates that exosomes derived from FF of PCOS patients deliver overexpressed miR-199a-3p to macrophages, leading to targeted suppression of the mTOR signaling pathway. This suppression consequently inhibits M2 macrophage polarization and reduces anti-inflammatory cytokine secretion. Concurrently, M1 macrophage polarization is relatively enhanced, accompanied by increased production of pro-inflammatory cytokines, ultimately resulting in a shift toward a pro-inflammatory state within the PCOS follicular microenvironment. This mechanism is likely associated with the CLGI status characteristic of PCOS. Collectively, these findings provide novel molecular insights into exosome-mediated immune regulation in PCOS pathogenesis and suggest a potential avenue for developing cell-free therapeutic strategies.

Supplementary Material

Supplementary Material 1. Supplementary Material 1.

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: pmc-nxml

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2026) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

SciLite annotations

chemicals 28
phalloidin hydroxyl nucleotide ozone carbon acetate water phorbol myristoleyl myristate acetate phalloidin phenylindole hydroxymethylphosphonic acid sodium dodecyl sulfate polyacrylamide macromolecule vinylidene fluoride polysorbate 20 estradiol progesterone ozone letrozole metformin vitamin d steroid lipid lipopolysaccharide polysorbate 20
organisms 13
rodents human human rabbits human rodents mus sp. mus sp. rattus sp. microbiota microbiota rodents human

Source provenance

europepmc
last seen: 2026-07-27T06:15:28.040536+00:00
scilite
last seen: 2026-06-21T06:47:03.627287+00:00
unpaywall
last seen: 2026-05-21T05:10:58.409756+00:00
License: CC-BY-NC-ND-4.0