Folate Receptor Alpha Expression in Fallopian Tube: Further Evidence Supporting Tubal Contribution of “Ovarian” Endometriosis

In: Research Square · 2021 · doi:10.21203/rs.3.rs-746595/v1 · W3191575495
preprint OA: green CC0
AI-generated summary by claude@2026-06+body, 2026-06-13

This study found that folate receptor alpha (FOLR1) mRNA and protein are highly expressed in fallopian tube and ovarian endometriosis tissues, but not ovarian surface epithelia, supporting the fallopian tube's contribution to ovarian endometriosis.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

AI-generated deep summary by claude@2026-06, 2026-06-09 · read from full text

This preprint investigated whether folate receptor alpha (FOLR1) and its protein product (FRA) show expression patterns that support a tubal contribution to “ovarian” endometriosis. Using 144 human tissue samples that included paired tubal-endometrial-ovarian endometriosis, ovarian endometriosis without corresponding tubal/endometrial tissue, and ovarian tissue without endometriosis, the authors compared FOLR1 mRNA (real-time PCR) and FRA protein (Western blot and immunohistochemistry) between fallopian tube/endometriosis tissues and endometrium. FOLR1 and FRA were highly expressed in fallopian tube epithelia and in ovarian endometriosis, with significantly lower expression in endometrium; in addition, ovarian surface mesothelial epithelia were negative for FRA by IHC, and there was no significant difference in FRA between fallopian tube and ovarian endometriosis. A major limitation is that this evidence is based on biomarker expression rather than direct lineage tracing, and the preprint is not peer reviewed. This paper is centrally about endometriosis — it provides further evidence for a fallopian tube origin contributing to ovarian endometriosis via FOLR1/FRA expression.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Abstract Background Ovary is the most common organ site involved by endometriosis. We previously found that fallopian tube may contribute to the histogenesis of ovarian endometriosis. The finding was novel and requires further studies. We addressed this issue by examining a differentially expressed gene folate receptor alpha FOLR1 and its protein FRA in this study. Results A total of 144 tissue samples were studied. These included 32-paired 32-paired tubal-endometrial-ovarian endometriosis samples (n = 96), 18 samples of ovarian endometriosis without corresponding tubal or endometrium, and 30 ovarian tissue samples with ovarian surface epithelia but without endometriosis. Multiple comparisons among groups of ovarian endometriosis, normal fallopian tube and benign endometrium were performed. FOLR1 was highly expressed in the epithelia of fallopian tube and ovarian endometriosis, with paired endometrial samples showing a significantly lower level of expression. Similar differential studies for FRA protein were performed through Western blot and immunohistochemistry (IHC). The expression of folate receptor alpha at both mRNA and protein levels in the tissues (fallopian tube or ovarian endometriosis vs. the endometrium) were significantly different (p < 0.001). All ovarian surface mesothelial epithelia showed negative expression of FRA by IHC. Conclusions The results further support that the fallopian tube may contribute to the development of ovarian endometriosis. Understanding the tubal contribution to ovarian endometriosis should ultimately contribute to ongoing investigative efforts aimed at identifying alternative ways to prevent and treat endometriosis.
Full text 110,741 characters · extracted from preprint-html · click to expand
Folate Receptor Alpha Expression in Fallopian Tube: Further Evidence Supporting Tubal Contribution of “Ovarian” Endometriosis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Folate Receptor Alpha Expression in Fallopian Tube: Further Evidence Supporting Tubal Contribution of “Ovarian” Endometriosis Rujia Fan, Qiyan Li, Li Wei, Ruijiao Zhao, Yan Wang, Wanrun Lin, and 7 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-746595/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Ovary is the most common organ site involved by endometriosis. We previously found that fallopian tube may contribute to the histogenesis of ovarian endometriosis. The finding was novel and requires further studies. We addressed this issue by examining a differentially expressed gene folate receptor alpha FOLR1 and its protein FRA in this study. Results A total of 144 tissue samples were studied. These included 32-paired 32-paired tubal-endometrial-ovarian endometriosis samples (n = 96), 18 samples of ovarian endometriosis without corresponding tubal or endometrium, and 30 ovarian tissue samples with ovarian surface epithelia but without endometriosis. Multiple comparisons among groups of ovarian endometriosis, normal fallopian tube and benign endometrium were performed. FOLR1 was highly expressed in the epithelia of fallopian tube and ovarian endometriosis, with paired endometrial samples showing a significantly lower level of expression. Similar differential studies for FRA protein were performed through Western blot and immunohistochemistry (IHC). The expression of folate receptor alpha at both mRNA and protein levels in the tissues (fallopian tube or ovarian endometriosis vs. the endometrium) were significantly different (p < 0.001). All ovarian surface mesothelial epithelia showed negative expression of FRA by IHC. Conclusions The results further support that the fallopian tube may contribute to the development of ovarian endometriosis. Understanding the tubal contribution to ovarian endometriosis should ultimately contribute to ongoing investigative efforts aimed at identifying alternative ways to prevent and treat endometriosis. Sexual & Reproductive Medicine Cancer Biology ovarian endometriosis endometrioma endometrioitic cyst fallopian tube tubal contribution of endometriosis biomarkers of endometriosis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Background Endometriosis, one of the most common gynecologic disorders, is a bewildering and debilitating disease that affects millions of women in the world. Endometriosis, defined by the presence of endometrial tissue outside the uterus, can be divided into two categories with one inside and the other outside of the ovary. The ovarian endometriosis is the most common. Clinical symptoms of endometriosis are numerous and may include dysmenorrhea, dyspareunia, menorrhagia, dyschezia, pelvic and abdominal pain, infertility, and symptoms from gastrointestinal tract. Pathogenesis of endometriosis remains unclear. The most popular hypothesis is the retrograde menstruation theory, which was originally proposed by Sampson [ 1 ] in 1927. Although it is popular, it remains controversial for a variety of reasons. Retrograde menstruation is thought to occur in up to 90% of reproductive age women [ 2 ], but only 6–10% of these women have clinical symptoms related to endometriosis [ 2 ]. Additionally, the theory falls flat to explain the presence of endometriosis outside the peritoneal cavity. The coelomic metaplasia hypothesis proposed by Meyer[ 3 ] states that endometriosis may originate from mesothelial cells through a metaplastic process, although how the metaplasia happens is ambiguous. Initial endometriosis, which our group described in 2005 [ 4 ], represents a spectrum of the earliest morphologically identifiable changes of endometriosis within the ovary. At that time, we assumed that the morphologic transitions from ovarian surface epithelia or ovarian epithelial inclusions (OEI) to initial endometriosis lesions represented a metaplastic process from OSE as discussed in 2005 [ 4 ]. However, nowadays we realize that the majority of epithelia attached on the ovarian surface and OEIs are derived from the fallopian tube. This was found when we studied the origin of OEIs from the fallopian tube epithelia vs ovarian surface mesothelia in 2011 [ 5 ]. The fallopian tube, particularly tubal fimbriated end, has recently caught great attention in studies of adnexal pathology and the origin of ovarian serous cancers. This is mainly because most investigators believe that the majority ovarian serous cancers are actually derived from the fallopian tube, not the ovary as was historically asumed [ 6 – 8 ]. Similarly, in our study of the cellular origins of OEIs, we found that the majority OEIs (also called endosalpingiosis) display a phenotype suggesting they are derived directly from tubal epithelial cells rather than from ovarian surface mesothelial cells [ 5 , 9 ]. Indeed, microscopic examination of resected ovarian and tubal tissues frequently shows various stages of the following sequence: tubal epithelia mostly from fimbriated end are frequently adherent on the ovarian surface, accompanied by invagination of morphologically similar epithelia onto ovarian surface, then invaginate into the cortex forming OEIs or endosalpingiosis [ 5 , 6 ]. From those findings, we believe cellular metaplasia that eventuates in the formation of ovarian initial endometriosis occurs through the conversion of tubal-like epithelia within the ovarian cortex into endometriosis-like tissue, rather than the conversion of ovarian surface mesothelial cells into endometriosis-like tissue. The potential for tubal mucosal epithelia to convert into endometriosis-like tissue is also supported by the phenomenon of “endometrialization” of the proximal end of the fallopian tube after a tubal ligation procedure [ 10 , 11 ]. Based in part on the aforementioned morphological findings, we first proposed the hypothesis that tubal epithelia contribute to the formation of ovarian endometriosis in 2014 and 2015 [ 9 , 12 ]. The biomarker FRA (folate receptor alpha), the product of the FOLR1 gene, has previously been shown to be differentially expressed between the fallopian tube and the endometrium [ 13 , 14 ]. In this study, we aimed to investigate FRA expression in tissue samples of human ovarian endometriosis and normal tubal and endometrial tissue samples to further examine the cellular origin of the ovarian endometriosis. Results Multiple unique genes identified in the fallopian tube over the endometrium A total of 4114 and 3451 genes were identified from the tubal and endometrial samples, respectively. The gene expression profiles of the paired tubal and endometrial samples were compared using a Volcano Plot. The threshold for a differentially expressed genes between the tubal and endometrium was set at ≥ 2.0-fold level. There were 1796 genes identified with more than two-fold differential expressions between the two tissue samples. All differentially expressed genes were further scrutinized and some representative genes were listed and studied previously[ 9 ]. Compared with the endometrial samples, the tubes showed a total of 911 upregulated genes. These included genes that were ≥ 50-fold (n = 8), ≥ 20-fold (n = 28) and ≥ 2-fold (n = 875) comparatively upregulated in the fallopian tube. There were no genes with more than 50-fold upregulation in the endometrial sample relative to the tubal tissue. FOLR1 (gene bank accessing number NM_016729), which was not listed previously and represented another most differentially expressed gene, showed 55.6-fold increment in the tubal sample compared to the gene expression level at the endometrium ( p = 0.012831689). FOLR1 gene detection in the fallopian tube, endometrium, and ovarian endometriosis by real-time PCR Real-time PCR was used to examine the level of FOLR1 expression in 15 paired fresh tissue samples (total of 45 samples, including 15 each of the fallopian tube, endometrium, and ovarian endometriosis specimens). FOLR1 was highly expressed in the fallopian tube compared with the paired endometrium, with fold increment ranging from 9 to 35 (average fold change = 18.25, p < 0.001). Similarly, the FOLR1 gene was highly expressed in the samples of ovarian endometriosis compared with the paired endometrium, with fold increment ranging from 3 to 20 (average fold change = 11.18, p < 0.001). However, although there were some expression level differences between the fallopian tube and ovarian endometriosis samples, the difference did not reach statistical significance ( p = 0.125). The gene expression level from the 15-paired cases, together with pooled data, is shown in Fig. 1 . Among these 15-paired samples, 12 pairs (from 1 to 12) were in the proliferative phase and 3 (13 to 15) were in secretory phase of the menstrual cycle (Fig. 1 ). The gene expression levels of the two menstrual phases were compared and no significant differences ( p > 0.10) in the organ-matched samples were found (data not shown). FRA protein expression in the fallopian tube, endometrium, and ovarian endometriosis by Western blot FRA protein level examination for the 15-paired samples was performed by Western blot. FRA protein expression was significantly higher in the fallopian tube and ovarian endometriosis samples than that in the endometrium, with an average fold of increment of 12.36 ( p = 0.001) and 9.72 ( p = 0.022), respectively. As expected, there were no significant differences between the fallopian tube and ovarian endometriosis samples ( p > 0.10). These results were compatible with the findings from real-time PCR validation, indicating that FOLR1 or FRA do not change significantly at the transcriptional and post-transcriptional levels. Western blots of 6 representative paired samples and pooled data of FRA protein expression are shown in Fig. 2 . FRA expression in tissue sections of the fallopian tube, endometrium, ovarian endometriosis and ovarian surface epithelia by immunohistochemistry A total of 114 tissue samples were analyzed with anti-FRA antibodies by IHC. These tissue sections represented the 32 paired tissue sections of the fallopian tube, endometrium, and ovarian endometriosis and additional 18 samples of ovarian endometriosis. All 32 normal fallopian tube samples showed strong and diffuse FRA expression as expected. The observed staining pattern was mostly intense cytoplasmic, with some extending to the luminal border of tubal epithelia. The staining score ranged from 185 to 300 with an average of 228 for the tubes. There were minor differences in FRA staining between tubal secretory and ciliated cells, with the latter showing stronger staining intensity on the luminal border than the former. However, these staining differences were not statistically significant (data not shown). In addition, compared with the menstrual phases, proliferative versus secretory, we did not observe a significant difference of FRA staining pattern or intensity in the tubal and endometrial epithelia. FRA expression in 32-paired and 18-non-paired ovarian endometriosis samples were also highly positive, with IHC scores ranging from 94 to 300 with an average of 160. The majority of the epithelial cells were positive for FRA stain. Among all the 50 cases with endometriosis, there were 38 cases showing staining intensity score 3, 8 score 2, and 4 score 1. There were no significant differences in FRA expression scores between the paired and non-paired endometriosis. FRA expression was negative in all Pax-8 negative OSE as well as in all Pax-8 negative OEIs (endosalpingiosis) from the 30 ovarian sections without endometriosis examined (data not shown). In the eutopic endometrial tissue sections, FRA expression was largely absent, with IHC scores that ranged from 0 to 84 (average 42). Typically, only focal areas of endometrial glands were positive with weak intensity at the luminal apical borders of the epithelial cells. Among the 32 endometrial samples, 26 were in proliferative and 6 in secretory phase; Occasional weak staining was seen in samples of both proliferative and secretory endometria with no clearly discernible differences in staining frequency or intensity. Compared with the endometrium, both tubal and ovarian endometriosis samples showed significantly higher FRA IHC scores with p = 0.00051 and p = 0.00174, respectively. Interestingly, the difference of FRA expression between the fallopian tube and ovarian endometriosis also reached a statistical significance ( p = 0.05) with the expression was higher in the tubal samples. The data is summarized in Fig. 3 , and representative IHC pictures of the FRA expression are presented in Fig. 4 . Stromal cells and blood vessels were all negative for FRA expression in all samples examined. Discussion Endometriosis remains a serious problem for reproductive-age women. The etiology and pathogenesis of endometriosis have been the subject of numerous investigations, although answers remain unclear [ 4 , 9 , 12 , 15 ]. Starting in 2005, our group described the earliest morphologic changes of endometriosis in the ovary, which we named “initial endometriosis” [ 4 ]. That study, which was largely based on light microscopic observations, provided morphologic evidence that retrograde menstruation may not explain how the initial endometriosis forms either on the ovarian surface or within the ovarian cortex. That study indirectly provided some supportive evidence that ovarian endometriosis may be derived from the fallopian tube. Morphologically, foci of initial endometriosis show gradual transitions from a typical example of endosalpingiosis (tubal type epithelia with ovarian stroma but without appreciable vascular changes) to areas with a classic appearance of endometriosis (endometrioid epithelia associated with endometrioid stromal cells and increased density of microcapillary vessels) [ 4 ]. Such morphologic transitions suggest that the foci of ovarian endometriosis started from the site within the ovary, rather than being deposited from retrograde menstrual endometrial tissue. From what being presented, we questioned the hypothesis of retrograde menstruation and proposed that tubal cells are a plausible tissue source for ovarian endometriosis [ 16 ]. Recent studies of the tubal origin of ovarian serous carcinomas [ 5 , 17 , 18 ] have highlighted many previously under-recognized biologic and physiologic properties of the fallopian tube. In vivo , the fallopian tube is in close spatial proximity to the ovary [ 5 , 7 , 17 , 19 , 20 ], tubal epithelia are easily sloughed from the tubal mucosae [ 17 , 21 ], and the majority of the endosalpingiosis or OEIs are originated from the fallopian tube. Moreover, endosalpingiosis or OEIs are readily observed in ovarian cortex in many ovarian endometriosis [ 5 ]. It is likely therefore that the relationship between endosalpingiosis and initial endometriosis represents a trans-differentiation process from the former to the latter, although detailed underlying mechanisms remain to be clarified. Given the well-known limitations of morphologic assessment to support the novel concept of tubal origin of ovarian endometriosis, we have shifted morphologic observations to molecular studies addressing the issue since 2014. In one of our previous studies, we identified a set of novel genes that are either highly expressed in the normal tubal or endometrial tissue through a gene differential array study [ 9 ]. In that study, FMO3 and DMBT1 were examined as the biomarkers to test the hypothesis if the fallopian tube contributes the formation of ovarian endometriosis. These biomarkers were then validated in those paired samples of ovarian endometriosis, normal tubal and endometrial tissue similar to the current study. We found that FMO3 was highly expressed in the fallopian tube while was low in the paired endometrial samples, whereas DMBT1 had the reverse findings. Based on those observations, we concluded that tubal epithelia contribute at least partially to the development of ovarian endometriosis. The current study used another biomarker, FRA (folate receptor alpha), which is highly differentially expressed in the tubal and endometrial tissues. FRA, the product of the FOLR1 gene, is a glycosylphosphatidylinositol (GPI)-anchored protein that binds plasma folate (5-methyltetrahydrofolate) and transports it into the cell via endocytosis [ 22 ]. Folate is essential for 1-carbon metabolism, transferring single carbon units in reactions involving purine and pyrimidine synthesis, DNA repair, and methylation of various biomolecules including DNA, proteins, phospholipids, and neurotransmitters [ 23 , 24 ]. Folate deficiency has been linked with dysregulation of these processes and, in some cases, is associated with an increased risk of developing cancer, including serous type epithelial ovarian tumors [ 14 , 25 – 27 ]. However, no specific data have been reported on the expression of FRA in normal fallopian tube relative to ovarian endometriosis or to evaluate what role, if any, FRA may play in the development of ovarian endometriosis. Since FOLR2 and its protein product FRA were highly differentially expressed in the tube and the eutopic endometrium, we assessed the tubal and endometrial samples with the FRA antibody on 50 patients with ovarian endometriosis (32 paired and 18 non-paired). We found that all fallopian tubal epithelia expressed FRA with strong intensity. In contrast, FRA expression in the endometrium was either negative or weakly and focally positive. Therefore, FRA may be considered a tubal-specific biomarker when compared to that of the endometrium. This result was quite consistent with whole-genome expression microarray analysis [ 9 ]. Among 18 non-matched ovarian endometriosis, 15 cases had strong or moderately membrane and intracellular staining. Only 3 (18%) samples showed a weak staining on apical luminal borders. Furthermore, Pax-8 positive epithelial cells on the ovarian surface and OEIs showed moderate to strong FRA expression, while Pax-8 negative epithelial cells on the ovarian surface and OEIs were negative for FRA, which is supportive of tubal origin of ovarian endometriosis. Morphologically ovarian surface like epithelia and OEIs have two origins with one originated from classic ovarian surface epithelia (OSE) (Pax-8 negative) and the other from fallopian tube (Pax-8 positive) [ 5 ]. Original OSE negative for FRA expression suggests that ovarian endometriosis is unlikely derived from OSE through a metaplastic process. In short, our findings from this study further support the hypothesis that ovarian endometriosis is at least partially derived from the fallopian tube. In our previous study [ 9 ], we estimated that approximately 60% of ovarian endometriosis may be originated from the tubal epithelia based on the FMO3 and DMBT1 expression study. This is correlated to the number of OEIs from fallopian tube [ 5 ]. The design of the current study does not allow such quantification; however, the findings bolster the argument that the majority of ovarian endometriosis comes from the fallopian tube rather from retrograde menstrual endometrium. Two essential conditions must be met to consider the fallopian tube to be the origin of endometriosis when present in the ovary. First, tubal cells must enter the ovary. Frequent detachment of tubal epithelia from fimbriated ends makes this possible. Tubal cells are easily retrieved by flushing the fallopian tube [ 17 , 21 ]. The process is further facilitated by juxtaposed spatial relationship between tubal fimbria and ovarian surface [ 19 , 28 ]. The rupture of ovarian surface caused by ovulation [ 29 , 30 ] provides a favorable condition for tubal epithelia to implant onto the ovary then get into ovarian cortex. The latter process, from a morphologic perspective, has long been described as endosalpingiosis [ 31 – 33 ]. Second, endosalpingiosis or OEI must transform itself into endometriosis. The latter probably occurs through metaplasia or trans-differentiation, a process that is commonly seen in the Müllerian system [ 34 ], although detailed molecular mechanism remains elucidated. Initial endometriosis within the ovary describes the morphologic transition of OEIs, with some glands of OEIs displaying the earliest morphologic changes of endometriosis in only half of the gland [ 4 ]. Metaplasia from tubal epithelia is the most likely explanation for this morphologic observation, especially since transitional areas from normal-appearing tubal epithelia to endometrial like tissue are commonly present [ 17 , 35 ]. In summary, a graphic abstract is illustrated in Fig. 5 . We may conclude, therefore, endometriotic or endometrioid epithelial cells are likely originated from tubal epithelia. However, by all means, so far we don’t have solid scientific evidence that ovarian endometriosis are either derived from or not coming from the endometrial cells from retrograde menstruation. Further studies in this regard are needed. The novel findings of this study have provided further evidence supporting our previously proffered theory of the tubal contributions for ovarian endometriosis. Although our findings remain preliminary, they might provide an alternative way of thinking about the etiology and pathogenesis of endometriosis that might aid the prevention and early treatment of ovarian endometriosis. Conclusions The folate receptor alpha gene FOLR1 identified through a differential gene array analysis is highly expressed in ovarian endometriosis and the fallopian tube epithelial cells. However, the expression level of FOLR1 and its protein FRA is significantly lower in the endometrium and ovarian surface epithelia. These novel findings further support that the fallopian tube is likely the cellular source of ovarian endometriosis. Understanding the tubal contribution to ovarian endometriosis should ultimately contribute to ongoing investigative efforts aimed at identifying alternative ways to prevent and treat endometriosis. Materials And Methods Tissue specimens Fresh tissue samples, including normal fallopian tube fimbria and corresponding endometrium were obtained from pathology specimens within 30 minutes of their surgical resections as described previously [ 9 ]. A total of 114 formalin fixed and paraffin-embedded tissues were obtained from Henan Provincial People’s Hospital, Zhengzhou, China. Among 114 samples, 96 were derived from 32 patients with each patient contributing 1 ovarian endometriosis, 1 endometrium and 1 fallopian tube sample and 18 patients each contributing one sample of ovarian endometriosis only. Among the 32-paired samples, 15 had fresh tissue samples available in addition to the formalin-fixed paraffin sections. The remaining 18 patients had ovarian endometriosis from formalin-fixed tissues only. In addition, 30 ovarian tissue sections containing Pax-8 negative OSE were included for FRA IHC stains. The representativeness of the ovarian endometriosis foci (n = 15) for quantitative PCR and Western blot analysis were confirmed by examining the corresponding frozen sections under the microscope. Foci of endometriosis, comprised predominantly of epithelial and stromal tissue, were manually dissected by removing non-endometriotic ovarian tissue. Patients’ age ranged from 22 to 50 years (mean 34.5). The reasons for total hysterectomy and bilateral salpingo-oophorectomy were prolonged ovarian endometriosis or benign gynecologic disorders including leiomyomata and benign ovarian cysts. No patient received hormonal treatment in 12 months prior to the surgery. Pathologic diagnosis of ovarian endometriosis were confirmed by two pathologists (RZ and WZ). Endometriosis, tubal mucosa and endometrium with both glandular epithelia and stroma were confirmed to be present under microscope. Determination of menstrual cycle phase (proliferative or secretory) for the 15-paired cases with both fresh and formalin-fixed tissues was made by examining hysterectomy specimens microscopically. Patients with a history of malignancy or tubal ligation were excluded. The research protocol was approved by the institutional review board of Henan Provincial People’s Hospital at Zhengzhou, Henan Province, China. Microarray and Data Analysis In order to identify tissue-specific biomarkers, we compared the gene expression profiles between the fallopian tube and the endometrium from patients without evidence of endometriosis by gene array analysis, as previously described [ 9 ]. The endometriosis samples were manually dissected after microscopic confirmation. Three pairs of fresh samples of fallopian tube fimbria and corresponding endometrial specimens mentioned above were sent to Kang Chen Bio-Tech (Shanghai, China) to perform whole-genome expression microarray analysis using the Agilent array platform (Agilent Technologies, Palo Alto, CA, USA). To limit potential confounding interferance, endometrial samples showing tubal metaplasia were excluded from the study. Total RNA from three pairs of hand-dissected epithelial samples under routine microscopy were prepared by using TRIzol (Invitrogen, Gaithersburg, MD, USA), further quantified by the NanoDrop 1000, and RNA integrity was confirmed by standard denaturing agarose gel electrophoresis. The Human Gene Expression Array was manufactured by Agilent with a cluster of 41000 genes and their corresponding transcripts and they are present in those public domain annotations. Array hybridization and sample labeling were done according to the protocol provided by Agilent Technologies (Palo Alto, CA, USA) as described elsewhere [ 36 ]. Median normalization and subsequent data processing were analyzed by using the GeneSpring GX software (version 11). Highly differentially expressed genes were selected for further analysis after normalization of the raw data. Differentially expressed genes were identified through fold change filtering. Hierarchical clustering analyses were carried out also by using the Agilent GeneSpring GX software. Analysis of gene ontology and pathway studies were performed by using the standard enrichment computation method. A gene was considered to be highly differentially expressed between the tubal fimbria and the endometrium if there was a ≥ 2-fold difference in its expression level between or among the tissue categories, and the p -value less than 0.05 was considered significant. Validation of Microarray Data by Real-Time PCR Multiple differentially expressed genes were verified and published previously [ 9 ]. In the current study, we examined another highly differentiated gene FOLR1 to further test the possibility of tubal contribution of ovarian endometriosis. To verify the gene expression data obtained from the microarray, real-time PCR was performed on FOLR1 gene, using total RNAs from 15-paired tubal fimbria and corresponding endometrial samples. Among the 15-paired specimens, 12 were in the proliferative phase and the remaining 3 were secretory endometria, which were determined based on endometrial morphology. The FOLR1 gene was selected in this study because it was 56-fold more expressed in the tubal samples compared with the endometria by gene array study. In addition, the antibody against corresponding protein FRA suitable for immunohistochemistry on FFPE tissue samples was recently available. FRA represents one of the glycosylphosphatidylinositol (GPI)-anchored receptors that bind plasma folate (5-methyltetrahydrofolate) with high affinity (K D ~1nM), and transport it into the cell via endocytosis [ 22 ]. Together with folate receptor beta, gamma, and delta, FRA lies in tandem on chromosome 11q13 [ 22 ], although much less is known about those other family members. FRA has been shown to be expressed in normal placenta, fallopian tube, kidney, lung, breast and choroid plexus [ 14 ]. GAPDH was used as internal control. Real-time PCR was done on 15-paired ovarian endometriosis, tubal, and endometrial samples. Primers were designed using Primer 3 software and the sequences were as follows. FOLR1: F5’- CCCGAGGACAAGTTGCATGA -3’ R5’- TCCACAGTGGTTCCAGTTGAATCTA -3’ GAPDH : F5’- AGCAAGAGCACAAAGAGGAAGAG -3’ R5’- TCTACATGGCAACTGTGAGGAG -3’ The protocol of real-time PCR was described elsewhere.[ 37 ] Data analysis was executed with StepOnePlus™ Real-Time PCR System software, version 2.2 (Applied Biosystem, Hercules, CA). Comparative Ct method (ΔΔCt) was used to obtain relative quantification of the gene expression levels. Quantification of the amplified products were normalized against GAPDH (ΔCt). Paired two-tailed t test was used to compare relative mRNA expression levels of the studied tissue samples. Statistical significance was defined as a p value < 0.05. Western Blot Analysis Monoclonal antibodies against FRA, 1:500 dilution, was obtained from Dr. Daniel O’Shannessy (Department of Diagnostics Development, Morphotek Inc., Exton, Pennsylvania). All samples mentioned above were subsequently evaluated for protein expression by Western blot, as described elsewhere [ 38 ]. GAPDH antibody (Abcam, USA) was used as the loading control. Immunohistochemistry Among many differentially expressed genes, folate receptor-alpha (FRA) was one of the most highly differentially expressed. Immunohistochemistry (IHC) stain with antibodies against FRA, mentioned above, was performed as described previously [ 14 ]. Normal fallopian tube samples served as a positive control since it is ubiquitously expressed in tubal epithelial cells [ 14 ]. Negative controls were carried out by replacing primary antibodies with class-matched mouse and rabbit IgGs on parallel sections. The subcellular staining localization for FRA was both cytoplasmic and membranous. IHC stained slides were evaluated and scored by counting at least 500 epithelial cells independently by two pathologists (RZ and WZ). Positive FRA expression was defined as discrete membrane and intracellular (mainly cytoplasmic) brown color with at least weak intensity within the epithelial cells. IHC scoring criteria have been described previously [ 14 ]. Briefly, the staining intensity was scored as 0 if negative, 1 if with weak intensity, 2 with moderate intensity, and 3 if strong and intensely stained. Tissues with score 3 staining showed an intensely positive pattern that was readily identifiable at low magnification (4× objective) under light microscope. Sometimes a complete circumferential staining was seen. Score 2 was only visible at the 10× objective level and it was typically localized to the apical luminal or occasionally to the lateral cell border. In contrast, score 1 stain was generally limited to the luminal borders, or required 20× to 40× objectives to confirm. Percentage of the positive cells at each intensity was calculated for each case. The final score was summarized by multiplying the staining intensity and the percentage of the positive cells for each sample [ 9 ]. Statistical Analysis Multiple comparisons among categories of ovarian endometriosis, benign tubal and endometrial tissues were carried out by using student t-test and SPSS statistical software program version 13.0 (SPSS, Chicago, IL, USA) when appropriate. P value < 0.05 was considered statistically significant. Declarations Ethics approval and consent to participate: Patient consent was waived due to the reason that the current study does not require patient consent since only residual tissues in the paraffin blocks were used after clinical diagnosis and management were completed Author’s contribution: WZ, YiW, YuW conceived the study design and experiments. RF, QL, YuW, RZ, ZY, LW, and YaW carried out experiments and data analysis. RF, QL, LW, and WL performed data analysis. RF, QL, YiW, WZ, RC, and OF wrote the manuscript. YiW, YuW, RZ, and WL provided the majority of cases with relevant clinical information. All authors were involved in editing and approving the final manuscript. Funding: This work was partially supported by grants from the Department of Science and Technology of Henan province (project number: 162102310174) to YW; Natural Science Foundation of Henan province (project number: ZC20180062) to YW. National Natural Science Foundation of China (project number: 81972441) to YW. The project was also supported in part by Mark and Jane Gibson Endowment fund to WZ. Informed Consent Statement: The patient consent was waived due to the reason that the current study does not require patient consent since only residual tissue in the paraffin blocks were used after clinical diagnosis and management were completed. Disclosure/Conflict of Interest: The authors declare no potential conflicts of interest. References JA, S., Peritoneal endometriosis due to menstrual dissemination of endometrial tissue into the peritoneal cavity. American journal of obstetrics and gynecology 1927, 14, 48. Halme, J.; Hammond, M. G.; Hulka, J. F.; Raj, S. G.; Talbert, L. M., Retrograde menstruation in healthy women and in patients with endometriosis. Obstetrics and gynecology 1984, 64, (2), 151-4. R, M., The current question of adenomyositis and adenomyomas in general and particularly seroepithelial adenomyositis and sarcomatoid adenomyometritis. Zentralbl Gynakol 1919, 43, 6. Zheng, W.; Li, N.; Wang, J.; Ulukus, E. C.; Ulukus, M.; Arici, A.; Liang, S. X., Initial endometriosis showing direct morphologic evidence of metaplasia in the pathogenesis of ovarian endometriosis. International journal of gynecological pathology : official journal of the International Society of Gynecological Pathologists 2005, 24, (2), 164-72. Li, J.; Abushahin, N.; Pang, S.; Xiang, L.; Chambers, S. K.; Fadare, O.; Kong, B.; Zheng, W., Tubal origin of 'ovarian' low-grade serous carcinoma. Mod Pathol 2011, 24, (11), 1488-99. Li, J.; Fadare, O.; Xiang, L.; Kong, B.; Zheng, W., Ovarian serous carcinoma: recent concepts on its origin and carcinogenesis. Journal of hematology & oncology 2012, 5, 8. Piek, J. M.; Kenemans, P.; Verheijen, R. H., Intraperitoneal serous adenocarcinoma: a critical appraisal of three hypotheses on its cause. American journal of obstetrics and gynecology 2004, 191, (3), 718-32. Meserve, E. E. K.; Mirkovic, J.; Conner, J. R.; Yang, E.; Muto, M. G.; Horowitz, N.; Strickland, K. C.; Howitt, B. E.; Crum, C. P., Frequency of "incidental" serous tubal intraepithelial carcinoma (STIC) in women without a history of or genetic risk factor for high-grade serous carcinoma: A six-year study. Gynecol Oncol 2017, 146, (1), 69-73. Yuan, Z.; Wang, L.; Wang, Y.; Zhang, T.; Li, L.; Cragun, J. M.; Chambers, S. K.; Kong, B.; Zheng, W., Tubal origin of ovarian endometriosis. Modern pathology : an official journal of the United States and Canadian Academy of Pathology, Inc 2014, 27, (8), 1154-62. JH, R., The histogenesis of endometriosis. Obstet Gynecol Surv 1968, 23, (35), 1. Gardner, G. H.; Greene, R. R.; Ranney, B., The histogenesis of endometriosis; recent contributions. Obstetrics and gynecology 1953, 1, (6), 615-37. Wang, Y.; Mang, M.; Wang, Y.; Wang, L.; Klein, R.; Kong, B.; Zheng, W., Tubal origin of ovarian endometriosis and clear cell and endometrioid carcinoma. American journal of cancer research 2015, 5, (3), 869-79. O'Shannessy, D. J.; Somers, E. B.; Albone, E.; Cheng, X.; Park, Y. C.; Tomkowicz, B. E.; Hamuro, Y.; Kohl, T. O.; Forsyth, T. M.; Smale, R.; Fu, Y. S.; Nicolaides, N. C., Characterization of the human folate receptor alpha via novel antibody-based probes. Oncotarget 2011, 2, (12), 1227-43. O'Shannessy, D. J.; Somers, E. B.; Smale, R.; Fu, Y. S., Expression of folate receptor-alpha (FRA) in gynecologic malignancies and its relationship to the tumor type. International journal of gynecological pathology : official journal of the International Society of Gynecological Pathologists 2013, 32, (3), 258-68. Giudice, L. C.; Kao, L. C., Endometriosis. Lancet (London, England) 2004, 364, (9447), 1789-99. Yuan Z; Wang Y; Cragun JM; Chambers SK; Zheng W, Cell origin of endometriosis: contribution by the fallopian tube epithelium. Am J Clin Exp Obstet Gynecol 2013, 1, (1), 37-42. Kurman, R. J.; Shih Ie, M., The origin and pathogenesis of epithelial ovarian cancer: a proposed unifying theory. The American journal of surgical pathology 2010, 34, (3), 433-43. Roh, M. H.; Kindelberger, D.; Crum, C. P., Serous tubal intraepithelial carcinoma and the dominant ovarian mass: clues to serous tumor origin? The American journal of surgical pathology 2009, 33, (3), 376-83. Eddy, C. A.; Pauerstein, C. J., Anatomy and physiology of the fallopian tube. Clinical obstetrics and gynecology 1980, 23, (4), 1177-93. Gordts, S.; Campo, R.; Rombauts, L.; Brosens, I., Endoscopic visualization of the process of fimbrial ovum retrieval in the human. Human reproduction (Oxford, England) 1998, 13, (6), 1425-8. Piek, J. M.; van Diest, P. J.; Zweemer, R. P.; Kenemans, P.; Verheijen, R. H., Tubal ligation and risk of ovarian cancer. Lancet (London, England) 2001, 358, (9284), 844. Kalli, K. R.; Oberg, A. L.; Keeney, G. L.; Christianson, T. J.; Low, P. S.; Knutson, K. L.; Hartmann, L. C., Folate receptor alpha as a tumor target in epithelial ovarian cancer. Gynecol Oncol 2008, 108, (3), 619-26. Liu, J. J.; Ward, R. L., Folate and one-carbon metabolism and its impact on aberrant DNA methylation in cancer. Adv Genet 2010, 71, 79-121. Kotsopoulos, J.; Hecht, J. L.; Marotti, J. D.; Kelemen, L. E.; Tworoger, S. S., Relationship between dietary and supplemental intake of folate, methionine, vitamin B6 and folate receptor alpha expression in ovarian tumors. Int J Cancer 2010, 126, (9), 2191-8. O'Shannessy, D. J.; Somers, E. B.; Palmer, L. M.; Thiel, R. P.; Oberoi, P.; Heath, R.; Marcucci, L., Serum folate receptor alpha, mesothelin and megakaryocyte potentiating factor in ovarian cancer: association to disease stage and grade and comparison to CA125 and HE4. J Ovarian Res 2013, 6, (1), 29. Necela, B. M.; Crozier, J. A.; Andorfer, C. A.; Lewis-Tuffin, L.; Kachergus, J. M.; Geiger, X. J.; Kalari, K. R.; Serie, D. J.; Sun, Z.; Moreno-Aspitia, A.; O'Shannessy, D. J.; Maltzman, J. D.; McCullough, A. E.; Pockaj, B. A.; Cunliffe, H. E.; Ballman, K. V.; Thompson, E. A.; Perez, E. A., Folate receptor-alpha (FOLR1) expression and function in triple negative tumors. PloS one 2015, 10, (3), e0122209. Kurosaki, A.; Hasegawa, K.; Kato, T.; Abe, K.; Hanaoka, T.; Miyara, A.; O'Shannessy, D. J.; Somers, E. B.; Yasuda, M.; Sekino, T.; Fujiwara, K., Serum folate receptor alpha as a biomarker for ovarian cancer: Implications for diagnosis, prognosis and predicting its local tumor expression. Int J Cancer 2016, 138, (8), 1994-2002. Dietl, J.; Wischhusen, J.; Hausler, S. F., The post-reproductive Fallopian tube: better removed? Human reproduction (Oxford, England) 2011, 26, (11), 2918-24. Fathalla, M. F., Incessant ovulation--a factor in ovarian neoplasia? Lancet (London, England) 1971, 2, (7716), 163. Chene, G.; Penault-Llorca, F.; Le Bouedec, G.; Mishellany, F.; Dauplat, M. M.; Jaffeux, P.; Aublet-Cuvelier, B.; Pouly, J. L.; Dechelotte, P.; Dauplat, J., Ovarian epithelial dysplasia after ovulation induction: time and dose effects. Human reproduction (Oxford, England) 2009, 24, (1), 132-8. Burmeister, R. E.; Fechner, R. E.; Franklin, R. R., Endosalpingiosis of the peritoneum. Obstetrics and gynecology 1969, 34, (3), 310-8. Tutschka, B. G.; Lauchlan, S. C., Endosalpingiosis. Obstetrics and gynecology 1980, 55, (3 Suppl), 57s-60s. Scully, R. E., Pathology of ovarian cancer precursors. Journal of cellular biochemistry. Supplement 1995, 23, 208-18. Fukunaga, M.; Ushigome, S., Epithelial metaplastic changes in ovarian endometriosis. Modern pathology : an official journal of the United States and Canadian Academy of Pathology, Inc 1998, 11, (8), 784-8. Nishida, M.; Watanabe, K.; Sato, N.; Ichikawa, Y., Malignant transformation of ovarian endometriosis. Gynecologic and obstetric investigation 2000, 50 Suppl 1, 18-25. Wang, J. L.; Lin, Y. W.; Chen, H. M.; Kong, X.; Xiong, H.; Shen, N.; Hong, J.; Fang, J. Y., Calcium prevents tumorigenesis in a mouse model of colorectal cancer. PloS one 2011, 6, (8), e22566. Wei, W.; Kong, B.; Qu, X., Alteration of HGF and TSP-1 expression in ovarian carcinoma associated with clinical features. J Obstet Gynaecol Res 2012, 38, (1), 57-64. Hong, S.; Li, X.; Zhao, Y.; Yang, Q.; Kong, B., 53BP1 suppresses tumor growth and promotes susceptibility to apoptosis of ovarian cancer cells through modulation of the Akt pathway. Oncol Rep 2012, 27, (4), 1251-7. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-746595","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research","associatedPublications":[],"authors":[{"id":43016628,"identity":"7da8f863-ec76-4513-9762-3fe17d496471","order_by":0,"name":"Rujia Fan","email":"","orcid":"","institution":"Henan Provincial People's Hospital","correspondingAuthor":false,"prefix":"","firstName":"Rujia","middleName":"","lastName":"Fan","suffix":""},{"id":43016629,"identity":"618ab223-d5f5-495e-9b5f-87db8d431844","order_by":1,"name":"Qiyan Li","email":"","orcid":"","institution":"Henan University People' hospital","correspondingAuthor":false,"prefix":"","firstName":"Qiyan","middleName":"","lastName":"Li","suffix":""},{"id":43016630,"identity":"8845d657-576d-48c5-8619-824d8224003f","order_by":2,"name":"Li Wei","email":"","orcid":"","institution":"Henan Provincial People's Hospital","correspondingAuthor":false,"prefix":"","firstName":"Li","middleName":"","lastName":"Wei","suffix":""},{"id":43016631,"identity":"4b610472-811d-46ef-8f4d-1ca10207a526","order_by":3,"name":"Ruijiao Zhao","email":"","orcid":"","institution":"Henan Provincial People's Hospital","correspondingAuthor":false,"prefix":"","firstName":"Ruijiao","middleName":"","lastName":"Zhao","suffix":""},{"id":43016632,"identity":"de713351-d019-4e6a-b691-d22ab28ebb33","order_by":4,"name":"Yan Wang","email":"","orcid":"","institution":"UT southwestern medical center","correspondingAuthor":false,"prefix":"","firstName":"Yan","middleName":"","lastName":"Wang","suffix":""},{"id":43016633,"identity":"57f6eecb-d7a6-41f4-8c41-dbb4e90425b6","order_by":5,"name":"Wanrun Lin","email":"","orcid":"https://orcid.org/0000-0003-0457-0097","institution":"UT Southwestern medical center","correspondingAuthor":false,"prefix":"","firstName":"Wanrun","middleName":"","lastName":"Lin","suffix":""},{"id":43016634,"identity":"a2a56ebf-7590-4f81-8d39-8eef0528df10","order_by":6,"name":"Jing Zhang","email":"","orcid":"","institution":"utsouthwestern medical center","correspondingAuthor":false,"prefix":"","firstName":"Jing","middleName":"","lastName":"Zhang","suffix":""},{"id":43016635,"identity":"f0326b52-a9df-4231-98d9-51e511b78ebe","order_by":7,"name":"Ruby Chang","email":"","orcid":"","institution":"UT Southwestern medical center","correspondingAuthor":false,"prefix":"","firstName":"Ruby","middleName":"","lastName":"Chang","suffix":""},{"id":43016636,"identity":"66942052-72a9-4d22-91c5-8caf7fc00a4b","order_by":8,"name":"Zeng Yuan","email":"","orcid":"","institution":"Shandong University Qilu Hospital","correspondingAuthor":false,"prefix":"","firstName":"Zeng","middleName":"","lastName":"Yuan","suffix":""},{"id":43016637,"identity":"4dcafcfc-6b82-43e3-af63-fbe3eb9b460a","order_by":9,"name":"Oluwole Fadare","email":"","orcid":"","institution":"University of California San Diego","correspondingAuthor":false,"prefix":"","firstName":"Oluwole","middleName":"","lastName":"Fadare","suffix":""},{"id":43016638,"identity":"8fd487b1-ceb6-4e94-8d7a-1dd359f46daa","order_by":10,"name":"Yiying Wang","email":"","orcid":"","institution":"Henan Provincial People's Hospital","correspondingAuthor":false,"prefix":"","firstName":"Yiying","middleName":"","lastName":"Wang","suffix":""},{"id":43016639,"identity":"95cbe0e2-d1a4-4efa-a945-514a3000d924","order_by":11,"name":"Yue Wang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA3klEQVRIiWNgGAWjYBADHn5mxsYHCRU1xGuRk2xvbjZ4cOYY8VqMDXqOt0k+bGEmrNTg+NnDr3nbbBI3SCS2VSQ2sDHwt3cn4NdyJi/NmrctLXE7UMuNxB0yDBJnzm7Aq8XsQI6ZMW/b4cSdM0BazrAxGEjkEtBy/g1Iy//EDTcS2woS25iJ0HIjx/gxb9sBY4MzB9sYiNJif+ONGeOcc8nAQG5slkg4c4yHoF8k+3OMP7wpswNGJfvDjz8qauT423vxawECNikeJB4PTnVIgPnjD2KUjYJRMApGwcgFALIyTw6fB5IhAAAAAElFTkSuQmCC","orcid":"","institution":"Henan Provincial People's Hospital","correspondingAuthor":true,"prefix":"","firstName":"Yue","middleName":"","lastName":"Wang","suffix":""},{"id":43016640,"identity":"fc3ef7b3-26b5-4354-877d-a63652ac08e7","order_by":12,"name":"Wenxin Zheng","email":"","orcid":"https://orcid.org/0000-0002-4284-2893","institution":"University of Texas Southwestern Medical Center","correspondingAuthor":false,"prefix":"","firstName":"Wenxin","middleName":"","lastName":"Zheng","suffix":""}],"badges":[],"createdAt":"2021-07-24 10:57:51","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-746595/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-746595/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":12069590,"identity":"2398c82e-e0a7-4fc0-b5aa-d23f6f21b483","added_by":"auto","created_at":"2021-08-03 15:03:16","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":323246,"visible":true,"origin":"","legend":"FOLR1 gene expression level in paired tubal, endometrial, and ovarian endometriosis \nComparisons of mRNA expression levels in the fallopian tube, the endometrium, and the foci of endometriosis by quantitative PCR in 15 individual paired cases (A) and the pooled data (B). FOLR1 levels in fallopian tube (FT) and ovarian endometriosis (OE) were similar, but both were higher than the observed FOLR1 level in the endometrium (E) [*p = 0.176 (FT vs. OE) and ** p = 0.0018 (E vs. OE)]. FT: fallopian tube; E: endometrium; OE: ovarian endometriosis.","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-746595/v1/81329112d024b168680edcc2.jpg"},{"id":12069591,"identity":"3d7fa396-c3fa-4296-b3cc-c4d0c3df7f12","added_by":"auto","created_at":"2021-08-03 15:03:16","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":297630,"visible":true,"origin":"","legend":"FRA protein expression level in paired tubal, endometrial, and ovarian endometriosis samples\nComparisons of protein level of expression, after normalization with GAPDH control, in the tubal, endometrial, and ovarian endometriosis were performed by Western blot analysis. Panel A shows Western blots from 6 paired samples and panel B represents the pooled data from 15 paired samples of the fallopian tube, endometrium and ovarian endometriosis after normalization of GAPDH. Similar to the gene expression levels, FRA protein was significantly higher in the fallopian tube and the ovarian endometriosis samples than in the endometrium [*p = 0.103 (FT vs. OE) and ** p = 0.001 (E vs. OE)]. FRA showed a strong band in all 6 samples of the fallopian tubal and ovarian endometriosis, and was barely detectable in the corresponding endometrium. Each experiment was conducted three times, and the data were expressed as mean ± standard error of the mean (SEM). FT: fallopian tube; E: endometrium; OE: ovarian endometriosis.","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-746595/v1/8b813981d876f8dc531c7888.jpg"},{"id":12069589,"identity":"88a7060a-04da-4b4f-afcf-4baa7f02b4f8","added_by":"auto","created_at":"2021-08-03 15:03:16","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":135628,"visible":true,"origin":"","legend":"FRA protein expression levels by immunohistochemical scores in paired tubal, endometrial, and ovarian endometriosis \nComparisons of FRA protein expression levels in the fallopian tube, the endometrium, and the lesions of endometriosis by IHC scores in 32 paired and 18 endometriosis cases (pooled data): FRA expression was significantly higher in the fallopian tube and ovarian endometriosis than in the endometrium [*p = 0.00051 (FT vs. E) and **p = 0.00174 (OE vs. E)]. The FRA expression level in the fallopian tube was also higher than the FRA level in the ovarian endometriosis, with the difference just attaining statistical significance (p = 0.05). FT: fallopian tube; E: endometrium; OE: ovarian endometriosis","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-746595/v1/3cb04c5a699ed481c08e1982.jpg"},{"id":12069593,"identity":"91c2d232-9760-4098-a2d8-be29d77a6227","added_by":"auto","created_at":"2021-08-03 15:03:16","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":911141,"visible":true,"origin":"","legend":"FRA protein detection by immunohistochemistry in fallopian tubal, ovarian endometriosis, endosalpingiosis, and endometrial tissue sections\nRepresentative IHC stains of FRA showed strong diffuse FRA expression in the fallopian tube (left column, A, E, I), ovarian endometriosis (left mid, B, F, J), and ovarian endosalpingiosis (right mid, C, G, K), but only focal and weak staining was observed in a case of proliferative endometrium (right column, D, H, L). FRA staining was mainly cytoplasmic. Membranous stains can be seen when the staining intensity is moderate (E) and luminal stains are more prominent when stains become weak or moderate and magnified (I and L). Histologic H\u0026E sections are arranged on the top panel. FRA expression in the fallopian tube is illustrated in panels E and I, where I (200x) represents the magnification of part of E (100x). FRA expression in 2 ovarian endometriosis cases, with one showing high (F, 100x) and one showing intermediate (J, 100x) FRA expression levels. FRA expression in endosalpingiosis is shown in panels G (100x) and K (200x). Focal glandular with a mainly luminal pattern is seen in an endometrial sample (H, 100x; L, 200x).","description":"","filename":"Figure4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-746595/v1/fdf36f62b9918f946a995d70.jpg"},{"id":12069592,"identity":"f6f263e8-0c0e-4eed-b469-1bc795ca5762","added_by":"auto","created_at":"2021-08-03 15:03:16","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1606838,"visible":true,"origin":"","legend":"Graphic abstract of the process of ovarian endometriosis developed from tubal epithelia\nTop panel shows tubal fimbriated end adherent to the ovary. Tubal epithelia (1) spreads to the ovarian surface (2), invaginates onto ovary through adhesions (3), and forms endosalpingiosis or ovarian epithelial inclusions (4). Mid-panel shows magnified morphology as well as Pax-8 IHC stains of tubal epithelia (5), epithelia on the ovarian surface (6), epithelia within ovarian surface adhesions (7), and endosalpingiosis (8). Low-panel shows endometriosis develops from initial endometriosis within the ovary. Endosalpingiosis like gland start to have endometrioid stroma and increased micro capillary vessels (9), more apparent in a magnified view (10), endometriosis without evidence of bleeding (11), and typical appearance of endometriosis in the ovary (12).","description":"","filename":"Figure5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-746595/v1/5d8854d86ade41a09bc9c972.jpg"},{"id":13707055,"identity":"c7577ce4-0262-47f3-aab3-6ac1038fde00","added_by":"auto","created_at":"2021-09-17 14:00:44","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":928653,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-746595/v1/6ebb673e-ab8a-48df-a428-303a8fd70afa.pdf"}],"financialInterests":"","formattedTitle":"\u003cp\u003eFolate Receptor Alpha Expression in Fallopian Tube: Further Evidence Supporting Tubal Contribution of “Ovarian” Endometriosis\u003c/p\u003e","fulltext":[{"header":"Background","content":"\u003cp\u003eEndometriosis, one of the most common gynecologic disorders, is a bewildering and debilitating disease that affects millions of women in the world. Endometriosis, defined by the presence of endometrial tissue outside the uterus, can be divided into two categories with one inside and the other outside of the ovary. The ovarian endometriosis is the most common. Clinical symptoms of endometriosis are numerous and may include dysmenorrhea, dyspareunia, menorrhagia, dyschezia, pelvic and abdominal pain, infertility, and symptoms from gastrointestinal tract.\u003c/p\u003e \u003cp\u003ePathogenesis of endometriosis remains unclear. The most popular hypothesis is the retrograde menstruation theory, which was originally proposed by Sampson [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e] in 1927. Although it is popular, it remains controversial for a variety of reasons. Retrograde menstruation is thought to occur in up to 90% of reproductive age women [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e], but only 6\u0026ndash;10% of these women have clinical symptoms related to endometriosis [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Additionally, the theory falls flat to explain the presence of endometriosis outside the peritoneal cavity. The coelomic metaplasia hypothesis proposed by Meyer[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e] states that endometriosis may originate from mesothelial cells through a metaplastic process, although how the metaplasia happens is ambiguous. Initial endometriosis, which our group described in 2005 [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e], represents a spectrum of the earliest morphologically identifiable changes of endometriosis within the ovary. At that time, we assumed that the morphologic transitions from ovarian surface epithelia or ovarian epithelial inclusions (OEI) to initial endometriosis lesions represented a metaplastic process from OSE as discussed in 2005 [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. However, nowadays we realize that the majority of epithelia attached on the ovarian surface and OEIs are derived from the fallopian tube. This was found when we studied the origin of OEIs from the fallopian tube epithelia vs ovarian surface mesothelia in 2011 [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe fallopian tube, particularly tubal fimbriated end, has recently caught great attention in studies of adnexal pathology and the origin of ovarian serous cancers. This is mainly because most investigators believe that the majority ovarian serous cancers are actually derived from the fallopian tube, not the ovary as was historically asumed [\u003cspan additionalcitationids=\"CR7\" citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Similarly, in our study of the cellular origins of OEIs, we found that the majority OEIs (also called endosalpingiosis) display a phenotype suggesting they are derived directly from tubal epithelial cells rather than from ovarian surface mesothelial cells [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Indeed, microscopic examination of resected ovarian and tubal tissues frequently shows various stages of the following sequence: tubal epithelia mostly from fimbriated end are frequently adherent on the ovarian surface, accompanied by invagination of morphologically similar epithelia onto ovarian surface, then invaginate into the cortex forming OEIs or endosalpingiosis [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. From those findings, we believe cellular metaplasia that eventuates in the formation of ovarian initial endometriosis occurs through the conversion of tubal-like epithelia within the ovarian cortex into endometriosis-like tissue, rather than the conversion of ovarian surface mesothelial cells into endometriosis-like tissue. The potential for tubal mucosal epithelia to convert into endometriosis-like tissue is also supported by the phenomenon of \u0026ldquo;endometrialization\u0026rdquo; of the proximal end of the fallopian tube after a tubal ligation procedure [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Based in part on the aforementioned morphological findings, we first proposed the hypothesis that tubal epithelia contribute to the formation of ovarian endometriosis in 2014 and 2015 [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe biomarker FRA (folate receptor alpha), the product of the \u003cem\u003eFOLR1\u003c/em\u003e gene, has previously been shown to be differentially expressed between the fallopian tube and the endometrium [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. In this study, we aimed to investigate FRA expression in tissue samples of human ovarian endometriosis and normal tubal and endometrial tissue samples to further examine the cellular origin of the ovarian endometriosis.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv class=\"Section2\" id=\"Sec3\"\u003e\n \u003ch2\u003eMultiple unique genes identified in the fallopian tube over the endometrium\u003c/h2\u003e\n \u003cp\u003eA total of 4114 and 3451 genes were identified from the tubal and endometrial samples, respectively. The gene expression profiles of the paired tubal and endometrial samples were compared using a Volcano Plot. The threshold for a differentially expressed genes between the tubal and endometrium was set at \u0026ge; 2.0-fold level. There were 1796 genes identified with more than two-fold differential expressions between the two tissue samples. All differentially expressed genes were further scrutinized and some representative genes were listed and studied previously[\u003cspan class=\"CitationRef\"\u003e9\u003c/span\u003e].\u003c/p\u003e\n \u003cp\u003eCompared with the endometrial samples, the tubes showed a total of 911 upregulated genes. These included genes that were \u0026ge;\u0026thinsp;50-fold (n = 8), \u0026ge;\u0026thinsp;20-fold (n = 28) and \u0026ge;\u0026thinsp;2-fold (n\u0026thinsp;=\u0026thinsp;875) comparatively upregulated in the fallopian tube. There were no genes with more than 50-fold upregulation in the endometrial sample relative to the tubal tissue. \u003cem\u003eFOLR1\u003c/em\u003e (gene bank accessing number NM_016729), which was not listed previously and represented another most differentially expressed gene, showed 55.6-fold increment in the tubal sample compared to the gene expression level at the endometrium (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.012831689).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec4\"\u003e\n \u003ch2\u003eFOLR1 gene detection in the fallopian tube, endometrium, and ovarian endometriosis by real-time PCR\u003c/h2\u003e\n \u003cp\u003eReal-time PCR was used to examine the level of \u003cem\u003eFOLR1\u003c/em\u003e expression in 15 paired fresh tissue samples (total of 45 samples, including 15 each of the fallopian tube, endometrium, and ovarian endometriosis specimens). \u003cem\u003eFOLR1\u003c/em\u003e was highly expressed in the fallopian tube compared with the paired endometrium, with fold increment ranging from 9 to 35 (average fold change\u0026thinsp;=\u0026thinsp;18.25, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001). Similarly, the \u003cem\u003eFOLR1\u003c/em\u003e gene was highly expressed in the samples of ovarian endometriosis compared with the paired endometrium, with fold increment ranging from 3 to 20 (average fold change\u0026thinsp;=\u0026thinsp;11.18, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001). However, although there were some expression level differences between the fallopian tube and ovarian endometriosis samples, the difference did not reach statistical significance (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.125). The gene expression level from the 15-paired cases, together with pooled data, is shown in Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e. Among these 15-paired samples, 12 pairs (from 1 to 12) were in the proliferative phase and 3 (13 to 15) were in secretory phase of the menstrual cycle (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). The gene expression levels of the two menstrual phases were compared and no significant differences (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.10) in the organ-matched samples were found (data not shown).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec5\"\u003e\n \u003ch2\u003eFRA protein expression in the fallopian tube, endometrium, and ovarian endometriosis by Western blot\u003c/h2\u003e\n \u003cp\u003eFRA protein level examination for the 15-paired samples was performed by Western blot. FRA protein expression was significantly higher in the fallopian tube and ovarian endometriosis samples than that in the endometrium, with an average fold of increment of 12.36 (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.001) and 9.72 (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.022), respectively. As expected, there were no significant differences between the fallopian tube and ovarian endometriosis samples (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.10). These results were compatible with the findings from real-time PCR validation, indicating that \u003cem\u003eFOLR1\u003c/em\u003e or FRA do not change significantly at the transcriptional and post-transcriptional levels. Western blots of 6 representative paired samples and pooled data of FRA protein expression are shown in Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e\n \u003ch2\u003eFRA expression in tissue sections of the fallopian tube, endometrium, ovarian endometriosis and ovarian surface epithelia by immunohistochemistry\u003c/h2\u003e\n \u003cp\u003eA total of 114 tissue samples were analyzed with anti-FRA antibodies by IHC. These tissue sections represented the 32 paired tissue sections of the fallopian tube, endometrium, and ovarian endometriosis and additional 18 samples of ovarian endometriosis. All 32 normal fallopian tube samples showed strong and diffuse FRA expression as expected. The observed staining pattern was mostly intense cytoplasmic, with some extending to the luminal border of tubal epithelia. The staining score ranged from 185 to 300 with an average of 228 for the tubes. There were minor differences in FRA staining between tubal secretory and ciliated cells, with the latter showing stronger staining intensity on the luminal border than the former. However, these staining differences were not statistically significant (data not shown). In addition, compared with the menstrual phases, proliferative versus secretory, we did not observe a significant difference of FRA staining pattern or intensity in the tubal and endometrial epithelia.\u003c/p\u003e\n \u003cp\u003eFRA expression in 32-paired and 18-non-paired ovarian endometriosis samples were also highly positive, with IHC scores ranging from 94 to 300 with an average of 160. The majority of the epithelial cells were positive for FRA stain. Among all the 50 cases with endometriosis, there were 38 cases showing staining intensity score 3, 8 score 2, and 4 score 1. There were no significant differences in FRA expression scores between the paired and non-paired endometriosis. FRA expression was negative in all Pax-8 negative OSE as well as in all Pax-8 negative OEIs (endosalpingiosis) from the 30 ovarian sections without endometriosis examined (data not shown).\u003c/p\u003e\n \u003cp\u003eIn the eutopic endometrial tissue sections, FRA expression was largely absent, with IHC scores that ranged from 0 to 84 (average 42). Typically, only focal areas of endometrial glands were positive with weak intensity at the luminal apical borders of the epithelial cells. Among the 32 endometrial samples, 26 were in proliferative and 6 in secretory phase; Occasional weak staining was seen in samples of both proliferative and secretory endometria with no clearly discernible differences in staining frequency or intensity.\u003c/p\u003e\n \u003cp\u003eCompared with the endometrium, both tubal and ovarian endometriosis samples showed significantly higher FRA IHC scores with \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.00051 and \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.00174, respectively. Interestingly, the difference of FRA expression between the fallopian tube and ovarian endometriosis also reached a statistical significance (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.05) with the expression was higher in the tubal samples. The data is summarized in Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e, and representative IHC pictures of the FRA expression are presented in Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e. Stromal cells and blood vessels were all negative for FRA expression in all samples examined.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eEndometriosis remains a serious problem for reproductive-age women. The etiology and pathogenesis of endometriosis have been the subject of numerous investigations, although answers remain unclear [\u003cspan class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e15\u003c/span\u003e]. Starting in 2005, our group described the earliest morphologic changes of endometriosis in the ovary, which we named \u0026ldquo;initial endometriosis\u0026rdquo; [\u003cspan class=\"CitationRef\"\u003e4\u003c/span\u003e]. That study, which was largely based on light microscopic observations, provided morphologic evidence that retrograde menstruation may not explain how the initial endometriosis forms either on the ovarian surface or within the ovarian cortex. That study indirectly provided some supportive evidence that ovarian endometriosis may be derived from the fallopian tube. Morphologically, foci of initial endometriosis show gradual transitions from a typical example of endosalpingiosis (tubal type epithelia with ovarian stroma but without appreciable vascular changes) to areas with a classic appearance of endometriosis (endometrioid epithelia associated with endometrioid stromal cells and increased density of microcapillary vessels) [\u003cspan class=\"CitationRef\"\u003e4\u003c/span\u003e]. Such morphologic transitions suggest that the foci of ovarian endometriosis started from the site within the ovary, rather than being deposited from retrograde menstrual endometrial tissue.\u003c/p\u003e\n\u003cp\u003eFrom what being presented, we questioned the hypothesis of retrograde menstruation and proposed that tubal cells are a plausible tissue source for ovarian endometriosis [\u003cspan class=\"CitationRef\"\u003e16\u003c/span\u003e]. Recent studies of the tubal origin of ovarian serous carcinomas [\u003cspan class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e18\u003c/span\u003e] have highlighted many previously under-recognized biologic and physiologic properties of the fallopian tube. \u003cem\u003eIn vivo\u003c/em\u003e, the fallopian tube is in close spatial proximity to the ovary [\u003cspan class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e20\u003c/span\u003e], tubal epithelia are easily sloughed from the tubal mucosae [\u003cspan class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e21\u003c/span\u003e], and the majority of the endosalpingiosis or OEIs are originated from the fallopian tube. Moreover, endosalpingiosis or OEIs are readily observed in ovarian cortex in many ovarian endometriosis [\u003cspan class=\"CitationRef\"\u003e5\u003c/span\u003e]. It is likely therefore that the relationship between endosalpingiosis and initial endometriosis represents a trans-differentiation process from the former to the latter, although detailed underlying mechanisms remain to be clarified.\u003c/p\u003e\n\u003cp\u003eGiven the well-known limitations of morphologic assessment to support the novel concept of tubal origin of ovarian endometriosis, we have shifted morphologic observations to molecular studies addressing the issue since 2014. In one of our previous studies, we identified a set of novel genes that are either highly expressed in the normal tubal or endometrial tissue through a gene differential array study [\u003cspan class=\"CitationRef\"\u003e9\u003c/span\u003e]. In that study, \u003cem\u003eFMO3\u003c/em\u003e and \u003cem\u003eDMBT1\u003c/em\u003e were examined as the biomarkers to test the hypothesis if the fallopian tube contributes the formation of ovarian endometriosis. These biomarkers were then validated in those paired samples of ovarian endometriosis, normal tubal and endometrial tissue similar to the current study. We found that \u003cem\u003eFMO3\u003c/em\u003e was highly expressed in the fallopian tube while was low in the paired endometrial samples, whereas \u003cem\u003eDMBT1\u003c/em\u003e had the reverse findings. Based on those observations, we concluded that tubal epithelia contribute at least partially to the development of ovarian endometriosis.\u003c/p\u003e\n\u003cp\u003eThe current study used another biomarker, FRA (folate receptor alpha), which is highly differentially expressed in the tubal and endometrial tissues. FRA, the product of the \u003cem\u003eFOLR1\u003c/em\u003e gene, is a glycosylphosphatidylinositol (GPI)-anchored protein that binds plasma folate (5-methyltetrahydrofolate) and transports it into the cell via endocytosis [\u003cspan class=\"CitationRef\"\u003e22\u003c/span\u003e]. Folate is essential for 1-carbon metabolism, transferring single carbon units in reactions involving purine and pyrimidine synthesis, DNA repair, and methylation of various biomolecules including DNA, proteins, phospholipids, and neurotransmitters [\u003cspan class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e24\u003c/span\u003e]. Folate deficiency has been linked with dysregulation of these processes and, in some cases, is associated with an increased risk of developing cancer, including serous type epithelial ovarian tumors [\u003cspan class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e25\u003c/span\u003e\u0026ndash;\u003cspan class=\"CitationRef\"\u003e27\u003c/span\u003e]. However, no specific data have been reported on the expression of FRA in normal fallopian tube relative to ovarian endometriosis or to evaluate what role, if any, FRA may play in the development of ovarian endometriosis.\u003c/p\u003e\n\u003cp\u003eSince \u003cem\u003eFOLR2\u003c/em\u003e and its protein product FRA were highly differentially expressed in the tube and the eutopic endometrium, we assessed the tubal and endometrial samples with the FRA antibody on 50 patients with ovarian endometriosis (32 paired and 18 non-paired). We found that all fallopian tubal epithelia expressed FRA with strong intensity. In contrast, FRA expression in the endometrium was either negative or weakly and focally positive. Therefore, FRA may be considered a tubal-specific biomarker when compared to that of the endometrium. This result was quite consistent with whole-genome expression microarray analysis [\u003cspan class=\"CitationRef\"\u003e9\u003c/span\u003e]. Among 18 non-matched ovarian endometriosis, 15 cases had strong or moderately membrane and intracellular staining. Only 3 (18%) samples showed a weak staining on apical luminal borders. Furthermore, Pax-8 positive epithelial cells on the ovarian surface and OEIs showed moderate to strong FRA expression, while Pax-8 negative epithelial cells on the ovarian surface and OEIs were negative for FRA, which is supportive of tubal origin of ovarian endometriosis. Morphologically ovarian surface like epithelia and OEIs have two origins with one originated from classic ovarian surface epithelia (OSE) (Pax-8 negative) and the other from fallopian tube (Pax-8 positive) [\u003cspan class=\"CitationRef\"\u003e5\u003c/span\u003e]. Original OSE negative for FRA expression suggests that ovarian endometriosis is unlikely derived from OSE through a metaplastic process. In short, our findings from this study further support the hypothesis that ovarian endometriosis is at least partially derived from the fallopian tube. In our previous study [\u003cspan class=\"CitationRef\"\u003e9\u003c/span\u003e], we estimated that approximately 60% of ovarian endometriosis may be originated from the tubal epithelia based on the \u003cem\u003eFMO3\u003c/em\u003e and \u003cem\u003eDMBT1\u003c/em\u003e expression study. This is correlated to the number of OEIs from fallopian tube [\u003cspan class=\"CitationRef\"\u003e5\u003c/span\u003e]. The design of the current study does not allow such quantification; however, the findings bolster the argument that the majority of ovarian endometriosis comes from the fallopian tube rather from retrograde menstrual endometrium.\u003c/p\u003e\n\u003cp\u003eTwo essential conditions must be met to consider the fallopian tube to be the origin of endometriosis when present in the ovary. First, tubal cells must enter the ovary. Frequent detachment of tubal epithelia from fimbriated ends makes this possible. Tubal cells are easily retrieved by flushing the fallopian tube [\u003cspan class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e21\u003c/span\u003e]. The process is further facilitated by juxtaposed spatial relationship between tubal fimbria and ovarian surface [\u003cspan class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e28\u003c/span\u003e]. The rupture of ovarian surface caused by ovulation [\u003cspan class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e30\u003c/span\u003e] provides a favorable condition for tubal epithelia to implant onto the ovary then get into ovarian cortex. The latter process, from a morphologic perspective, has long been described as endosalpingiosis [\u003cspan class=\"CitationRef\"\u003e31\u003c/span\u003e\u0026ndash;\u003cspan class=\"CitationRef\"\u003e33\u003c/span\u003e]. Second, endosalpingiosis or OEI must transform itself into endometriosis. The latter probably occurs through metaplasia or trans-differentiation, a process that is commonly seen in the M\u0026uuml;llerian system [\u003cspan class=\"CitationRef\"\u003e34\u003c/span\u003e], although detailed molecular mechanism remains elucidated. Initial endometriosis within the ovary describes the morphologic transition of OEIs, with some glands of OEIs displaying the earliest morphologic changes of endometriosis in only half of the gland [\u003cspan class=\"CitationRef\"\u003e4\u003c/span\u003e]. Metaplasia from tubal epithelia is the most likely explanation for this morphologic observation, especially since transitional areas from normal-appearing tubal epithelia to endometrial like tissue are commonly present [\u003cspan class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e35\u003c/span\u003e]. In summary, a graphic abstract is illustrated in Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e. We may conclude, therefore, endometriotic or endometrioid epithelial cells are likely originated from tubal epithelia. However, by all means, so far we don\u0026rsquo;t have solid scientific evidence that ovarian endometriosis are either derived from or not coming from the endometrial cells from retrograde menstruation. Further studies in this regard are needed.\u003c/p\u003e\n\u003cp\u003eThe novel findings of this study have provided further evidence supporting our previously proffered theory of the tubal contributions for ovarian endometriosis. Although our findings remain preliminary, they might provide an alternative way of thinking about the etiology and pathogenesis of endometriosis that might aid the prevention and early treatment of ovarian endometriosis.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eThe folate receptor alpha gene \u003cem\u003eFOLR1\u003c/em\u003e identified through a differential gene array analysis is highly expressed in ovarian endometriosis and the fallopian tube epithelial cells. However, the expression level of \u003cem\u003eFOLR1\u003c/em\u003e and its protein FRA is significantly lower in the endometrium and ovarian surface epithelia. These novel findings further support that the fallopian tube is likely the cellular source of ovarian endometriosis. Understanding the tubal contribution to ovarian endometriosis should ultimately contribute to ongoing investigative efforts aimed at identifying alternative ways to prevent and treat endometriosis.\u003c/p\u003e"},{"header":"Materials And Methods","content":"\u003cdiv class=\"Section2\" id=\"Sec9\"\u003e\n \u003ch2\u003eTissue specimens\u003c/h2\u003e\n \u003cp\u003eFresh tissue samples, including normal fallopian tube fimbria and corresponding endometrium were obtained from pathology specimens within 30 minutes of their surgical resections as described previously [\u003cspan class=\"CitationRef\"\u003e9\u003c/span\u003e]. A total of 114 formalin fixed and paraffin-embedded tissues were obtained from Henan Provincial People\u0026rsquo;s Hospital, Zhengzhou, China. Among 114 samples, 96 were derived from 32 patients with each patient contributing 1 ovarian endometriosis, 1 endometrium and 1 fallopian tube sample and 18 patients each contributing one sample of ovarian endometriosis only. Among the 32-paired samples, 15 had fresh tissue samples available in addition to the formalin-fixed paraffin sections. The remaining 18 patients had ovarian endometriosis from formalin-fixed tissues only. In addition, 30 ovarian tissue sections containing Pax-8 negative OSE were included for FRA IHC stains. The representativeness of the ovarian endometriosis foci (n\u0026thinsp;=\u0026thinsp;15) for quantitative PCR and Western blot analysis were confirmed by examining the corresponding frozen sections under the microscope. Foci of endometriosis, comprised predominantly of epithelial and stromal tissue, were manually dissected by removing non-endometriotic ovarian tissue.\u003c/p\u003e\n \u003cp\u003ePatients\u0026rsquo; age ranged from 22 to 50 years (mean 34.5). The reasons for total hysterectomy and bilateral salpingo-oophorectomy were prolonged ovarian endometriosis or benign gynecologic disorders including leiomyomata and benign ovarian cysts. No patient received hormonal treatment in 12 months prior to the surgery. Pathologic diagnosis of ovarian endometriosis were confirmed by two pathologists (RZ and WZ). Endometriosis, tubal mucosa and endometrium with both glandular epithelia and stroma were confirmed to be present under microscope. Determination of menstrual cycle phase (proliferative or secretory) for the 15-paired cases with both fresh and formalin-fixed tissues was made by examining hysterectomy specimens microscopically. Patients with a history of malignancy or tubal ligation were excluded. The research protocol was approved by the institutional review board of Henan Provincial People\u0026rsquo;s Hospital at Zhengzhou, Henan Province, China.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec10\"\u003e\n \u003ch2\u003eMicroarray and Data Analysis\u003c/h2\u003e\n \u003cp\u003eIn order to identify tissue-specific biomarkers, we compared the gene expression profiles between the fallopian tube and the endometrium from patients without evidence of endometriosis by gene array analysis, as previously described [\u003cspan class=\"CitationRef\"\u003e9\u003c/span\u003e]. The endometriosis samples were manually dissected after microscopic confirmation. Three pairs of fresh samples of fallopian tube fimbria and corresponding endometrial specimens mentioned above were sent to Kang Chen Bio-Tech (Shanghai, China) to perform whole-genome expression microarray analysis using the Agilent array platform (Agilent Technologies, Palo Alto, CA, USA). To limit potential confounding interferance, endometrial samples showing tubal metaplasia were excluded from the study. Total RNA from three pairs of hand-dissected epithelial samples under routine microscopy were prepared by using TRIzol (Invitrogen, Gaithersburg, MD, USA), further quantified by the NanoDrop 1000, and RNA integrity was confirmed by standard denaturing agarose gel electrophoresis. The Human Gene Expression Array was manufactured by Agilent with a cluster of 41000 genes and their corresponding transcripts and they are present in those public domain annotations.\u003c/p\u003e\n \u003cp\u003eArray hybridization and sample labeling were done according to the protocol provided by Agilent Technologies (Palo Alto, CA, USA) as described elsewhere [\u003cspan class=\"CitationRef\"\u003e36\u003c/span\u003e]. Median normalization and subsequent data processing were analyzed by using the GeneSpring GX software (version 11). Highly differentially expressed genes were selected for further analysis after normalization of the raw data. Differentially expressed genes were identified through fold change filtering. Hierarchical clustering analyses were carried out also by using the Agilent GeneSpring GX software. Analysis of gene ontology and pathway studies were performed by using the standard enrichment computation method. A gene was considered to be highly differentially expressed between the tubal fimbria and the endometrium if there was a\u0026thinsp;\u0026ge;\u0026thinsp;2-fold difference in its expression level between or among the tissue categories, and the \u003cem\u003ep\u003c/em\u003e-value less than 0.05 was considered significant.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec11\"\u003e\n \u003ch2\u003eValidation of Microarray Data by Real-Time PCR\u003c/h2\u003e\n \u003cp\u003eMultiple differentially expressed genes were verified and published previously [\u003cspan class=\"CitationRef\"\u003e9\u003c/span\u003e]. In the current study, we examined another highly differentiated gene \u003cem\u003eFOLR1\u003c/em\u003e to further test the possibility of tubal contribution of ovarian endometriosis.\u003c/p\u003e\n \u003cp\u003eTo verify the gene expression data obtained from the microarray, real-time PCR was performed on \u003cem\u003eFOLR1\u003c/em\u003e gene, using total RNAs from 15-paired tubal fimbria and corresponding endometrial samples. Among the 15-paired specimens, 12 were in the proliferative phase and the remaining 3 were secretory endometria, which were determined based on endometrial morphology. The \u003cem\u003eFOLR1\u003c/em\u003e gene was selected in this study because it was 56-fold more expressed in the tubal samples compared with the endometria by gene array study. In addition, the antibody against corresponding protein FRA suitable for immunohistochemistry on FFPE tissue samples was recently available. FRA represents one of the glycosylphosphatidylinositol (GPI)-anchored receptors that bind plasma folate (5-methyltetrahydrofolate) with high affinity (K\u003csub\u003eD\u003c/sub\u003e ~1nM), and transport it into the cell via endocytosis [\u003cspan class=\"CitationRef\"\u003e22\u003c/span\u003e]. Together with folate receptor beta, gamma, and delta, FRA lies in tandem on chromosome 11q13 [\u003cspan class=\"CitationRef\"\u003e22\u003c/span\u003e], although much less is known about those other family members. FRA has been shown to be expressed in normal placenta, fallopian tube, kidney, lung, breast and choroid plexus [\u003cspan class=\"CitationRef\"\u003e14\u003c/span\u003e].\u003c/p\u003e\n \u003cp\u003eGAPDH was used as internal control. Real-time PCR was done on 15-paired ovarian endometriosis, tubal, and endometrial samples. Primers were designed using Primer 3 software and the sequences were as follows.\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eFOLR1:\u003c/em\u003e F5\u0026rsquo;- CCCGAGGACAAGTTGCATGA -3\u0026rsquo;\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eR5\u0026rsquo;-\u0026nbsp;TCCACAGTGGTTCCAGTTGAATCTA\u0026nbsp;-3\u0026rsquo;\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eGAPDH\u003c/em\u003e: F5\u0026rsquo;- AGCAAGAGCACAAAGAGGAAGAG -3\u0026rsquo;\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eR5\u0026rsquo;- TCTACATGGCAACTGTGAGGAG -3\u0026rsquo;\u003c/p\u003e\n \u003cdiv class=\"Section3\" id=\"Sec13\"\u003e\n \u003cp\u003eThe protocol of real-time PCR was described elsewhere.[\u003cspan class=\"CitationRef\"\u003e37\u003c/span\u003e] Data analysis was executed with StepOnePlus\u0026trade; Real-Time PCR System software, version 2.2 (Applied Biosystem, Hercules, CA). Comparative Ct method (\u0026Delta;\u0026Delta;Ct) was used to obtain relative quantification of the gene expression levels. Quantification of the amplified products were normalized against GAPDH (\u0026Delta;Ct). Paired two-tailed t test was used to compare relative mRNA expression levels of the studied tissue samples. Statistical significance was defined as a \u003cem\u003ep\u003c/em\u003e value\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec14\"\u003e\n \u003ch2\u003eWestern Blot Analysis\u003c/h2\u003e\n \u003cp\u003eMonoclonal antibodies against FRA, 1:500 dilution, was obtained from Dr. Daniel O\u0026rsquo;Shannessy (Department of Diagnostics Development, Morphotek Inc., Exton, Pennsylvania). All samples mentioned above were subsequently evaluated for protein expression by Western blot, as described elsewhere [\u003cspan class=\"CitationRef\"\u003e38\u003c/span\u003e]. GAPDH antibody (Abcam, USA) was used as the loading control.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec15\"\u003e\n \u003ch2\u003eImmunohistochemistry\u003c/h2\u003e\n \u003cp\u003eAmong many differentially expressed genes, folate receptor-alpha (FRA) was one of the most highly differentially expressed. Immunohistochemistry (IHC) stain with antibodies against FRA, mentioned above, was performed as described previously [\u003cspan class=\"CitationRef\"\u003e14\u003c/span\u003e]. Normal fallopian tube samples served as a positive control since it is ubiquitously expressed in tubal epithelial cells [\u003cspan class=\"CitationRef\"\u003e14\u003c/span\u003e]. Negative controls were carried out by replacing primary antibodies with class-matched mouse and rabbit IgGs on parallel sections. The subcellular staining localization for FRA was both cytoplasmic and membranous.\u003c/p\u003e\n \u003cp\u003eIHC stained slides were evaluated and scored by counting at least 500 epithelial cells independently by two pathologists (RZ and WZ). Positive FRA expression was defined as discrete membrane and intracellular (mainly cytoplasmic) brown color with at least weak intensity within the epithelial cells. IHC scoring criteria have been described previously [\u003cspan class=\"CitationRef\"\u003e14\u003c/span\u003e]. Briefly, the staining intensity was scored as 0 if negative, 1 if with weak intensity, 2 with moderate intensity, and 3 if strong and intensely stained. Tissues with score 3 staining showed an intensely positive pattern that was readily identifiable at low magnification (4\u0026times; objective) under light microscope. Sometimes a complete circumferential staining was seen. Score 2 was only visible at the 10\u0026times; objective level and it was typically localized to the apical luminal or occasionally to the lateral cell border. In contrast, score 1 stain was generally limited to the luminal borders, or required 20\u0026times; to 40\u0026times; objectives to confirm. Percentage of the positive cells at each intensity was calculated for each case. The final score was summarized by multiplying the staining intensity and the percentage of the positive cells for each sample [\u003cspan class=\"CitationRef\"\u003e9\u003c/span\u003e].\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec16\"\u003e\n \u003ch2\u003eStatistical Analysis\u003c/h2\u003e\n \u003cp\u003eMultiple comparisons among categories of ovarian endometriosis, benign tubal and endometrial tissues were carried out by using student t-test and SPSS statistical software program version 13.0 (SPSS, Chicago, IL, USA) when appropriate. \u003cem\u003eP\u003c/em\u003e value \u0026lt;\u0026nbsp;0.05 was considered statistically significant.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate:\u0026nbsp;\u003c/strong\u003ePatient consent was waived due to the reason that the current study does not require patient consent since only residual tissues in the paraffin blocks were used after clinical diagnosis and management were completed\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor\u0026rsquo;s contribution:\u003c/strong\u003e WZ, YiW, YuW conceived the study design and experiments. RF, QL, YuW, RZ, ZY, LW, and YaW carried out experiments and data analysis. RF, QL, LW, and WL performed data analysis. RF, QL, YiW, WZ, RC, and OF wrote the manuscript. YiW, YuW, RZ, and WL provided the majority of cases with relevant clinical information. All authors were involved in editing and approving the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u0026nbsp;\u003c/strong\u003eThis work was partially supported by grants from the Department of Science and Technology of Henan province (project number: 162102310174) to YW; Natural Science Foundation of Henan province (project number: ZC20180062) to YW. National Natural Science Foundation of China (project number: 81972441) to YW. The project was also supported in part by Mark and Jane Gibson Endowment fund to WZ.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eInformed Consent Statement:\u0026nbsp;\u003c/strong\u003eThe\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003epatient consent was waived due to the reason that the current study does not require patient consent since only residual tissue in the paraffin blocks were used after clinical diagnosis and management were completed.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDisclosure/Conflict of Interest:\u003c/strong\u003e The authors declare no potential conflicts of interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eJA, S., Peritoneal endometriosis due to menstrual dissemination of endometrial tissue into the peritoneal cavity. \u003cem\u003eAmerican journal of obstetrics and gynecology\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e1927,\u003c/strong\u003e 14, 48.\u003c/li\u003e\n \u003cli\u003eHalme, J.; Hammond, M. G.; Hulka, J. F.; Raj, S. G.; Talbert, L. M., Retrograde menstruation in healthy women and in patients with endometriosis. \u003cem\u003eObstetrics and gynecology\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e1984,\u003c/strong\u003e 64, (2), 151-4.\u003c/li\u003e\n \u003cli\u003eR, M., The current question of adenomyositis and adenomyomas in general and particularly seroepithelial adenomyositis and sarcomatoid adenomyometritis. \u003cem\u003eZentralbl Gynakol\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e1919,\u003c/strong\u003e 43, 6.\u003c/li\u003e\n \u003cli\u003eZheng, W.; Li, N.; Wang, J.; Ulukus, E. C.; Ulukus, M.; Arici, A.; Liang, S. X., Initial endometriosis showing direct morphologic evidence of metaplasia in the pathogenesis of ovarian endometriosis. \u003cem\u003eInternational journal of gynecological pathology : official journal of the International Society of Gynecological Pathologists\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e2005,\u003c/strong\u003e 24, (2), 164-72.\u003c/li\u003e\n \u003cli\u003eLi, J.; Abushahin, N.; Pang, S.; Xiang, L.; Chambers, S. K.; Fadare, O.; Kong, B.; Zheng, W., Tubal origin of \u0026apos;ovarian\u0026apos; low-grade serous carcinoma. \u003cem\u003eMod Pathol\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e2011,\u003c/strong\u003e 24, (11), 1488-99.\u003c/li\u003e\n \u003cli\u003eLi, J.; Fadare, O.; Xiang, L.; Kong, B.; Zheng, W., Ovarian serous carcinoma: recent concepts on its origin and carcinogenesis. \u003cem\u003eJournal of hematology \u0026amp; oncology\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e2012,\u003c/strong\u003e 5, 8.\u003c/li\u003e\n \u003cli\u003ePiek, J. M.; Kenemans, P.; Verheijen, R. H., Intraperitoneal serous adenocarcinoma: a critical appraisal of three hypotheses on its cause. \u003cem\u003eAmerican journal of obstetrics and gynecology\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e2004,\u003c/strong\u003e 191, (3), 718-32.\u003c/li\u003e\n \u003cli\u003eMeserve, E. E. K.; Mirkovic, J.; Conner, J. R.; Yang, E.; Muto, M. G.; Horowitz, N.; Strickland, K. C.; Howitt, B. E.; Crum, C. P., Frequency of \u0026quot;incidental\u0026quot; serous tubal intraepithelial carcinoma (STIC) in women without a history of or genetic risk factor for high-grade serous carcinoma: A six-year study. \u003cem\u003eGynecol Oncol\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e2017,\u003c/strong\u003e 146, (1), 69-73.\u003c/li\u003e\n \u003cli\u003eYuan, Z.; Wang, L.; Wang, Y.; Zhang, T.; Li, L.; Cragun, J. M.; Chambers, S. K.; Kong, B.; Zheng, W., Tubal origin of ovarian endometriosis. \u003cem\u003eModern pathology : an official journal of the United States and Canadian Academy of Pathology, Inc\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e2014,\u003c/strong\u003e 27, (8), 1154-62.\u003c/li\u003e\n \u003cli\u003eJH, R., The histogenesis of endometriosis. \u003cem\u003eObstet Gynecol Surv\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e1968,\u003c/strong\u003e 23, (35), 1.\u003c/li\u003e\n \u003cli\u003eGardner, G. H.; Greene, R. R.; Ranney, B., The histogenesis of endometriosis; recent contributions. \u003cem\u003eObstetrics and gynecology\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e1953,\u003c/strong\u003e 1, (6), 615-37.\u003c/li\u003e\n \u003cli\u003eWang, Y.; Mang, M.; Wang, Y.; Wang, L.; Klein, R.; Kong, B.; Zheng, W., Tubal origin of ovarian endometriosis and clear cell and endometrioid carcinoma. \u003cem\u003eAmerican journal of cancer research\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e2015,\u003c/strong\u003e 5, (3), 869-79.\u003c/li\u003e\n \u003cli\u003eO\u0026apos;Shannessy, D. J.; Somers, E. B.; Albone, E.; Cheng, X.; Park, Y. C.; Tomkowicz, B. E.; Hamuro, Y.; Kohl, T. O.; Forsyth, T. M.; Smale, R.; Fu, Y. S.; Nicolaides, N. C., Characterization of the human folate receptor alpha via novel antibody-based probes. \u003cem\u003eOncotarget\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e2011,\u003c/strong\u003e 2, (12), 1227-43.\u003c/li\u003e\n \u003cli\u003eO\u0026apos;Shannessy, D. J.; Somers, E. B.; Smale, R.; Fu, Y. S., Expression of folate receptor-alpha (FRA) in gynecologic malignancies and its relationship to the tumor type. \u003cem\u003eInternational journal of gynecological pathology : official journal of the International Society of Gynecological Pathologists\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e2013,\u003c/strong\u003e 32, (3), 258-68.\u003c/li\u003e\n \u003cli\u003eGiudice, L. C.; Kao, L. C., Endometriosis. \u003cem\u003eLancet (London, England)\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e2004,\u003c/strong\u003e 364, (9447), 1789-99.\u003c/li\u003e\n \u003cli\u003eYuan Z; Wang Y; Cragun JM; Chambers SK; Zheng W, Cell origin of endometriosis: contribution by the fallopian tube epithelium. \u003cem\u003eAm J Clin Exp Obstet Gynecol\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e2013,\u003c/strong\u003e 1, (1), 37-42.\u003c/li\u003e\n \u003cli\u003eKurman, R. J.; Shih Ie, M., The origin and pathogenesis of epithelial ovarian cancer: a proposed unifying theory. \u003cem\u003eThe American journal of surgical pathology\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e2010,\u003c/strong\u003e 34, (3), 433-43.\u003c/li\u003e\n \u003cli\u003eRoh, M. H.; Kindelberger, D.; Crum, C. P., Serous tubal intraepithelial carcinoma and the dominant ovarian mass: clues to serous tumor origin? \u003cem\u003eThe American journal of surgical pathology\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e2009,\u003c/strong\u003e 33, (3), 376-83.\u003c/li\u003e\n \u003cli\u003eEddy, C. A.; Pauerstein, C. J., Anatomy and physiology of the fallopian tube. \u003cem\u003eClinical obstetrics and gynecology\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e1980,\u003c/strong\u003e 23, (4), 1177-93.\u003c/li\u003e\n \u003cli\u003eGordts, S.; Campo, R.; Rombauts, L.; Brosens, I., Endoscopic visualization of the process of fimbrial ovum retrieval in the human. \u003cem\u003eHuman reproduction (Oxford, England)\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e1998,\u003c/strong\u003e 13, (6), 1425-8.\u003c/li\u003e\n \u003cli\u003ePiek, J. M.; van Diest, P. J.; Zweemer, R. P.; Kenemans, P.; Verheijen, R. H., Tubal ligation and risk of ovarian cancer. \u003cem\u003eLancet (London, England)\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e2001,\u003c/strong\u003e 358, (9284), 844.\u003c/li\u003e\n \u003cli\u003eKalli, K. R.; Oberg, A. L.; Keeney, G. L.; Christianson, T. J.; Low, P. S.; Knutson, K. L.; Hartmann, L. C., Folate receptor alpha as a tumor target in epithelial ovarian cancer. \u003cem\u003eGynecol Oncol\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e2008,\u003c/strong\u003e 108, (3), 619-26.\u003c/li\u003e\n \u003cli\u003eLiu, J. J.; Ward, R. L., Folate and one-carbon metabolism and its impact on aberrant DNA methylation in cancer. \u003cem\u003eAdv Genet\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e2010,\u003c/strong\u003e 71, 79-121.\u003c/li\u003e\n \u003cli\u003eKotsopoulos, J.; Hecht, J. L.; Marotti, J. D.; Kelemen, L. E.; Tworoger, S. S., Relationship between dietary and supplemental intake of folate, methionine, vitamin B6 and folate receptor alpha expression in ovarian tumors. \u003cem\u003eInt J Cancer\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e2010,\u003c/strong\u003e 126, (9), 2191-8.\u003c/li\u003e\n \u003cli\u003eO\u0026apos;Shannessy, D. J.; Somers, E. B.; Palmer, L. M.; Thiel, R. P.; Oberoi, P.; Heath, R.; Marcucci, L., Serum folate receptor alpha, mesothelin and megakaryocyte potentiating factor in ovarian cancer: association to disease stage and grade and comparison to CA125 and HE4. \u003cem\u003eJ Ovarian Res\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e2013,\u003c/strong\u003e 6, (1), 29.\u003c/li\u003e\n \u003cli\u003eNecela, B. M.; Crozier, J. A.; Andorfer, C. A.; Lewis-Tuffin, L.; Kachergus, J. M.; Geiger, X. J.; Kalari, K. R.; Serie, D. J.; Sun, Z.; Moreno-Aspitia, A.; O\u0026apos;Shannessy, D. J.; Maltzman, J. D.; McCullough, A. E.; Pockaj, B. A.; Cunliffe, H. E.; Ballman, K. V.; Thompson, E. A.; Perez, E. A., Folate receptor-alpha (FOLR1) expression and function in triple negative tumors. \u003cem\u003ePloS one\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e2015,\u003c/strong\u003e 10, (3), e0122209.\u003c/li\u003e\n \u003cli\u003eKurosaki, A.; Hasegawa, K.; Kato, T.; Abe, K.; Hanaoka, T.; Miyara, A.; O\u0026apos;Shannessy, D. J.; Somers, E. B.; Yasuda, M.; Sekino, T.; Fujiwara, K., Serum folate receptor alpha as a biomarker for ovarian cancer: Implications for diagnosis, prognosis and predicting its local tumor expression. \u003cem\u003eInt J Cancer\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e2016,\u003c/strong\u003e 138, (8), 1994-2002.\u003c/li\u003e\n \u003cli\u003eDietl, J.; Wischhusen, J.; Hausler, S. F., The post-reproductive Fallopian tube: better removed? \u003cem\u003eHuman reproduction (Oxford, England)\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e2011,\u003c/strong\u003e 26, (11), 2918-24.\u003c/li\u003e\n \u003cli\u003eFathalla, M. F., Incessant ovulation--a factor in ovarian neoplasia? \u003cem\u003eLancet (London, England)\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e1971,\u003c/strong\u003e 2, (7716), 163.\u003c/li\u003e\n \u003cli\u003eChene, G.; Penault-Llorca, F.; Le Bouedec, G.; Mishellany, F.; Dauplat, M. M.; Jaffeux, P.; Aublet-Cuvelier, B.; Pouly, J. L.; Dechelotte, P.; Dauplat, J., Ovarian epithelial dysplasia after ovulation induction: time and dose effects. \u003cem\u003eHuman reproduction (Oxford, England)\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e2009,\u003c/strong\u003e 24, (1), 132-8.\u003c/li\u003e\n \u003cli\u003eBurmeister, R. E.; Fechner, R. E.; Franklin, R. R., Endosalpingiosis of the peritoneum. \u003cem\u003eObstetrics and gynecology\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e1969,\u003c/strong\u003e 34, (3), 310-8.\u003c/li\u003e\n \u003cli\u003eTutschka, B. G.; Lauchlan, S. C., Endosalpingiosis. \u003cem\u003eObstetrics and gynecology\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e1980,\u003c/strong\u003e 55, (3 Suppl), 57s-60s.\u003c/li\u003e\n \u003cli\u003eScully, R. E., Pathology of ovarian cancer precursors. \u003cem\u003eJournal of cellular biochemistry. Supplement\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e1995,\u003c/strong\u003e 23, 208-18.\u003c/li\u003e\n \u003cli\u003eFukunaga, M.; Ushigome, S., Epithelial metaplastic changes in ovarian endometriosis. \u003cem\u003eModern pathology : an official journal of the United States and Canadian Academy of Pathology, Inc\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e1998,\u003c/strong\u003e 11, (8), 784-8.\u003c/li\u003e\n \u003cli\u003eNishida, M.; Watanabe, K.; Sato, N.; Ichikawa, Y., Malignant transformation of ovarian endometriosis. \u003cem\u003eGynecologic and obstetric investigation\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e2000,\u003c/strong\u003e 50 Suppl 1, 18-25.\u003c/li\u003e\n \u003cli\u003eWang, J. L.; Lin, Y. W.; Chen, H. M.; Kong, X.; Xiong, H.; Shen, N.; Hong, J.; Fang, J. Y., Calcium prevents tumorigenesis in a mouse model of colorectal cancer. \u003cem\u003ePloS one\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e2011,\u003c/strong\u003e 6, (8), e22566.\u003c/li\u003e\n \u003cli\u003eWei, W.; Kong, B.; Qu, X., Alteration of HGF and TSP-1 expression in ovarian carcinoma associated with clinical features. \u003cem\u003eJ Obstet Gynaecol Res\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e2012,\u003c/strong\u003e 38, (1), 57-64.\u003c/li\u003e\n \u003cli\u003eHong, S.; Li, X.; Zhao, Y.; Yang, Q.; Kong, B., 53BP1 suppresses tumor growth and promotes susceptibility to apoptosis of ovarian cancer cells through modulation of the Akt pathway. \u003cem\u003eOncol Rep\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e2012,\u003c/strong\u003e 27, (4), 1251-7.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"ovarian endometriosis, endometrioma, endometrioitic cyst, fallopian tube, tubal contribution of endometriosis, biomarkers of endometriosis","lastPublishedDoi":"10.21203/rs.3.rs-746595/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-746595/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground\u003c/strong\u003e\u0026nbsp;Ovary is the most common organ site involved by endometriosis.\u0026nbsp;We previously found that fallopian tube may contribute to the histogenesis of ovarian endometriosis.\u0026nbsp;The finding was novel and requires further studies.\u0026nbsp;We addressed this issue by examining a differentially expressed gene folate receptor alpha FOLR1 and its protein FRA in this study. \u003c/p\u003e\u003cp\u003e\u003cstrong\u003eResults\u003c/strong\u003e\u0026nbsp;A total of 144 tissue samples were studied.\u0026nbsp;These included 32-paired 32-paired tubal-endometrial-ovarian endometriosis samples (n = 96), 18 samples of ovarian endometriosis without corresponding tubal or endometrium, and 30 ovarian tissue samples with ovarian surface epithelia but without endometriosis.\u0026nbsp;Multiple comparisons among groups of ovarian endometriosis, normal fallopian tube and benign endometrium were performed.\u0026nbsp;FOLR1 was highly expressed in the epithelia of fallopian tube and ovarian endometriosis, with paired endometrial samples showing a significantly lower level of expression.\u0026nbsp;Similar differential studies for FRA protein were performed through Western blot and immunohistochemistry (IHC).\u0026nbsp;The expression of folate receptor alpha at both mRNA and protein levels in the tissues (fallopian tube or ovarian endometriosis vs. the endometrium) were significantly different (p \u0026lt; 0.001). \u0026nbsp;All ovarian surface mesothelial epithelia showed negative expression of FRA by IHC. \u003c/p\u003e\u003cp\u003e\u003cstrong\u003eConclusions\u0026nbsp;\u003c/strong\u003eThe results further support that the fallopian tube may contribute to the development of ovarian endometriosis.\u0026nbsp;Understanding the tubal contribution to ovarian endometriosis should ultimately contribute to ongoing investigative efforts aimed at identifying alternative ways to prevent and treat endometriosis.\u0026nbsp;\u003c/p\u003e","manuscriptTitle":"Folate Receptor Alpha Expression in Fallopian Tube: Further Evidence Supporting Tubal Contribution of “Ovarian” Endometriosis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2021-08-03 15:03:14","doi":"10.21203/rs.3.rs-746595/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"607301f5-29ea-4341-98f3-6d3a41668c82","owner":[],"postedDate":"August 3rd, 2021","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":6174106,"name":"Sexual \u0026 Reproductive Medicine"},{"id":6174107,"name":"Cancer Biology"}],"tags":[],"updatedAt":"2021-09-09T05:52:45+00:00","versionOfRecord":[],"versionCreatedAt":"2021-08-03 15:03:14","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-746595","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-746595","identity":"rs-746595","version":["v1"]},"buildId":"B-jG_2CBjPDmsCi4Wdhf-","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Condition tags

endometriosis

Citation neighborhood

Papers in the corpus that this work cites (lower rings, blue) and that cite this one (upper rings, green). Dot size scales with the paper's in-corpus citation count — bigger dot = more influential within the endo/adeno field. Click a dot to open that paper. [ expand to 2 hops ] — adds papers reached through this work's immediate citers/citees. Heavier; up to 60 extra dots.

References (31)

Source provenance

europepmc
last seen: 2026-08-09T06:41:02.236481+00:00
openalex
last seen: 2026-06-10T17:14:06.276822+00:00
License: CC0 · commercial use OK