Unveiling the prevalence of sexually transmitted infections and its etiology among married women of remote South Andaman Island in India.

OA: gold CC-BY-NC-ND-4.0

Abstract

Sexually transmitted infections (STIs) are a global public health concern, particularly among women of reproductive age and leads to severe health complications. Married women, despite being perceived as low-risk, are often excessively affected due to factors such as partner infidelity, and lack of negotiation power in sexual relationships. Therefore, the study aimed to understand the prevalence of STIs among married women of South Andaman Islands. A cross-sectional study with an analytical focus was conducted on STIs in South Andaman after obtaining the ethical approval. Written informed consent obtained before sample collection.Vaginal swab sample were collected for extracting high-quality DNA and Polymerase chain reaction assay for STI Pathogens such as C.trachomatis, N.gonorrheae, T.vaginalis, U.parvum, and HSV-2 were carried out individually. ELISA was performed for detecting Hepatitis B virus and T.pallidum. Statistical analysis was performed using the STATA software. Overall prevalence of STIs was 15.1%, of which Hepatitis B virus had the highest crude prevalence rate at 3.1%. Lower rates of bacterial STIs suggest possible variations in transmission dynamics, testing availability, or healthcare-seeking behavior. Most women (44.6%) reported their first sexual encounter after age 16, with higher rates among U. parvum (66.7%) and C. trachomatis (62.5%). Majority (97.9%) reported having a single sexual partner, with only a small proportion reporting multiple partners. Family planning usage varied, with 50.8% of women never using any contraception. Women without contraceptive methods had higher odds of getting C.trachomatis, N.gonorrheae, U.parvum, and T.pallidum infection. The prevalence of STIs among married women in South Andaman is high. Younger women are more likely to get Chlamydia, while women over 35 faces other STIs. Unemployment, early sexual activity, no condom use, and lack of STI knowledge are significant risk factors. Proper menstrual hygiene is vital for prevention. These findings underscore the need for strengthened screening and targeted health education interventions in remote island settings and can inform regional STI control strategies tailored to vulnerable populations.
Full text 40,964 characters · extracted from pmc-nxml · 5 sections · click to expand

Results

A cross-sectional study was conducted among married women residing in South Andaman. The study was carried out in selected healthcare facilities, including government hospitals, primary health centers, and private clinics, to ensure a diverse and representative sample. Data were collected through structured interviews and clinical examinations. A pre-tested questionnaire was used to gather information on socio-demographic characteristics, sexual and reproductive health history, STI symptoms, healthcare-seeking behavior, and knowledge of STI prevention. Clinical examinations and laboratory tests, including serological and microbiological assessments, were conducted to confirm the presence of STIs. Ethical approval was obtained from the institutional ethics committee. Written informed consent was obtained from all participants prior to enrollment. Confidentiality and privacy were strictly maintained throughout the study. Data were analyzed using descriptive and inferential statistical methods. Prevalence rates were calculated, and associations between STIs and potential risk factors were assessed using chi-square tests and logistic regression models. All analyses were performed using statistical software. The study included 813 participants, all of whom reported one or more symptoms suggestive of reproductive health issues. The most commonly reported symptoms included abnormal vaginal discharge, which can indicate infections or hormonal imbalances; chronic pelvic pain, often associated with conditions such as endometriosis or pelvic inflammatory disease; and lower abdominal pain, which may result from infections, ovarian cysts, or uterine disorders. Fig. 1 Crude prevalence rate of pathogens responsible for STI. Crude prevalence rate of pathogens responsible for STI. The overall prevalence of STIs in the study population was 15.1%. Among the identified pathogens, HBV had the highest crude prevalence rate at 3.1% (95% CI: 3.0–6.8), making it the most common STI in this population. (Fig.  1 ) Following HBV, U.parvum was detected in 2.8% (95% CI: 1.7–4.0) of individuals, while T.vaginalis and HSV-2 both had a prevalence of 2.6% (95% CI: 1.5–3.7). Additionally, T.pallidum , the causative agent of syphilis, was found in 1.5% (95% CI: 0.6–2.6) of the population. The prevalence of N.gonorrhoeae was relatively low at 1.5% (95% CI: 0.6–2.6), similar to that of T. pallidum . The lowest prevalence was observed for C.trachomatis , with a rate of 1.0% (95% CI: 0.3–1.7). The demographic characteristics of women infected with different STIs, including HSV-2, HBV, C.trachomatis , N.gonorrhoeae , U.parvum , T.pallidum , and T.vaginalis is shown in Table 3. The median age of study participants was 36 years, with an age range of 30 to 45 years. Women infected with HSV-2, HBV, C.trachomatis , N.gonorrhoeae , U.parvum , T.pallidum , and T.vaginalis was mostly within the 30 to 44-year age group. Moreover, C.trachomatis infected women aged 30 to 34 years had (OR: 1.24, p  = 0.793) higher likelihood of getting C.trachomatis infection, However, this is not statistically significant. Interestingly, 35 to 39 year aged women with HBV positive were double the times higher chance of being infected with HBV (OR: 2.86, p  = 0.09). T.vaginalis cases tended to be slightly older, with most affected women being 41 years or older. Notably, 41.7% of U.parvum cases and 58.3% of T.vaginalis cases were in women above 39 years. Similar results are observed for the other pathogens, where no significant associations are found based on the high p-values. Moreover, women aged 35 to 39 years who were positive for N.gonorrheae were two times higher chance of getting gonorrhea infection (OR: 2.51, p-value: 0.291), but the result is not significant. Regarding geographical distribution, urban women made up 31.1% of the total study population. Among those infected, HSV-2 and T. pallidum cases were predominantly from urban areas, whereas U. parvum infections were more common in rural regions. In addition, rural women infected with T . pallidum (OR: 2.15, p-value: 0.338), and C . trachomatis (OR: 1.36, p-value: 0.708) has higher odds of getting these infections. Education levels were generally high, with over 93% of infected women being literate across all infections, except for T. vaginalis , which had a higher proportion of illiterate individuals. Moreover, literate women with N.gonorrheae (OR:0.72, p-value: 0.752), T.vaginalis (OR:0.32, p-value: 0.789) and T.pallidum (OR: 0.22, p-value: 0.068) infection had lower likelihood of getting these infections. Additionally, most infected women were unemployed (86.7%), with 100% unemployment observed among those with C. trachomatis , N. gonorrhoeae , and U. parvum infections. Nearly half of women (44.6%) reported having their first sexual encounter after the age of 16, with higher rates observed among those infected with U. parvum (66.7%) and C. trachomatis (62.5%). In contrast, early sexual initiation (before age 16) was more common among women infected with HSV-2 (19.0%) and T. pallidum (17.4%). The majority (97.9%) reported having a single sexual partner, with only a small proportion reporting multiple partners. Multiple sexual partners were observed in 4.8% of HSV-2 cases and 12.5% of C. trachomatis cases. Regarding reproductive history, more than two-thirds of the women (66.1%) had experienced 1 to 2 pregnancies, with this rate reaching 100% among N. gonorrhoeae cases and 56.5% among T. pallidum cases. However, a higher number of pregnancies (three or more) were observed among women with HBV (52.0%). Women with more than three pregnancies had 1.18 times the chances of getting HBV infection (OR:1.18, p-value:0.878). In terms of childbirth, most women (74.4%) had 1 to 2 children, with this percentage being highest among T. pallidum -positive cases (91.3%). In terms of delivery type, most of the women delivery the baby by vaginal birth are significantly associated with HBV infection and has higher likelihood of being positive for HBV infection (OR:5.26; 95%CI: 2.26 to 12.4; p-value: 0.001). Family planning usage varied, with 50.8% of women never having used any contraception. However, significant use of condoms and tubectomy was observed among women infected with U. parvum (50%) and T. vaginalis (50%). Moreover, women those never using any contraceptive methods had higher odds of getting C.trachomatis (OR: 1.14, p-value: 0.872), N.gonorrheae (OR: 19.5, p-value: 0.006), U.parvum (OR: 1.71, p-value: 2.64) and T.pallidum (OR: 1.86, p-value: 2.93) infection. Individual those never using contraceptive methods were strongly associated with gonorrhea infection. (Tables 4 and 5) Overall population, and this usage was higher in women with HSV-2(85.7%).Table  3 presents data on menstrual hygiene practices, including menstrual cycle regularity and sanitary pad usage, among women with STIs. A total of 43.3% of women reported using 3 to 4 sanitary pads during their menstrual cycle, with the highest proportion observed among N.gonorrhoeae cases (75.0%). In contrast, 9.1% of women did not use any sanitary pads, with non-usage being most common among those infected with C.trachomatis (16.0%). Additionally, 33.9% of women reported using only 1 to 2 sanitary pads per, with the highest usage seen in HBV cases (52.0%) and T.vaginalis cases (58.3%). Women using one or two sanitary pads had higher odds of getting infected with HSV-2 (OR: 3.30, p-value: 0.033) and had a significant association. (Fig.  2 ) Regarding the type of sanitary pads used, synthetic pads were the most commonly preferred, with 59.7% of women opting for them. However, cotton pads were more frequently used among women infected with C. trachomatis (80.0%), N. gonorrhoeae (87.5%), and T. vaginalis (83.3%). Additionally, 27.3% of women reported using a combination of both cotton and synthetic pads, with this practice being significantly higher among those with HSV-2 infections (85.7%). Women using synthetic pads had lower likelihood of getting infection with HSV-2 (OR: 0.70, p-value: 0.63), N.gonorrheae (OR: 0.60, p-value: 0.629), and T.pallidum (OR: 1.42, p-value: 0.907). Among the reported symptoms, U.parvum had the highest proportion of women experiencing abnormal vaginal discharge (78.3%), followed by N.gonorrhoeae (66.7%) and T.vaginalis (61.9%). In addition, those with abnormal vaginal discharge had higher odds of acquiring U.parvum (OR: 1.99, p-value: 0.179) and N.gonorrhoeae (OR: 1.09, p-value: 0.893) infection. However, this is not statistically significant. Menorrhagia (heavy menstrual bleeding) was most commonly observed in women with HBV infection, affecting 44.0% of cases. However, this symptom was largely absent in women with C. trachomatis , N. gonorrhoeae , and U. parvum infections. Chronic pelvic pain was reported most frequently in U. parvum infections (73.9%), followed by T. vaginalis (52.4%) and N. gonorrhoeae (50.0%). Similarly, T. vaginalis cases had the highest proportion of women reporting lower abdominal pain (71.4%), with significant occurrence also seen in U. parvum (60.9%) and N. gonorrhoeae (50.0%) cases. U.parvum positive women with Lower abdominal pain were 2.30 times higher chance of getting U.parvum (OR:2.30, p-value: 0.051) infection. Itching was most commonly reported in U. parvum infections (56.5%), followed by T. vaginalis (47.6%). In contrast, N. gonorrhoeae cases had the lowest incidence of itching, affecting only 8.3% of cases. Frequent urination (micturition) was most prevalent among women with T.pallidum infections (16.7%). However, this symptom was relatively rare among other infections and was completely absent in N.gonorrhoeae cases (0.0%). (Fig.  3 ) Table 3 Demographic characteristics of patients infected with sexually transmitted pathogens. STI pathogens HSV-2 HBV C. trachomatis N .gonorrhoeae U.parvum T.pallidum T. vaginalis Variable Overall, N  = 813 1 Positive, N  = 21 1 Positive, N  = 25 Positive, N  = 8 1 Positive, N  = 12 1 Positive, N  = 23 1 Positive, N  = 12 Positive, N  = 21 1 Age in years, Median (IQR) 36.0 (30.0–43.0) 35.0 (31.0–39.0) 37.0 (33.0–41.0) 30.5 (25.0–33.8) 38.5 (34.5–40.3) 36.0 (31.0–44.0) 41 (35.5–43.8) 35.0 (30.0–44.0) Age classification, n (%) Age: <30 188 (23.1) 5 (23.8) 4 (16.0) 3 (37.5) 2 (16.7) 5 (21.7) 2 (16.7) 5 (23.8) Age: 30–34 152 (18.7) 5 (23.8) 4 (16.0) 3 (37.5) 1 (8.3) 3 (13.0) 1 (8.3) 5 (23.8) Age: 35–39 152 (18.7) 7 (33.3) 8 (32.0) 1 (12.5) 4 (33.3) 6 (26.1) 2 (16.7) 3 (14.3) Age: >39 321 (39.5) 4 (19.0) 9 (36.0) 1 (12.5) 5 (41.7) 9 (39.1) 7 (58.3) 8 (38.1) Residential area [Urban/Rural, n (% Urban 253 (31.1) 8 (38.1) 4 (16.0) 2 (25.0) 0 (0.0) 9 (39.1) 2 10 (47.6) Rural 560 (68.9) 13 (61.9) 21 (84.0) 6 (75.0) 12 (100.0) 14 (60.9) 10 11 (52.4) Education, n (%) Illiterate 50 (6.2) 1 (4.8) 1 (4.0) 0 (0.0) 1 (8.3) 1 (4.3) 2 (16.7) 1 (4.8) Literate 763 (93.8) 20 (95.2) 24 (96.0) 8 (100.0) 11 (91.7) 22 (95.7) 10 (83.3) 20 (95.2) Occupation, n (%) Unemployed 705 (86.7) 17 (81.0) 22 (88.0) 8 (100.0) 12 (100.0) 19 (82.6) 11 (91.7) 16 (76.2) Employed 108 (13.3) 4 (19.0) 3 (12.0) 0 (0.0) 0 (0.0) 4 (17.4) 1 (8.3) 5 (23.8) Demographic characteristics of patients infected with sexually transmitted pathogens. Table 4 Reproductive characteristics of cases infected with sexually transmitted pathogens. STI pathogens HSV-2 HBV C. trachomatis N .gonorrhoeae U. parvum T.pallidum T. vaginalis Variable Overall, N  = 813 1 Positive, N  = 21 1 Positive, N  = 25 Positive, N  = 8 1 Positive, N  = 12 1 Positive, N  = 23 1 Positive, N  = 12 Positive, N  = 21 1 Age at first intercourse, n (%) less than 16 years 82 (10.1) 4 (19.0) 0 (0.0) 0 (0.0) 2 (16.7) 4 (17.4) 2 (16.7) 3 (14.3) 16 to 20 years 363 (44.6) 8 (38.1) 12 (48.0) 5 (62.5) 8 (66.7) 11 (47.8) 4 (33.3) 7 (33.3) greater than 20 years 368 (45.3) 9 (42.9) 13 (52.0) 3 (37.5) 2 (16.7) 8 (34.8) 6 (50.0) 11 (52.4) No of sexual partners, n (%) One 796 (97.9) 20 (95.2) 23 (92.0) 7 (87.5) 12 (100.0) 23 (100.0) 12 (100.0) 21 (100.0) > 1 Partner 17 (2.1) 1 (4.8) 2 (8.0) 1 (12.5) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) No of conceptions, n (%) Zero 71 (8.7) 3 (14.3) 3 (12.0) 0 (0.0) 1 (8.3) 1 (4.3) 1 (8.3) 3 (14.3) 1 to 2 537 (66.1) 13 (61.9) 9 (36.0) 8 (100.0) 8 (66.7) 13 (56.5) 6 (50.0) 10 (47.6) More than 3 205 (25.2) 5 (23.8) 13 (52.0) 0 (0.0) 3 (25.0) 9 (39.1) 5 (41.7) 8 (38.1) No of living children, n (%) Zero 113 (13.9) 3 (14.3) 3 (12.0) 1 (12.5) 1 (8.3) 1 (4.3) 1 (8.3) 4 (19.0) 1 to 2 605 (74.4) 15 (71.4) 17 (68.0) 7 (87.5) 9 (75.0) 21 (91.3) 8 (66.7) 14 (66.7) More than 3 95 (11.7) 3 (14.3) 5 (20.0) 0 (0.0) 2 (16.7) 1 (4.3) 3 (25.0) 3 (14.3) Family planning method, n (%) Never used 413 (50.8) 10 (47.6) 10 (40.0) 4 (50.0) 1 (8.3) 13 (56.5) 4 (33.3) 9 (42.9) Condom 133 (16.4) 0 (0.0) 1 (4.0) 3 (37.5) 6 (50.0) 7 (30.4) 2 (16.7) 6 (28.6) IUD 23 (2.8) 2 (9.5) 1 (4.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) Hormonal Contraception 13 (1.6) 1 (4.8) 1 (4.0) 0 (0.0) 0 (0.0) 1 (4.3) 0 (0.0) 0 (0.0) Tubectomy 231 (28.4) 8 (38.1) 12 (48.0) 1 (12.5) 5 (41.7) 2 (8.7) 6 (50.0) 6 (28.6) Reproductive characteristics of cases infected with sexually transmitted pathogens. Table 5 Prevalence rate of STIss by age, behavior, and contraceptive use. STI pathogens HSV-2 HBV C. trachomatis N .gonorrhoeae U.parvum T.pallidum T. vaginalis Prevalence rate (%) 2.6 3.1 1.0 1.5 2.8 1.5 2.6 Age classification, (%) Age: 39 0.5 1.1 0.1 0.6 1.1 0.9 1.0 Age at first intercourse, (%) less than 16 years 0.5 0.0 0.0 0.2 0.5 0.2 0.4 16 to 20 years 1.0 1.5 0.6 1.0 1.4 0.5 0.9 greater than 20 years 1.1 1.6 0.4 0.2 1.0 0.7 1.4 No of sexual partners, (%) One 2.5 2.8 0.9 1.5 2.8 1.5 2.6 > 1 Partner 0.1 0.2 0.1 0.0 0.0 0.0 0.0 No of conceptions, (%) Zero 0.4 0.4 0.0 0.1 0.1 0.1 0.4 1 to 2 1.6 1.1 1.0 1.0 1.6 0.7 1.2 More than 3 0.6 1.6 0.0 0.4 1.1 0.6 1.0 No of living children, (%) Zero 0.4 0.4 0.1 0.1 0.1 0.1 0.5 1 to 2 1.8 2.1 0.9 1.1 2.6 1.0 1.7 More than 3 0.4 0.6 0.0 0.2 0.1 0.4 0.4 Family planning method, (%) Never used 1.2 1.2 0.5 0.1 1.6 0.5 1.1 Condom 0.0 0.1 0.4 0.7 0.9 0.2 0.7 IUD 0.2 0.1 0.0 0.0 0.0 0.0 0.0 Hormonal Contraception 0.1 0.1 0.0 0.0 0.1 0.0 0.0 Tubectomy 1.0 1.5 0.1 0.6 0.2 0.7 0.7 Prevalence rate of STIss by age, behavior, and contraceptive use. Fig. 2 Menstrual hygiene levels among women infected with sexually transmitted diseases. ( A ) Number of sanitary pad usage during menstruation. ( B ) Type of sanitary pad used during menstrual cycle. Menstrual hygiene levels among women infected with sexually transmitted diseases. ( A ) Number of sanitary pad usage during menstruation. ( B ) Type of sanitary pad used during menstrual cycle. Fig. 3 Symptomatic characteristics of patients infected with STI pathogens. Symptomatic characteristics of patients infected with STI pathogens.

Materials

This research was a cross-sectional study with an analytical focus, aiming to understand the prevalence of STIs among married women of reproductive age group (18–49 years) in the selected clusters and the hospitals in South Andaman. Women with symptoms of vaginal discharge, vulval itching/irritation, and/or vaginal malodor, dysuria, dyspareunia, with lower abdominal pain were included in the study. Pregnant women, menopausal women, menstruating, who had received antibiotics in the past 4 weeks, and unwilling to participate in the study were excluded. This study has been conducted from January 2021 to March 2024. As per the previous study done on Indian ethnicity, the prevalence of STIs was 27.2% 17 . Considering the prevalence of STIs to be 27.2% (P) with absolute precision of 5% and the 95% confidence level (z), the sample size (N) calculated by the following formula allows a design effect of 2.0. The sample size was calculated based on the formula mentioned below (Open-Epi version 3). \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$Sample~size~n~=~[DEFF*Np\left( {1 - p} \right)\left] {/~} \right[\left( {d2/Z21 - \alpha /2*\left( {N - 1} \right)+p*\left( {1 - p} \right)} \right]$$\end{document} Where, N is Population size, P is hypothesized frequency of the outcome factor, d is confidence limits as % of 100, DEFF is Design effect 18 . The calculated sample size is 609. Considering the improved participant recruitment and higher response rate than initially predicted and ensuring greater statistical precision and representativeness, especially relevant for the diverse and dispersed populations in the Andaman and Nicobar Islands, the sample size is increased by 25%, then the sample size is 813. Ethical approval was obtained from the institutional human ethics Committee of the ICMR Regional Medical Research Centre, Sri Vijaya Puram, Andaman and Nicobar Islands (IHEC/ICMR-RMRC/PB/Proj-6 Dated: 30/08/2022). All procedures involving human participants were conducted in accordance with the ethical standards of the institutional and national research committees, as well as the 1964 Declaration of Helsinki and its updated amendments. Written informed consent was obtained from participants before collecting their sample specimens. Collected information were kept confidential with password protection accessible exclusively to the investigator. Anonymity was ensured for the study subjects. Each participant was provided with an information sheet describing the objectives, procedures, potential risks, and expected benefits of the study in simple, understandable language. Written informed consent was obtained from all participants before data collection. The potential risks associated with participation were primarily psychosocial, relating to the disclosure of sensitive sexual and reproductive health information. To minimize these risks, interviews were conducted in private settings by trained female investigators to ensure comfort and confidentiality. Participants were assured that their responses would remain strictly confidential, anonymized using coded identifiers, and used solely for research purposes. No invasive procedures beyond routine clinical sampling were performed, and therefore no significant physical risk or pain was anticipated. The symptomatic women, who provided written consent to participate, were enrolled in the study. The history of antimicrobial treatment in the last 14 days was also recorded. Field clinics were established at each cluster within sub-centres, Primary Health Centres (PHCs), Community Health Centres (CHCs), and District Hospitals. Trained Nurse-midwife was conducted the interview and the data was recorded using a predesigned questionnaire which seeks information about personal identity, medical history, family history and gynecological symptoms. Participants were mobilized by field investigators and assessed using a pre-designed structured questionnaire consisting of two sections with closed-ended questions. The first section collected demographic details and it also obtained information on sexual behaviour and reproductive characteristics, covering aspects like sexual orientation, number of sexual partners, age at first sexual intercourse, and any history of pelvic inflammatory disease (PID) or STIs. Additionally, menstrual, marital, and obstetric histories were documented. The second section focused on gynaecological symptoms, capturing data on vaginal discharge, menorrhagia, chronic pelvic pain, lower abdominal pain, itching/irritation, and painful micturition. All de-identified data generated in this study are storedS on a secure institutional server with controlled access restricted to the research team. Procedure was explained to the patient to ensure their comfort and cooperation. Sterile swab (typically made of nylon or Dacron) was used and inserted it gently into the vaginal canal. Rotate the swab gently to collect cells and secretions from the vaginal walls. Contact has been avoided with the vaginal opening and external genitalia to minimize contamination. Vaginal swab was placed into a sterile container or medium if required, and label it appropriately. Specific instructions for storage and transportation were followed to ensure the integrity of the sample 19 . The Vaginal swab sample taken from the patient was utilized for extracting high-quality deoxy-ribo nucleic acid (DNA). Swabs were placed in 3 ml of phosphate buffered saline (PBS) (Catalogue No: P4417-50TAB; SIGMA, USA) and mixed vigorously to release the cells and eliminate any cellular debris. Next, the solution was moved to a micro-centrifuge tube and spun at the highest speed in a refrigerated micro-centrifuge for 10 min. The liquid above the cells was removed, and the solution was then re-suspended in 400 µl of PBS. Further, the 200 µl of the sample has been taken for DNA extraction. Isolation of nucleic acid was performed by using manufacturer instructions (QIAamp DNA mini-Kit; Catalogue No. 51306; QIAGEN GmbH, Hilden, Germany). The eluted DNA was stored in -40℃ for further usage. Polymerase chain reaction (PCR) assay for five STI Pathogens such as C.trachomatis , N.gonorrheae , T.vaginalis , U.parvum , and HSV-2, were carried out individually. Since the culture identification of bacterial etiology such as C. trachomatis , N.gonorrhoeae , HSV-2 , T.vaginalis , and U.parvum were more laborious, we have adopted PCR methods following the standard procedures. The sets of published primers were used for PCR technique. (Table  1 ) Five specific Polymerase chain reaction (PCR) reaction were prepared for a total 25 µl using 12.5 µl of PCR Master Mix (Cat No. K0171, Invitrogen, ThermoScientific™, USA), 0.5 µl of forward and reverse primer and 7.1 µl of nuclease free water.(Table  2 ) These PCR assays were performed with appropriate internal quality controls, including positive and negative control samples and the procedures adhere to the internal quality validation. Table 1 Primer details for pathogen specific PCR assay. Pathogens Primer Sequence (5’ to 3’) Base pairs (bp) C. trachomatis 20 KL F’ TCC GGA GCG AGT TAC GAA GA 240 KL R’ AAT CAA TGC CCG GGA TTG GT N. gonorrheae 21 Orf1 F’ CAA CTA TTC CCG ATT GCG A 260 Orf1 R’ GTT ATA CAG CTT CGC CTG AA U. parvum 22 US F’ CAATCTGCTCGTGAAGTATTAC 429 US R’ ACGACGTCCATAAGCAACT HSV − 2 23 Pol gene F’ GTC CCA CCT CAG CGA TCT GCC T 544 Polgene R’ CAG CAG CGA GTC CTG CAC ACA A T. vaginalis 24 TVC F’ CGA ATG GRA TAA CGA ATG CGA C 237 TVC R’ CAA CCT TTC TTG TCA GAC AAC TTG Primer details for pathogen specific PCR assay. Table 2 Thermal conditions of pathogens specific PCR assay. Organism Denaturation (in degree Celsius) Time (in minutes) Annealing (in degree Celsius) Time (in seconds) Extension (in degree Celsius) Time (in minutes) C. trachomatis 94 1 66 60 72 1 N. gonorrheae 95 1 60 45 72 1 U. parvum 94 1 51 45 72 1 HSV − 2 94 1 66 60 72 1 T. vaginalis 94 1 66 45 72 1 Thermal conditions of pathogens specific PCR assay. The amplification product consists of specific base pairs from the targeted gene, was visualized after electrophoresis through a 1.5% agarose gel containing ethidium bromide (EtBr). Monolisa HBsAg Ultra ELISA kits (Catalogue No: 72346; Lot: 8D0096; BioRad Laboratories, France) and Treponema pallidum IgM ELISA kits (Catalogue No: EIA-4267; Lot: 129 M/K063; DRG International, Marburg, Germany) were used for the early detection of HBV and T.pallidum. These methods were performed according to the manufacturer instructions. Both ELISA assays were performed with appropriate internal quality controls, including positive and negative control samples, and procedures adhered to the laboratory’s quality assurance protocols. The profiles and clinical information were evaluated using STATA 15.1 (StataCorp, Texas, USA). The data was shown through numbers and percentages. Graphs were utilized to illustrate the symptoms of STIs. The prevalence rate and the 95% confidence range were determined by dividing the number of women tested who had STIs such as C.trachomatis , N.gonorrheae , T.pallidum , U.parvum , HSV-2, HBV, and T.vaginalis by the total number of participants in the study. The adjusted prevalence rate was calculated through logistic regression, taking into account the study’s cluster structure, the rate of participation by age groups in the study, and the weight of the population. The odd ratio was calculated and adjusted for the likelihood of reporting STI pathogens using a logistic regression model with relevant factors as explanatory variables. These factors included socio-demographic, behavioral, sexual behavior, reproductive, and STI-related symptoms. Both simple and multiple logistic regression models were applied to calculate the odd ratio and adjusted odd ratio. To detect the most significant factors, a multiple logistic regression model was conducted using a stepwise approach, with factors meeting the criteria of p  ≥ 0.20 being considered for exclusion from the model and p  < 0.05 for inclusion in the model. The factors selected for analysis were based on an initial exploration with a simple logistic regression model and a review of the literature. All statistical analyses were conducted with a two-tailed approach at a significance level of 0.05. Data with missing values were excluded, as they accounted for only 3%, which was lower than anticipated and already accounted in the sample size estimation. Case-wise deletion was applied during the bivariate analyses.

Conclusion

This study found a significant prevalence of sexually transmitted infections (STIs) among married women in South Andaman, with HBV identified as the most common pathogen. Younger women were more likely to contract Chlamydia, while women over 35 were more prone to other STIs, including C.trachomatis , HBV, U.parvum , T.vaginalis , and T.pallidum . Unemployment, early sexual initiation, lack of condom use, and insufficient STI knowledge were significantly linked to STIs. The study explored reproductive behaviours and symptoms in married women infected with STI-causing pathogens. Proper menstrual hygiene was emphasized as a secondary factor in preventing STI-causing pathogens. This study reaffirms a notable burden of reproductive tract and sexually transmitted infections among married women in remote island communities. The findings contribute valuable evidence on STI epidemiology in underserved populations and underscore the need for improving access to screening, counseling, and community-based awareness programs. Strengthening surveillance and integrating routine STI screening into primary care services may help reduce the disease burden in similar remote settings.

Discussion

This study provides crucial insights into the prevalence of STIs and underlying causes of gynaecological symptoms among married women in the South Andaman Islands, India. The findings highlight the significant burden of STIs and reproductive health disorders, emphasizing the need for early diagnosis, awareness, and improved healthcare interventions. The current study observed a high prevalence of HBV infection among women in South Andaman, in comparison to other STIs, including U. parvum , T. vaginalis , HSV-2, and T. pallidum . In contrast, the prevalence of N. gonorrhoeae and C. trachomatis was relatively low. Similarly, a study conducted eastern province of India revealed that 2.85% of women population were positive for HBV 25 . In addition, a previous research among tribes in Andaman and Nicobar Islands revealed HBV prevalence is high 26 , 27 . However, a study conducted in Nepal indicated a high prevalence of trichomoniasis, whereas C. trachomatis , N. gonorrhoeae , T. pallidum , and HBV infections were observed at low rates 28 . This research revealed that a significant proportion of the population across all infections was over the age of 39 years. This may be due to hormonal changes, and engage in inconsistent safe-sex practices. Majority of the U. parvum cases were found within the same age group, while T. vaginalis exhibited the highest percentage of cases in individuals aged over 39. C. trachomatis was more prevalent among the women aged 30 to 34 years. However, the previous research investigated in India identified that one-third of the study population aged 24–26 years accounted for 46.67% of C. trachomatis cases 29 . In contrast, another study reported that STIs prevalence was 36.1%, with the highest rate reported in the age group of 35 years and older (42%) 30 . Furthermore, this research found that the majority of women with U. parvum , C. trachomatis , and HBV infections were from rural areas, while most cases of HSV-2 and T. pallidum was predominantly reported in urban localities. Similarly, prevalence research conducted in Bangladesh indicated that STI symptoms were most prevalent among rural women 31 . This is because of insufficient screening, limited availability of the health services, and lack of STI knowledge. A study conducted by Huda et al. (2022) found that STIs were more common among illiterate women with a single sexual partner who had one or two conceptions. In contrast, women in the current study were predominantly literate (> 93% across all infections), with only a small portion being illiterate. Most participants had a single sexual partner and reported having one to two conceptions. Additionally, the majority of women in this study were unemployed, accounting for more than 80%. Similarly, a research by Verma et al. indicated that a significant number of women with STIs in India were unemployed 32 . Notably, C. trachomatis , N. gonorrhoeae , and U. parvum infections were associated with 100% unemployment among the infected individuals. Majority of women reported their first sexual intercourse was at the ages of 16 to 20. Among these, cases of U. parvum and C. trachomatis were particularly more common in this age group. First intercourse at a younger age is associated with higher odds of STI compared to older ages. In contrast to this, a study conducted in Mozambique found that the prevalence of C. trachomatis was considerably elevated among women who experienced early sexual debut 33 . Additionally, early sexual debut, defined as starting intercourse before the age of 16, this rate was notably higher among women with HSV-2 (19.0%) and T. pallidum (17.4%). Several studies observed that STIs are more common among individuals who do not use any contraceptive methods 32 , 34 . Similarly, the majority of STIs-infected cases reported that they had never used any family planning methods. Unhygienic menstrual practices are increasing the burden of STIs primarily by the cause of genital tract infection. This may affect the vaginal mucosal layer and alter the microbiome of the genital tract. In this research, more than half of women reported using synthetic pads; however, cotton pads were notably more prevalent among those infected with C. trachomatis , N. gonorrhoeae , and T. vaginalis . Additionally, both cotton and synthetic pads were used by 27.3% of the overall population, with women infected with HSV-2 exhibiting the highest usage at 85.7%. A study conducted in Kerala revealed that women who used both cloth and sanitary pads interchangeably during menstruation were at a lower risk of contracting STIs 32 . Another study conducted in Haryana found that the majority of women using cloths as absorbents during menstruation were at an increased risk of acquiring STIs 35 . A study by Shakya et al. revealed that treatable STIs were considerably more common in women with vaginal discharge syndrome reported by gynecological assessment than in those reporting normal discharge (9.4% versus 5.0%) 28 . The current study revealed that more than 60% of U. parvum , N. gonorrhoeae , and T. vaginalis infected women were reporting abnormal vaginal discharge. Additionally, a previous study conducted in Nepal found a high prevalence of curable STIs among women exhibiting symptoms such as lower abdominal pain, itching, and painful micturition 28 . Similarly, T. vaginalis leads with more frequent number of women reporting lower abdominal pain followed by U. parvum and N. gonorrhoeae . Nearly half of the women infected with U. parvum and T. vaginalis showed the highest percentage of women experiencing itching. However, only T. pallidum infected women had a high rate of painful micturition. Chronic pelvic pain is a long-term complication of PID and is primarily associated with infections caused by C. trachomatis and N. gonorrhoeae 36 , 37 . However, our study shows that women infected with U. parvum exhibited the highest proportion (more than 70%) having chronic pelvic pain, followed by those with T. vaginalis and N. gonorrhoeae . Potential intervention for dropping the burden of STIs majorly depend in comprehensive sexual health education. Culturally appropriate and gender-sensitive health education programs should aim to increase awareness about modes of transmission, symptoms, and complications of STIs, and promote safer sexual practices, including consistent and correct condom use. Early screening and treatment are important to disturb the chains of transmission and prevent complications such as infertility, ectopic pregnancy, and neonatal infections. Routine screening of sexually active women for common STIs such as C. trachomatis , N. gonorrhoeae , T. vaginalis , and syphilis is essential. Partnering with local leaders, and community-based organizations can increase reach and acceptability of interventions. In addition, stigma reduction campaigns should normalize STI testing and treatment as routine healthcare practices. The study has limitations which should be considered in interpreting the results of this study. Firstly, the cross-sectional design limits the ability to establish causality between risk factors and STI prevalence. The small sample size may have limited the statistical power to detect relative association and this may not capture the heterogeneity. Recall bias may have influenced the accuracy of self-reported data on sexual and reproductive health history. As the study population was restricted to married women residing in South Andaman, the findings may not be generalizable to unmarried women, men, or populations in other geographic or sociocultural contexts. The reliance on clinical examinations and laboratory tests for diagnosis, although rigorous, may miss asymptomatic cases, further underestimating the true prevalence of STIs. Furthermore, given the sensitive nature of sexual and reproductive health topics, social desirability bias may have influenced self-reported behaviors. Participants may have underreported socially undesirable practices or overreported behaviors perceived as acceptable, potentially affecting prevalence estimates and observed associations. Despite these limitations, the research study has several notable strengths. It provides valuable epidemiological insights into the prevalence and determinants of STIs among married women in a geographically and culturally distinct population of South Andaman, where limited data are currently available. The use of standardized data collection tools and laboratory-based diagnostic methods enhances the reliability and validity of the findings. Moreover, by integrating information on sociodemographic factors, reproductive characteristics and sexual behavior factor, the study offers a comprehensive understanding of STI-related issues within this community. These findings can inform region-specific public health strategies and serve as a baseline for future comparative and interventional studies.

Introduction

Sexually transmitted infections (STIs) remain a significant public health concern worldwide, particularly among women of reproductive age 1 . These infections can lead to severe health complications, including infertility, chronic pelvic pain, and increased risk of Human immunodeficiency virus (HIV) transmission 1 . In developing regions, women often face barriers to healthcare access, including stigma, lack of awareness, limited availability of diagnostic and treatment facilities 2 . Married women, despite being perceived as low-risk, are often excessively affected due to factors such as partner infidelity, lack of negotiation power in sexual relationships, and socio-cultural norms restricting discussions on sexual health 3 . The Centers for Disease Control and Prevention (CDC) have concluded that around 2.4 million STIs were reported in the United States (US) in 2020 4 . Chlamydia was the most prevalent among these, with 1.6 million cases. Following closely behind were 677,769 cases of gonorrhea, a 45% increase from 2016, and 133,945 cases of primary and secondary syphilis, a 52% rise over the same period. In 2020, there was a 235% increase in the number of infants born with congenital syphilis from 2016 4 . According to the World Health Organization (WHO), every day, over 1 million new potentially accounting for most of these cases. Trichomoniosis is the most common globally, with 156 million new cases each year, followed by Chlamydia at 127 million, gonorrhea at 87 million, and syphilis at 6.3 million 5 . , 6 Moreover, Herpes simplex virus type 2 (HSV-2) affects over 500 million people globally. In 2016, over 350,000 babies were born with complications due to STIs. HPV infections are linked to over 310,000 deaths from cervical cancer each year. Syphilis is the second leading cause of stillbirths worldwide. In 2016, 37 million people worldwide were living with HIV. Approximately 15% of HIV-infected individuals in the US are unaware of their status and are responsible for 40% of all new HIV infections 1 . Studies suggest that around 6% of the adult population in India has one or more STI 7 . , The prevalence is significantly higher among key populations with high-risk behaviors, such as men who have sex with men (MSM), female sex workers (FSW), transgender individuals, and people who inject drugs (PWID) 8 . Moreover, the prevalence of these four curable STIs among the general population is estimated to be between 0 and 3.9% 8 . Access and affordability of STI laboratory diagnosis at the primary level of care are limited, which makes syndromic case management (treating based on symptoms) the cornerstone of STI control 9 . Due to limited access to laboratory diagnosis, syndromic management remains a key strategy for STI control, focusing on treating patients based on their symptoms. Previous studies in Andaman and Nicobar Islands revealed the high to moderate prevalence of human papillomavirus (HPV), HSV-2 and HBV 10 . , 11 , 12 Moreover, T.vaginalis also reported among women with vaginal discharge syndrome in this group of Islands 13 . Study about the prevalence of other STI pathogens such as N.gonorrheae , C.trachomatis , and T.pallidum were are limited in this group of Islands. South Andaman, a region with diverse demographic and socio-economic backgrounds, presents unique challenges in STI surveillance and control 14 . Socio-cultural and health system barriers significantly impede STI diagnosis and management. Many women do not seek timely care due to inadequate access, social stigma, and, in some cases, lack of awareness or partner permission, leading to untreated infections and increased risk for pelvic inflammatory disease and chronic complications. National surveys indicate rising self-reported STI symptoms among married women, with increases over the past decade and a widening treatment gap due to hesitancy in seeking medical attention 15 . Transmission is often facilitated by sexual networks and sometimes by asymptomatic carriage in male partners 16 . Moreover, the remote geography and unique sociocultural context of South Andaman make systematic surveillance, laboratory diagnosis, and evidence-based interventions particularly challenging. This problem requires rigorous epidemiological exploration, culturally sensitive health education, improved diagnostic access, and targeted interventions to reduce morbidity and interrupt transmission. Understanding the prevalence and determinants of STIs in this population is important for establishing effective intervention strategies, promoting awareness, and improving healthcare access. This study aims to determine the prevalence of STIs among married women in South Andaman, identify associated risk factors, and assess knowledge, attitudes, and healthcare-seeking behaviors related to STI prevention and treatment.

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: pmc-nxml

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2026) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

SciLite annotations

organisms 117
strain har-13 onobrychis vaginalis hepatitis b virus subtype adw hepatitis b virus subtype adw umbelopsis isabellina b7317 typhlosaurus cregoi strain har-13 rickettsiaformis human immunodeficiency virus siv/hiv noordeloos 2009062 rickettsiaformis rickettsiaformis human alphaherpesvirus 2 siv/hiv siv/hiv who lt1686 human papillomavirus human hepatitis b virus hbv onobrychis vaginalis strain har-13 human human strain har-13 onobrychis vaginalis typhlosaurus cregoi neisseria gonorrhoeae onobrychis vaginalis treponema pallidum human hepatitis b virus hbv strain har-13 human hepatitis b virus hbv onobrychis vaginalis human hepatitis b virus hbv human hepatitis b virus hbv onobrychis vaginalis neisseria gonorrhoeae strain har-13 human hepatitis b virus hbv strain har-13 neisseria gonorrhoeae onobrychis vaginalis human hepatitis b virus hbv strain har-13 human hepatitis b virus hbv human hepatitis b virus hbv onobrychis vaginalis onobrychis vaginalis noordeloos 2009062 strain har-13 t. castro psl-1703 onobrychis vaginalis typhlosaurus cregoi n. lavandero:700 umbelopsis isabellina b7317 typhlosaurus cregoi typhlosaurus cregoi n. lavandero:700 human hepatitis b virus hbv noordeloos 2009062 +57 more
chemicals 4
deoxy oligosaccharide derivative water agarose ethidium bromide

Source provenance

europepmc
last seen: 2026-08-30T09:23:35.175841+00:00
scilite
last seen: 2026-06-21T06:47:03.627287+00:00
unpaywall
last seen: 2026-05-21T02:00:01.467718+00:00
License: CC-BY-NC-ND-4.0