Elevated IL-8/TNF-α in follicle fluid of infertile women with endometriosis decrease LHCGR expression in cumulus cells

In: Research Square · 2023 · doi:10.21203/rs.3.rs-2855626/v1 · W4376130288
preprint OA: green CC0
AI-generated summary by gemini-2.5-flash-lite, 2026-06-21

Elevated IL-8/TNF-α in infertile women's follicular fluid with endometriosis correlates with decreased LHCGR expression in cumulus cells via SMAD2/3 activation and inhibited AKT/β-Catenin pathways.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

AI-generated deep summary by claude@2026-06, 2026-06-21 · read from full text

This preprint investigated whether inflammatory cytokines in follicular fluid from infertile women with endometriosis (EMs) are linked to impaired ovulation by measuring ovulation-related gene expression in cumulus cells and testing IL-8/TNF-α effects in vitro. Follicular fluid (with cumulus granulosa cells) and peritoneal fluid were collected from women with EM and male-factor infertility, with gene expression assessed by RT-PCR and signaling/apoptosis assessed using FSH-stimulated oocyte-ectomized cumulus cell models plus ELISA, TUNEL staining, Western blotting, and analysis of LHCGR promoter methylation. The study found that IL-8 and TNF-α concentrations were higher in endometriosis, and IL-8/TNF-α reduced FSH-induced signaling (decreased P-AKT and P-β-catenin) and retinoic acid production, accompanied by reduced P-SMAD2/3 activity, LHCGR promoter hypermethylation at SP1 binding sites, and decreased LHCGR mRNA expression, while not causing significant cumulus cell apoptosis at the tested cytokine dose. A major caveat is that the work is reported as a preprint and does not provide peer-reviewed validation, and the cytokine exposure did not induce apoptosis despite altering multiple signaling pathways. This paper is centrally about endometriosis — it examines how elevated IL-8/TNF-α in the follicular fluid of women with endometriosis suppresses LHCGR expression and implicates downstream ovulatory signaling mechanisms.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Abstract Background: To study whether ILs/TNFs in the follicular fluid (FF) of women with EMs are responsible for impaired follicular development or (and) ovulation or not, and then to explore the underlying mechanisms. Methods: follicular fluid (containing cumulus granulosa cells) was collected from women with EM and male factor infertility at our Clinical Reproductive Medicine Center, and peritoneal fluid was collected from the above patients with EMs. The expression of ovulation-related genes in cumulus cells was analysed by RT-PCR. Mouse cumulus cells expansion degree was assessed after cultured in follicle fluid from infertile women. Follicle fluid was detected by ELISA. Oocytectmized complex cell model was established, and cultured in vitro medium with addition of 100 IU/ml FSH. TUNEL staining was used to determine the apoptosis of cumulus cells. Then, we explored expression of P-SMAD2/3,key enzyme for retinoic acid metabolism, and methylation of SP1 binding sites in Lhcgr promoter region. Meanwhile, the P-AKT and P-catenin were assessed by Western blot. All experiments were performed independently at least three times, and data are presented as mean ± SEM. Statistical analyses were performed using Graphpad Prism 5 software p<0.05 (* and different letters) were defined as significant differences. Results: In cumulus cells, expression of genes related to ovulation decreased significantly than that in controls (P < 0.05), especially starting from LHCGR . The concentrations of IL-8 and TNF-α in follicle fluid were significantly higher in infertile women with endometriosis than in controls (P < 0.05). The function of follicle fluid and pelvic fluid of endometriosis women have changed. Addition of 500 pg/mL IL-8/TNF-α to medium did not cause significant apoptosis of cumulus cells, but inhibited P-AKT and P-β-catenin. On the other hand, expression of P-SMAD2/3 and retinoic acid production were reduced, while hypermethylation of the Sp1 binding sequence on Lhcgr promoter was identified, and Lhcgr expression was significantly reduced compared to control (P<0.05). Conclusion: Elevated IL-8/TNF-α in follicular fluid of women with endometriosis indirectly maintains Lhcgr promoter hypermethylation through activation of P-SMAD2/3, while inhibiting AKT and β-Catenin phosphorylation, which together reduce LHCGR mRNA expression.
Full text 134,430 characters · extracted from preprint-html · click to expand
Elevated IL-8/TNF-α in follicle fluid of infertile women with endometriosis decrease LHCGR expression in cumulus cells | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Elevated IL-8/TNF-α in follicle fluid of infertile women with endometriosis decrease LHCGR expression in cumulus cells Yaoxue Yin, Wangjuan Dai, Caihe Wen, Yundong Mao, Xiang Ma, Feiyang Diao, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-2855626/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background: To study whether ILs/TNFs in the follicular fluid (FF) of women with EMs are responsible for impaired follicular development or (and) ovulation or not, and then to explore the underlying mechanisms. Methods: follicular fluid (containing cumulus granulosa cells) was collected from women with EM and male factor infertility at our Clinical Reproductive Medicine Center, and peritoneal fluid was collected from the above patients with EMs. The expression of ovulation-related genes in cumulus cells was analysed by RT-PCR. Mouse cumulus cells expansion degree was assessed after cultured in follicle fluid from infertile women. Follicle fluid was detected by ELISA. Oocytectmized complex cell model was established, and cultured in vitro medium with addition of 100 IU/ml FSH. TUNEL staining was used to determine the apoptosis of cumulus cells. Then, we explored expression of P-SMAD2/3,key enzyme for retinoic acid metabolism, and methylation of SP1 binding sites in Lhcgr promoter region. Meanwhile, the P-AKT and P-catenin were assessed by Western blot. All experiments were performed independently at least three times, and data are presented as mean ± SEM. Statistical analyses were performed using Graphpad Prism 5 software p<0.05 (* and different letters) were defined as significant differences. Results: In cumulus cells, expression of genes related to ovulation decreased significantly than that in controls (P < 0.05), especially starting from LHCGR . The concentrations of IL-8 and TNF-α in follicle fluid were significantly higher in infertile women with endometriosis than in controls (P < 0.05). The function of follicle fluid and pelvic fluid of endometriosis women have changed. Addition of 500 pg/mL IL-8/TNF-α to medium did not cause significant apoptosis of cumulus cells, but inhibited P-AKT and P-β-catenin. On the other hand, expression of P-SMAD2/3 and retinoic acid production were reduced, while hypermethylation of the Sp1 binding sequence on Lhcgr promoter was identified, and Lhcgr expression was significantly reduced compared to control (P<0.05). Conclusion: Elevated IL-8/TNF-α in follicular fluid of women with endometriosis indirectly maintains Lhcgr promoter hypermethylation through activation of P-SMAD2/3, while inhibiting AKT and β-Catenin phosphorylation, which together reduce LHCGR mRNA expression. Endometriosis ovulation IL-8 TNF-α LHCGR Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction To date, there is evidence for many causes of infertility in women with EMs, including ovulation disorders (follicular dysplasia and LUFs), low postoperative ovarian function, abnormal tubal function, and low endometrial tolerance ( 1 – 5 ). In natural menstrual cycles, 13–73% of women with EMs have a history of LUF resulting in anovulatory infertility, reducing the natural pregnancy rate to less than 11% ( 6 , 7 ). In addition, our group recently found that infertile women with EMs have a low oocyte retrieval rate during IVF cycles, which may be related to insufficient cumulus expansion: a critical biological event for ovulation ( 8 ). However, the underlying pathophysiological mechanisms between EMs and ovulatory dysfunction are poorly understood. Under physiological conditions, binding of LH to its receptor triggers an ovulatory signaling cascade within the mature follicle, where EGF-like growth factors are produced by the granulosa cells and delivered to the cumulus cells, in turn inducing the biological events of cumulus expansion and follicular rupture, leading to ovulation ( 9 – 11 ). This process resembles an inflammatory response: the follicles become engorged with blood, produce prostaglandins, and synthesize hyaluronic acid-rich ECM containing a variety of cytokines and inflammatory factors ( 12 ). Meanwhile, endometriosis has long been considered a chronic sterile inflammatory disease with elevated levels of various inflammatory factors in the pelvis ( 13 , 14 ). Previous studies have reported that altered inflammatory factors in the pelvis (the microenvironment in which the ovaries are located) in women with EMs interfere with ovulation ( 2 , 15 – 19 ). Ronnberg's group and Koskimies et al. have previously reported lower LH receptor concentrations in the granulosa cells of either the developing follicle or the corpus luteum in infertile women with EMs than in controls (including male or tubal factor infertility), but have not elucidated the underlying mechanism ( 6 , 20 ). In fact, many local factors, including hormones and cytokines, may be involved in the regulation of LHR expression ( 21 ). Previous studies have reported that the endometrial foci induce an inflammatory response that is thought to be mediated by macrophages, lymphocytes, and mononuclear phagocytes ( 22 – 24 ). Cytokines such as interleukin (IL)-1, 6, 8, 10, vascular endothelial growth factor (VEGF), and tumor necrosis factor (TNF)-alpha are found at high levels in the peritoneal fluid (PF) of women with endometriosis ( 25 , 26 ). Nakao K et al illustrated that TNF-α inhibits FSH-induced LH receptor expression through transcriptional regulation in rat granulosa cells ( 21 ). Therefore, exploring the relationship between the inflammatory factor and LH receptor expression may help explain the ovulation disorder in women with EMs. The study of LH receptor expression in granulosa cells of women with endometriosis has not progressed much over the years due to the lack of ideal study models. In granulosa cells of the developing follicle, FSH activates several signaling pathways including phosphatidylinositol 3-kinase/AKT and inhibits phosphatidylinositol SMAD2/3 to express the LH receptor ( 27 , 28 ). Currently, granulosa cells obtained from immature follicles of female mice or rats are used to study the molecular mechanism of LH receptor expression ( 29 , 30 ). However, due to the estrous cycle, it is difficult to ensure that the granulosa cells used in experiments are at an immature stage when LH receptors are almost not expressed ( 31 ). Oocyte-ectomized (OOX) cumulus cells are a better model to study LH receptor de novo synthesis, which is performed by microsurgically removing the oocyte from the COCs, leaving the spherical zona pellucida and its surrounding cumulus cell population, as previously described ( 32 , 33 ). After removal of the oocyte from the COCs, SMAD2/3 dephosphorylation and LH receptor de novo synthesis subsequently occur in the OOXs as the paracrine effect of the oocyte on the cumulus cells is blocked. ( 32 ). The aim of the present study was to investigate whether certain inflammatory factors in the follicular fluid of women with EMs are responsible for impaired follicular development or (and) ovulation, and then to explore the underlying mechanisms. The concentration of inflammatory factors in the follicular fluid of infertile women with EMs was determined. Then, we investigated IL-8/TNF-a on FSH-induced Lhcgr mRNA expression levels and mechanisms of regulation in OOXs. We found that elevated IL-8/TNF-α in follicular fluid of women with EMs indirectly maintains Lhcgr promoter hypermethylation through activation of p-Smad2/3, while inhibiting AKT and β-catenin phosphorylation, which together reduce Lhcgr mRNA expression. Materials and methods Inclusion criteria and exclusion criteria for clinical sample collection A total of 80 infertile women (infertility with endometriosis or male factor) undergoing IVF at the Center of Reproductive Medicine, First Affiliated Hospital of Nanjing Medical University (NMU) were recruited for this study. This study was approved by the research ethics committee of the hospital. All infertile women who met the eligibility criteria and agreed to participate in the study provided written informed consent. Inclusion criteria All infertile patients were less than 40 years of age. According to the American Society for Reproductive Medicine (ASRM) criteria, we selected the EMs infertile women who were diagnosed by laparoscopic surgery and had a history of LUF as the EMs group. Women with male-factor only infertility who received ovulation induction for ICSI treatment were considered as the control group. Here, we determined the absence of endometriosis in control women by clinical presentation: women without dysmenorrhea, without dyspareunia and without sacral ligament tenderness, and with serum CA125 30 kg/m2, alcohol consumption, smoking, chronic anovulation with polycystic ovary syndrome (PCOS) or other causes, autoimmune diseases, diabetes mellitus, hydronephrosis and hypovarian reserve function (DOR), and thyroid disease were excluded. Ovarian stimulation, oocyte retrieval and clinical sample collection We selected 40 infertile women with EM and 40 women with male-factor infertility for specimen collection based on the above criteria. Ovarian stimulation, oocyte retrieval and clinical specimen collection were performed as previously described ( 8 ). Follicular fluid and cumulus cells (CCs): Follicular fluid containing cumulus cells in 40 patients with EMs and 40 women with male-factor infertility undergoing IVF was aspirated by egg retrieval under ultrasound guidance. Then, the supernatant was collected and processed separately after centrifugation. Cumulus cells were isolated by Percoll density gradient centrifugation and rapidly transferred to Eppendorf (EP) tubes. In addition, we removed some CCs from the outermost layer of the expanded COCs with a 1 ml sterile syringe needle, while ensuring that the quality of the COCs was not compromised. Peritoneal fluid: In addition, peritoneal fluid was collected from women with stage III-IV EM and from women undergoing laparoscopic surgery for other conditions during laparoscopic procedures. All samples were independently frozen at -80°C for follow-up testing. Chemicals and Reagents All chemicals and reagents were purchased from Sigma, USA, unless otherwise stated. ELISA test The concentration of inflammatory factors in the follicular fluid of 40 patients with EMs and 40 patients with male factors was determined by ELISA (MultiSciences Biotech, 70-EK101A-96, China). To avoid operator error, three independent replicate wells were made for each sample. We calculated the mean concentration of inflammatory factors in follicular fluid for each woman based on the standard curve, and then performed statistical analysis between the two groups. Mice Female C57/B6j mice, 22 to 24 days old, were generated and maintained for experimental use at the Animal Center of Nanjing Medical University (NMU). All experimental procedures and protocols were approved by the Animal Care and Use Committee of NMU and were performed in accordance with institutional guidelines for the care and use of laboratory animals. Mice were housed in ventilated cages with a 12-hour light/12-hour dark cycle, constant temperature (22°C), and controlled humidity. Superovulation test in mice Twelve 22- to 24-day-old C57/B6j mice of similar body weight were randomly divided into 2 groups: the control group and the EMs group. Three independent replicate experiments were performed in this study, with six mice in each group during the experiments. Female mice were stimulated to develop follicles by intraperitoneal injection of 0.1 mL (5 IU) of equine chorionic gonadotropin (eCG), while mice in the control group were injected intraperitoneally with 0.1 mL of saline and mice in the experimental group were injected intraperitoneally with 0.1 mL of peritoneal fluid from patients with EMs. After 46–48 hours, 0.1 mL (5 IU) of human chorionic gonadotropin (HCG) was injected into the peritoneal cavity of the mice to induce ovulation. Twenty-four hours after HCG injection, COCs clusters were collected from the oviducts of euthanized mice. Oocytes were obtained by digesting excess CCs around the COCs with hyaluronidase, followed by statistical analysis. Follicle count and morphological analysis In each group, post-ovulatory ovaries were collected and fixed in 4% formaldehyde, followed by paraffin embedding and serial sectioning at a thickness of 5 µm per section. Subsequently, periodic acid-Schiff (PAS) staining was used for morphological and statistical analysis in this experiment. To avoid duplicate or missed counts, every 25 sections were counted once to assess luteal and anovulatory follicles as accurately as possible. Cumulus expansion in COCs in Vitro We isolated COCs by puncturing large luminal follicles with a pair of 26-gauge needles 44–48 hours after eCG injection, and collected COCs in culture media with a fine-bore glass pipette. COCs were cultured in commercial in vitro maturation (IVM) medium (with and without FSH) (MEM-α, Gibco, USA), follicular fluid from patients with EM, and follicular fluid from infertile women in the control group. The COCs were incubated in a modular incubation chamber at 37°C with 90% N2, 5% CO2, and 5% O2 for 14 hours. After 14 hours of in vitro incubation, the extent of COC expansion was observed and scored by microscopy. Cumulus cells in OOXs in Vitro culture Oocytectomized (OOX) cumulus cells are prepared by microsurgically removing the oocyte from the COCs, leaving the spherical zona pellucida and its surrounding cumulus cell population. OOX cumulus cells were cultured in basal medium supplemented with 5% fetal bovine serum and 100 U/l FSH and covered with MEMα-washed mineral oil on 50 µL drops of culture solution. Intact OOX were co-cultured with full-grown oocytes (FGO) at a density of 2 oocytes/µL, TNF-α (500 pg/mL), and IL-8 (500 pg/mL) in the modular incubation chamber. After 24 hours, we collected only OOX cumulus cells, which were independently snap-frozen and stored in liquid nitrogen at -80°C for subsequent testing. Total RNA extraction and reverse transcription in vitro Total RNA was extracted from human and mouse CCs using the RNeasy Micro Kit (Qiagen, 74034, Germany) according to the manufacturer's protocol. The quality of extracted total RNA was checked by electrophoresis on a 1% agarose gel. In vitro transcription was performed using the QuantiTect Reverse Transcription Kit (Qiagen) at 42°C for 15 min, as previously described ( 34 ). All steps were performed under RNase-free conditions. Real-Time PCR analysis Real-time PCR for the detection of gene expression in cumulus cells was performed using a commercial kit (Takara, Japan). The PCR system (20 µl) contained 10 µl of SYBR Green PCR master mix, 1 µl of forward and reverse primers, 0.4 µl of Rox reference dye, and 6.6 µl of ddH2O and 1 µl of cDNA. Relative fold changes in mRNA levels were calculated using the 2-ΔΔCt method and expressed as relative changes compared to a specific group (control). GAPDH (human) and Rpl19 (mouse) were used as internal controls. The sequences of the primary primer pairs used in this study are listed in Table. 1 in the Supplementary Appendix. Table 1 Primary primer pairs used in RT-PCR Gene ID Forward primers(5’ − 3’) Reverse primers(5’ − 3’) GAPDH LHCGR AREG EREG BTC HAS2 PTGS2 PTX3 TNFAIP6 ADAMTS-1 PGR Rpl19 Lhcgr Has2 Ptgs2 Ptx3 Tnfaip6 Adh1 Adh5 Aldh1a1 Aldh1a7 Cyp26b1 ACCACAGTCCATGCCATCAC GACGACACTGACTTCACTGGA TCAAAATTTCTGCATTCACGGAG CACAGTCGTCGGTTCCACA CACTGCTCCTGGCCCTTG TCATGCAAAAATGGGGTGGAAA ACTAGAGCCCTTCCTCCTGT TGGCCGCGGTGCTAGA GGCCCAACTGTGGATTTGGA TGTGTGTGATCCGAGCAGAA TGGCAGATCCCACAGGAGTT TCAGGCTACAGAAGAGGCTTGC TACATAACCACCATACCAG CGAGTCTATGAGCAGGAGCTG CCCTTCCTCCCGTAGCAGAT TTGCTGAGACCTCGGATGAC ATACAAGCTCACCTACGCCGAA TTGGCTGTAAAGCAGCAGGA TGAACACTGCCAAGGTGGAG CCCGGATTTTTGTTGAGGAG CTGTCCCTGTCCAATGCCCA GATCCTACTGGGCGAACACC TCTAGACGGCAGGTCAGGTC GACTCTAGGCCATAGCTCGG ATGGACTTTTCCCCACACCG ACTCTGGATCCCCTGAGGTA TCCTCAGGGTCTCCACAGAG ACACCTCCAACCATGGGATCT CCTGGGGATCAGGGATGAACT CTTCTTGGAACGCATTGGGAA TAAAGACGCCACCACACTCC CACCATTAAGGCTGGCACAC GGGTTTGACTTCGTAGCCCTT ATCAGCCCATCCTTGATCAGC AGTTCCTAAAGGCACAGC GTGATTCCGAGGAGGAGAGACA TGAACTCTCTCCGTAGAAGAACCTTT GCGAGTTCTCCAGCATGATGA ATCCATCCAGCAGCACAGACAT CATGGGGTTCATGGAGAGGT ACGAGGACTTCCTGGATGGA GAGAACACTGTGGGCTGCAC GGTGACTGTATGAGATGTACAGC TGCTCCAGGCTCGAAGTGTA Western Blot OOXs were harvested, lysed with 2x Laemmli sample buffer, and heated at 105°C for 5 minutes, followed by electrophoresis. Collected protein was loaded onto 8% or 10% polyacrylamide gels, resolved by SDS-PAGE, and transferred to polyvinylidene difluoride (PVDF) membranes for protein detection as described in a previous study ( 35 ). In this study, antibodies were purchased from Cell Signaling Technology: rabbit anti-phospho-AKT (1:1000), rabbit anti-AKT (1:1000), rabbit anti-phospho-SMAD2/3 (1:1000), rabbit anti-SMAD2/3 (1:1000); from Abcam: mouse anti-phospho-β-catenin S552 (1:1000); and from Proteintech: rabbit anti-Bax (1:5000), rabbit anti-bcl2 (1:10000). The expression of β-actin (ACTB) detected by anti-β-actin antibody (1:2,000, A1978) was used as an internal control for each sample. Finally, the WB data were quantitatively analysed using Image J software. Genomic DNA extraction The Ezup Column Animal Genomic DNA Purification Kit (Sangon Biotech) was used to obtain genomic DNA from mouse OOXs cells according to the manufacturer's instructions. For NGS sequencing, genomic DNA was prepared. Next-Generation Sequencing-based Methylation analysis Combining Bisulfite Sequencing PCR (BSP) technology and high-throughput sequencing technology, the methylation of each CpG site in the target sequence can be detected more rapidly and accurately. The MethPrimer database predicted CpG islands in the putative Lhcgr promoter region. CCCAGGTCAAGGAGAACAGGGACAGG CG GTGAGAGGGGAGGGCTGGAG CG GG CG GGGGC CG G CG GGTGGGAAGGCAGGC CG AGGGG CG GGCAGAGGGTA CG GG CG GGCCCCC CG GG CG GTCCAGCA TACTGGCCTAGCCAC CG GAGCTCACACT CAGGCTGG CG GGCCATGGGG CG G CG GGTCC CG GCTCTGAGACAGCTGCTGGTGCTGGCAAT. The banded box shows the designed primer positions and the middle part is the sequence to be tested. 16 CpG sites are contained in the M690 gene fragment. The positions in the sequence are as follows: 2, 24, 28, 35, 38, 55, 62, 75, 79, 88, 92, 117, 138, 150, 153, and 160. Numbered 1–16. For sequence analysis, the PCR product was cloned into the TOPO TA cloning vector. A BigDye Terminator version 3.1/1.1 Cycle Sequencing Kit (Applied Biosystems) was used for sequencing. Percentage methylation of CpG sites in Lhcgr promoter region was analyzed using Quantification tool for methylation analysis as previous reported ( 35 ). Statistical Analysis All experiments were performed independently at least three times, and data are presented as mean ± SEM. Statistical analyses were performed using Graphpad Prism 5 software (Graphpad Software, USA). p < 0.05 (* and different letters) were defined as significant differences. Results Down-regulation of ovulation-related key gene expression in CCs of EMs infertile women As shown in the schematic, coupling of LH to LH receptors triggers the ovulation cascade signal, which is responsible for key biological events in the follicle, such as cumulus expansion and follicle rupture, during which the expression of many genes show dynamic changes (Fig. 1 A). The genes required for ovulation in mouse CCs cells were detected by qRT-PCR in both EMs and control groups. It showed that the expression of ADAMTS-1 was significantly decreased (P 0.05) (Fig. 1 B-C). Subsequently, the expression of cumulus expansion-related genes, HAS2 and PTGS2, was significantly reduced in CCs from EMs women (P 0.05, Fig. 1 F-G). Compared to the control group, all genes encoding EGF-like factors were significantly decreased in the CCs of the EMs group to varying degrees (BTC, P < 0.05, Fig. 1 G-I). Interestingly, LHCGR mRNA levels in CCs of infertile women with EMs are significantly lower than in the control group (P < 0.01, Fig. 1 G-I). Elevated expression of certain cytokines in follicular fluid of infertile women with endometriosis Given that many cytokines are secreted by ectopic endometrial lesions in the pelvis of women with endometriosis, we wondered whether or not the intrafollicular microenvironment is altered by inflammation. We tested the levels of inflammatory factors in the follicular fluid of infertile women in both groups by ELISA. It showed that the levels of IL-1a, IL-1b, and IL-4 were not significantly different between the control and EMs groups (P > 0.05, S Fig. 1 A-C). However, the concentrations of IL-8, IL-10, and TNF-α in the follicular fluid were increased to different degrees in the EMs group compared with the control group, and all differences were statistically significant (P < 0.05). In particular, IL-8 and TNF-α were interesting and representative among the increased cytokines (IL-8: 166.8 ± 8.8 vs. 223.4 ± 12.6; TNF-α: 81.89 ± 14 vs. 119.2 ± 39.9 in the control group vs. EMs group, P < 0.05) (Fig. 1 D, E, G). In addition, the results showed that the levels of IL-13, PGE2, and PGF2α were significantly lower in the control group than in the EMs group (P < 0.05 S Fig. 1 F, H, I). Intra- or extra-ovarian microenvironment inflammatory alteration impairs cumulus expansion in vitro and disrupts ovulation in vivo in mice. In vitro, cumulus expansion is the most important visual response to the ovulation signal initiated by the LH surge, and comparing COC expansion in different follicular microenvironments helps to determine their follicular fluid functional changes. After 14 hours of incubation in this experiment, we found that mouse COCs in the blank control group (basal medium only) showed "0" degree expansion: the oocytes were distributed in clusters and (or) granules, and the cumulus cells were tightly connected to the oocytes, the cells were in good condition, and some of the outer CCs were detached and growing against the bottom of the culture dish (S Fig. 2 A (I)). COCs cultured in the positive control group (medium containing 10 ng/ml EGF) showed full expansion, mucinisation of the extracellular matrix between the CCs, increased cell spacing, and outward radiation of the "radial crown" between the oocytes and the innermost CCs (S Fig. 2 E (II)). In addition, when we cultured COCs with follicular fluid from women with male factor infertility, they showed fully expanded COCs after 14 hours, which was similar to the expansion of CCs in the positive control group (S Fig. 2 A (III)). However, in the EMs group, where COCs were exposed to follicular fluid from infertile women with EMs, some CCs had a morphology similar to that of the blank control group, with a clustered, granular distribution, no outwardly radiating "radial crown", and a large number of CCs were shed from the COCs (S Fig. 2 A (IV)). In vitro, mice were injected intraperitoneally with eCG along with peritoneal fluid (from EMs women) or normal saline to observe the number of ovulated COCs in the oviduct; unruptured follicles, and corpus luteum in the ovary after ovulation. We found no difference in body weight between mice on the day of eCG injection and on the day of COC retrieval (S Fig. 2 A), while the mean number of ovulated COCs was 53.5 ± 5.7 in the control group and 35.4 ± 1.9 in the EMs group. The number of ovulated oocytes was significantly lower in the EMs group compared to the control group (S Fig. 2 B-C, P < 0.05). Twenty-four hours after HCG administration, we found that the corpus luteum/corpus luteum + unruptured follicles) was 85.1% in the control mice and 68.9% in the EMs group. After PAS staining, more unruptured mature follicles and fewer post-ovulatory corpus luteum were seen in the EMs group compared to the control group (S Fig. 2 D-E). IL-8/TNF-α inhibits FSH-induced Lhcgr expression in OOXs with fewer cumulus cells apoptosis. The results of TUNEL staining showed that some CCs cultured in basal medium showed apoptosis after in vitro FSH induction, whereas apoptosis (Cy3-dUTP) was significantly attenuated in the oocyte group with the addition of concentrations of 500 pg/ml IL-8 or (and) 500 pg/ml TNF-α (Fig. 2 . A). It was then shown that BAX/BCL2 (considered as a marker of apoptosis) was significantly reduced by the addition of IL-8 or (and) TNF-α compared to OOX cultured in basal medium (Fig. 2 B). On the basis of OOXs, Lhcgr expression was extremely increased when the oocyte was removed by microsurgery because the inhibition of paracrine effects was released. Lhcgr mRNA levels were extremely high in OOXs when the oocyte was removed by COCs because the inhibition of its paracrine effects was prevented. However, its expression decreased significantly when co-cultured with FGOs. When 500pg/ml IL-8 or (and) TNF-α was added to the medium, the FSH-induced expression of Lhcgr was significantly downregulated (Fig. 2 C). IL-8/TNF-α reduces methylation of the Sp1 binding site in the Lhcgr promoter through activation of the P-SMAD2/3-RA pathway As previously reported, the oocyte reduces Lhcgr expression through activation of the P-SMSD2/3-RA-Lhcgr promoter region demethylation pathway by paracrine factors ( 31 ). The Western blot result showed that SMAD2/3 phosphorylation was significantly activated in OOXs when treated with TNF-α alone and IL-8 plus TNF-α (Fig. 3 A). We analyzed the key genes encoding the rate-limiting enzymes for retinoic acid (RA) synthesis and catabolism. Notably, the expression of Adh1 , Aldh1 and Aldh5 in OOXs was significantly decreased to varying degrees after the addition of IL-8/TNF-α compared to the control (Fig. 3 B, D, E). No significant difference was found for either Adh5 or Cyp26b1 in the OOXs with or without the above cytokines (Fig. 3 C, F). We found hypermethylation at each of the sites in the Lhcgr promoter region in the COCs, whereas demethylation occurs in the OOXs group. Methylation of the Lhcgr promoter region was hyperactive in OOXs co-treated with IL-8 and TNF-α compared to OOXs cultured in basal medium (Fig. 3 G). IL-8/TNF-indirectly lowers Lhcgr expression by inhibiting β-Catenin and AKT phosphorylation in OOXs Through a cAMP-PKA-dependent mechanism, FSH directly or indirectly increases β-Catenin and AKT phosphorylation in granulosa cells, which in turn activates the transcriptional activity of Lhcgr and promotes its expression. ( 21 ). According to WB results, IL-8 and TNF-α at 500 pg/ml significantly inhibited the phosphorylation of β-catenin and AKT, which ultimately resulted in a downregulation of Lhcgr expression in OOXs. Notably, IL-8 inhibited their phosphorylation to a greater extent than TNF-α (Fig. 4 A-B). Discussion The aim of our study was to investigate the possible mechanism of frequent LUF and difficult oocyte retrieval in infertile women with EMs. We have shown that key ovulation genes are downregulated in cumulus granulosa cells of infertile women with EMs, as evidenced by dysregulated LHCGR-mediated ovulation cascade signaling. IL-8/TNF-α are represented and significantly elevated cytokines in follicular fluid during LH-mediated ovulation in women with EMs. OOXs used in this experiment could be considered as an ideal cell model to mimic FSH-induced do novo synthesis of Lhcgr . Addition of 500 pg/ml IL-8/TNF-α inhibits Lhcgr expression in OOXs with fewer cumulus cell apoptosis. We also demonstrated that the reduced RA production in cumulus cells was due to the activation of P-SMAD2/3 by IL-8/TNF-α, then the attenuation of Lhcgr promoter methylation, and finally the impaired Lhcgr expression. On the other hand, the cytokines indirectly affected Lhcgr translational activity by inhibiting P-β-catenin and P-AKT, resulting in lower levels of Lhcgr mRNA in OOXs (Fig. 4 B). The higher incidence of LUF in natural cycles and difficult egg retrieval in ovarian induction cycles can be considered as a poor response to LH surge, as there was no significant difference in peripheral LH concentration between EM and other infertile women in our previous study ( 8 ). Antral follicles begin to express LHR upon FSH induction, and as the follicles mature, LH acts on the mural granulosa cells to promote their expression of EGF-like growth factors ( AREG/EREG/BTC ), which in turn act on the cumulus cells to promote the expression of cumulus expansion genes ( HAS2/PTGS2/PTX3/TNFAIP6 ), followed by the expression of protease-related genes ( ADAMTS-1/RIP140 ) and transcription factors ( PGR ) in the mural granulosa cells in preparation for ovulation( 9 , 10 , 12 , 36 ). A deficiency of any of these cytokines will affect cumulus expansion and consequently ovulation ( 9 , 10 , 12 , 36 ). We believe that the ovulation signaling cascades initiated from LHCGR in the follicles of EMs infertile women were defective, and many studies also show downregulation of PTGS -2, HAS -2, EREG , and LHCGR in EMs women, which is similar to our findings ( 6 , 8 , 37 , 38 ). Based on this result, it seems understandable that LUF and follicular dysplasia are common in EMs sterility. Abnormal founcation and cytokines of Follicular fluid were observed in EMs women. The follicle is the smallest functional unit within the ovary, and the internally filled follicular fluid is the immediate living environment for COC survival. Indeed, alteration in composition will inevitably lead to functional changes. We have confirmed that the follicular fluid and peritoneal fluid of EM women are not sufficient to support cumulus expansion and ovulation. It should be noted that induction of ovulation in mice with human follicular fluid may slightly affect ovulation due to species-specific rejection reactions. In EMs, lots of cytokines in follicular fluid altered, especially IL-8 and TNF-α. In two other recent studies, researchers found that IL-6 and TNF-α were significantly elevated in the follicular fluid of patients with EMs ( 39 , 40 ). The concentration of cytokines detected in this experiment always correlates positively with the severity of endometriosis and provides a reference for later addition of IL-8 and TNF-α. The concentrations of inflammatory factors used in this study were determined based on the concentrations of IL-8 and TNFα measured in the follicular fluid of patients, which were able to cause a decrease in LHR expression in mice at the corresponding concentrations, while not causing massive apoptosis of mouse cumulus cells, so we did not explore the effect of the concentration gradient of the two inflammatory factors. Recently, Yu Tanaka et al. found that TNF-α expression could be suppressed by inhibiting inflammatory factor-induced neutrophil chemokine activity, which in turn reduced follicular atresia and apoptosis ( 41 ), but this study did not investigate the causal relationship between TNF-α and cumulus cell apoptosis at specific concentrations. In another study, bovine follicular cumulus cells were monitored in vitro using different concentrations of TNF-α (1, 10, 100, and 200 ng/ml) and their survival status was observed, and it was found that 1 ng/ml caused apoptosis and follicular atresia in antral follicular cumulus cells ( 42 ). However, the concentration used in this study was much higher than the dose of TNF-α concentration (500 pg/ml) used in this study. LHR-specific dominant expression in granulosa cells is important for the transition from FSH-dependent to LH-dependent follicles, especially for the morphology and function of mature follicles ( 43 ). LHR is a G protein-coupled 7-transmembrane glycoprotein, and its expression is extremely low on the surface of granulosa cells and oocytes in the wall of the pre-antral follicular phase. FSH promotes retinoic acid synthesis in granulosa cells, which mediates regulation to stimulate demethylation of the LH receptor promoter region on the granulosa cell surface and increased LHCGR expression. In cumulus cells, oocytes promote the SMAD2/3 pathway through the release of oocyte-derived paracrine factors (ODPFs) to inhibit retinoic acid synthesis, and the LH receptor promoter region is maintained at a high level of methylation, resulting in lower levels of LHCGR on the surface of cumulus cells. ( 31 ). In this study, we found that higher concentrations of IL-8/TNFα, which cause little apoptosis in cumulus cells, could differentially activate P-SMAD2/3 to reduce RA production, maintain higher methylation levels of the Lhcgr promoter Sp1 binding region, and reduce Lhcgr transcriptional activity, resulting in reduced Lhcgr mRNA expression. It has been reported that TNFα inhibits the transcriptional activity of the Lhcgr proximal promoter by promoting the entry of NF-κB (p65 protein) into the nucleus, although the Lhcgr promoter region has no NF-κB binding site and NF-κB can achieve Lhcgr transcriptional regulation through protein-protein interactions. ( 44 ). However, the exact mechanism has not been clarified, and it is speculated that the p65 protein is involved in the synthesis of the Lhcgr promoter transcriptional repressor ( 21 ). In addition, we found that IL-8/TNF-α can also indirectly activate PI3K to repress P-AKT, which promotes Lhcgr expression by promoting the exit of transcriptional repressor FOXO1 from the nucleus and relieving the repressive effect on Lhcgr transcription, while at the same time, inhibition of β-catenin phosphorylation fails to induce the transcription factor TF3 to replace the transcriptional conjugate bound to the Lhcgr promoter GRE, thereby indirectly reducing Lhcgr transcriptional activity. In this study, we focused only on Lhcgr expression, the LH-LHR binding efficiency should be explored. The design idea of this project originated from common clinical phenomena, and scientific questions were raised based on actual clinical difficulties to find the elevated inflammatory factors in the microenvironment - follicular fluid - on which COC depends, and to explore the mechanism. Therefore, to provide a new perspective to clinically address the problem of poor response to LH during ovulation in patients with EMs, we used an ideal in vitro cell culture model to discover the relationship between IL-8/TNFα and Lhcgr expression in cumulus cells and to first explore the potential specific molecular mechanisms. Conclusion Increased IL-8/TNF-α in the follicular fluid of women with EMs indirectly maintains the hypermethylation of the Lhcgr promoter through activation of P-SMAD2/3, while inhibiting AKT and β-catenin phosphorylation, which together reduce the expression of Lhcgr . This may explain, in part, the poor response to LH in the (induction of) ovulation in infertile women with EMs. Declarations Ethics approval and consent to participate This study was approved by the Research Ethics Committee of the hospital. All infertile women who met the eligibility criteria and agreed to participate in the study provided written informed consent. Mice were raised under the standard conditions at the Research Animal Center at Nanjing Medical University. All mouse procedures and protocols were approved by the Animal Care and Use Committee of each institution, and conducted in accordance with the institutional guides for the care and use of laboratory animals. Consent for publication No applicable Availability of data and materials The data underlying this article will be shared on reasonable request to the corresponding author. Competing interests The authors declare that they have no competing interests. Funding This study was supported by projects from the National Nature and Science Foundation (82101728, 81730041) and the National Key Research and Development Program of China (2017YFC1001604 and 2017YFC1001300) and the Nature and Science Foundation of Jiangsu Province (BK20191491). The funding bodies had no role in the design of the study; the collection, analysis, and interpretation of the data; or the writing of the manuscript. Authors’ contributions In this study, Yaoxue Yin collected data by interviewing the infertile women, and wrote the final draft of the manuscript. Yaoxue Yin, Caihe Wen, and Wangjuan Dai performed the molecular biological analysis. Jing Wang and Mengyu Zhang helped with clinical data analysis. Yundong Mao and Xiang Ma participated in the initial conception of the study and the protocol. Feiyang Diao modified and polished the entire manuscript. Lianju Qin helped with the statistical methods and polish of the manuscript. Yugui Cui provided the design and protocol of the research and reviewed and modified the final version of the manuscript. Jiayin Liu and Zhen Hou, as the main investigators, conceived of this project and reviewed and ensured the final version of this manuscript. All authors read and approved the final manuscript. Acknowledgements The authors gratefully acknowledge the efforts of the doctors, nurses, embryologists, and the entire staff at the Clinical Reproductive Medicine Center of the First Affiliated Hospital in Nanjing Medical University, Nanjing, China. References Bulun SE. Endometriosis. N Engl J Med. 2009;360:268–79. Koninckx PR, Kennedy SH, Barlow DH. Endometriotic disease: the role of peritoneal fluid. Hum Reprod Update. 1998;4:741–51. Du YB, Gao MZ, Shi Y, Sun ZG, Wang J. Endocrine and inflammatory factors and endometriosis-associated infertility in assisted reproduction techniques. Arch Gynecol Obstet. 2013;287:123–30. Macer ML, Taylor HS. Endometriosis and infertility: a review of the pathogenesis and treatment of endometriosis-associated infertility. Obstet Gynecol Clin N Am. 2012;39:535–49. Tanbo T, Fedorcsak P. Endometriosis-associated infertility: aspects of pathophysiological mechanisms and treatment options. Acta Obstet Gynecol Scand. 2017;96:659–67. Koskimies AI, Liukkonen S, Tenhunen A, Huhtaniemi I. Low LH receptor content in corpora lutea in luteinized unruptured follicle (LUF) syndrome. Hum Reprod. 1987;2:367–9. Kaya H, Oral B. Effect of ovarian involvement on the frequency of luteinized unruptured follicle in endometriosis. Gynecol Obstet Invest. 1999;48:123–6. Yin Y, Mao Y, Liu A, Shu L, Yuan C, Cui Y, et al. Insufficient Cumulus Expansion and Poor Oocyte Retrieval in Endometriosis-Related Infertile Women. Reproductive Sci. 2021;28:1412–20. Su YQ, Sugiura K, Li Q, Wigglesworth K, Matzuk MM, Eppig JJ. Mouse oocytes enable LH-induced maturation of the cumulus-oocyte complex via promoting EGF receptor-dependent signaling. Mol Endocrinol. 2010;24:1230–9. Eppig JJ, Wigglesworth K, Pendola FL. The mammalian oocyte orchestrates the rate of ovarian follicular development. Proc Natl Acad Sci USA. 2002;99:2890–4. Wigglesworth K, Lee KB, O'Brien MJ, Peng J, Matzuk MM, Eppig JJ. Bidirectional communication between oocytes and ovarian follicular somatic cells is required for meiotic arrest of mammalian oocytes. Proc Natl Acad Sci USA. 2013;110:E3723–9. Richards JS, Liu Z, Shimada M. Immune-like mechanisms in ovulation. Trends Endocrinol Metab. 2008;19:191–6. Taylor HS, Kotlyar AM, Flores VA. Endometriosis is a chronic systemic disease: clinical challenges and novel innovations. Lancet. 2021;397:839–52. Chapron C, Marcellin L, Borghese B, Santulli P. Rethinking mechanisms, diagnosis and management of endometriosis. Nat reviews Endocrinol. 2019;15:666–82. Weiss G, Goldsmith LT, Taylor RN, Bellet D, Taylor HS. Inflammation in reproductive disorders. Reproductive Sci. 2009;16:216–29. Bulun SE, Yilmaz BD, Sison C, Miyazaki K, Bernardi L, Liu S, et al. Endometr Endocr reviews. 2019;40:1048–79. Filip L, Duica F, Pradatu A, Cretoiu D, Suciu N, Cretoiu SM et al. Endometriosis Associated Infertility: A Critical Review and Analysis on Etiopathogenesis and Therapeutic Approaches. Medicina 2020;56. Wu MH, Shoji Y, Chuang PC, Tsai SJ. Endometriosis: disease pathophysiology and the role of prostaglandins. Expert Rev Mol Med. 2007;9:1–20. Nothnick W, Alali Z. Recent advances in the understanding of endometriosis: the role of inflammatory mediators in disease pathogenesis and treatment. F1000Research 2016;5. Ronnberg L, Kauppila A, Rajaniemi H. Luteinizing hormone receptor disorder in endometriosis. Fertil Steril. 1984;42:64–8. Nakao K, Kishi H, Imai F, Suwa H, Hirakawa T, Minegishi T. TNF-alpha Suppressed FSH-Induced LH Receptor Expression Through Transcriptional Regulation in Rat Granulosa Cells. Endocrinology 2015;156:3192 – 202. Haney AF, Muscato JJ, Weinberg JB. Peritoneal fluid cell populations in infertility patients. Fertil Steril. 1981;35:696–8. Hill JA, Anderson DJ. Lymphocyte activity in the presence of peritoneal fluid from fertile women and infertile women with and without endometriosis. Am J Obstet Gynecol. 1989;161:861–4. Hammond MG, Oh ST, Anners J, Surrey ES, Halme J. The effect of growth factors on the proliferation of human endometrial stromal cells in culture. Am J Obstet Gynecol. 1993;168:1131–6. discussion 6–8. Wu MY, Ho HN. The role of cytokines in endometriosis. Am J Reprod Immunol. 2003;49:285–96. Arici A. Local cytokines in endometrial tissue: the role of interleukin-8 in the pathogenesis of endometriosis. Ann N Y Acad Sci. 2002;955:101–9. discussion 18. Imai F, Kishi H, Nakao K, Nishimura T, Minegishi T. IL-6 up-regulates the expression of rat LH receptors during granulosa cell differentiation. Endocrinology. 2014;155:1436–44. Zhou P, Baumgarten SC, Wu Y, Bennett J, Winston N, Hirshfeld-Cytron J, et al. IGF-I signaling is essential for FSH stimulation of AKT and steroidogenic genes in granulosa cells. Mol Endocrinol. 2013;27:511–23. Lin X, Tong X, Zhang Y, Gu W, Huang Q, Zhang Y et al. Decreased Expression of EZH2 in Granulosa Cells Contributes to Endometriosis-Associated Infertility by Targeting IL-1R2. Endocrinology 2022;164. Lottini T, Iorio J, Lastraioli E, Carraresi L, Duranti C, Sala C, et al. Transgenic mice overexpressing the LH receptor in the female reproductive system spontaneously develop endometrial tumour masses. Sci Rep. 2021;11:8847. Kawai T, Richards JS, Shimada M. The Cell Type-Specific Expression of Lhcgr in Mouse Ovarian Cells: Evidence for a DNA-Demethylation-Dependent Mechanism. Endocrinology. 2018;159:2062–74. Buccione R, Vanderhyden BC, Caron PJ, Eppig JJ. FSH-induced expansion of the mouse cumulus oophorus in vitro is dependent upon a specific factor(s) secreted by the oocyte. Dev Biol. 1990;138:16–25. Su YQ, Wu X, O'Brien MJ, Pendola FL, Denegre JN, Matzuk MM, et al. Synergistic roles of BMP15 and GDF9 in the development and function of the oocyte-cumulus cell complex in mice: genetic evidence for an oocyte-granulosa cell regulatory loop. Dev Biol. 2004;276:64–73. Su YQ, Yin Y, Guo J, Gong X, Tian Y, Shi L. MTOR-mediated interaction between the oocyte and granulosa cells regulates the development and function of both compartments in micedagger. Biol Reprod. 2022;107:76–84. Bashtrykov P, Jeltsch A. DNA Methylation Analysis by Bisulfite Conversion Coupled to Double Multiplexed Amplicon-Based Next-Generation Sequencing (NGS). Methods in molecular biology 2018;1767:367 – 82. Su YQ, Sugiura K, Wigglesworth K, O'Brien MJ, Affourtit JP, Pangas SA, et al. Oocyte regulation of metabolic cooperativity between mouse cumulus cells and oocytes: BMP15 and GDF9 control cholesterol biosynthesis in cumulus cells. Development. 2008;135:111–21. Zhan H, Peng B, Ma J, Lin K, Xu K, Lin J, et al. Epidermal growth factor promotes stromal cells migration and invasion via up-regulation of hyaluronate synthase 2 and hyaluronan in endometriosis. Fertil Steril. 2020;114:888–98. da Luz CM, da Broi MG, Donabela FC, Paro de Paz CC, Meola J, Navarro PA. PTGS2 down-regulation in cumulus cells of infertile women with endometriosis. Reprod Biomed Online. 2017;35:379–86. Ning Y, Liu B, Han B, Guo J, Liu X, Fan G, et al. [Analysis of influence of inflammatory factor in patients with ovarian endometriosis follicular fluid on the outcome of in vitro fertilization]. Zhonghua yi xue za zhi. 2015;95:3829–32. Gonzalez MB, Lane M, Knight EJ, Robker RL. Inflammatory markers in human follicular fluid correlate with lipid levels and Body Mass Index. J Reprod Immunol. 2018;130:25–9. Tanaka Y, Kuwahara A, Ushigoe K, Yano Y, Taniguchi Y, Yamamoto Y, et al. Expression of cytokine-induced neutrophil chemoattractant suppresses tumor necrosis factor alpha expression and thereby prevents the follicles from undergoing atresia and apoptosis. Reproductive Med biology. 2017;16:157–65. Silva AWB, Ribeiro RP, Menezes VG, Barberino RS, Passos JRS, Dau AMP, et al. Expression of TNF-alpha system members in bovine ovarian follicles and the effects of TNF-alpha or dexamethasone on preantral follicle survival, development and ultrastructure in vitro. Anim Reprod Sci. 2017;182:56–68. Wohlres-Viana S, Arashiro EKN, Machado MA, Camargo LSA, Siqueira LGB, Palhao MP, et al. Intrafollicular oestradiol production, expression of the LH receptor (LHR) gene and its isoforms, and early follicular deviation in Bos indicus. Reprod Fertil Dev. 2017;29:1958–70. Todorov VT, Volkl S, Muller M, Bohla A, Klar J, Kunz-Schughart LA, et al. Tumor necrosis factor-alpha activates NFkappaB to inhibit renin transcription by targeting cAMP-responsive element. J Biol Chem. 2004;279:1458–67. Supplementary Files S1.png SFig.1. Alteration of certain cytokines in follicular fluid of infertile women with endometriosis. A-C. The concentrations of IL-1a, IL-1b, and IL-4 in follicular fluid of women with EMs were not significantly different compared with the control group, P > 0.05. D. E. G. The concentrations of IL-8, IL-10, and TNFα in follicular fluid were significantly higher compared with the control group, respectively, P < 0.05; F. H. I. The concentrations of IL-13, PGE2, and PGF2α were significantly lower compared with the control group, respectively, P < 0.05. S2.png SFig.2. Intra- or extra-ovarian microenvironment inflammatory alteration impairs cumulus expansion in vitro and disrupts ovulation in vivo in mice. A. (I). COCs cultured in normal culture medium without EGF. after 14 hours of incubation in normal culture medium, COCs remained in their original state with "0" level of expansion; (II). COCs cultured in IVM culture medium with EGF(10ng/mL). after incubation in IVM culture medium, COC oocytes from mice showed a fully expanded state with an obvious outward radiating crown; (III). COC cultured in follicular fluid from male factor infertile females. the COC exhibited a near fully expanded state with good cell growth; (IV). COC oocytes cultured in follicular fluid from EMs infertile females in an expanded state. Some of the COC's cumulus cells showed granular aggregation, inconspicuous extracellular matrix mucinization, severe cell abscission and poor condition (shown by white triangular arrows). The scale bar size in the figure is 100 μm. B. Illustration showing the process flow for superovulation induction under various stimuli (saline or follicular fluid) in C57/B6j mice. C. Superovulation analysis to assess the effect of adding human-derived peritoneal fluid on ovulation induction. Data are presented as the numbers of ovulated COCs and shown as the mean ± sem (n=3). Bars marked with different letters are significantly different (P<0.05). D. The average numbers of the corpus luteum and anovulatory follicles per mouse. The numbers of the corpus luteum were lower while the anovulatory follicles were more in the EMs group mice than the control group; data are presented as the mean ± sem (n=3). E. Micrographs of ovarian sections processed with periodic acid-Schiff (PAS) staining. The white arrows indicate unruptured follicles, and the black arrows refer to the corpus luteum. Scale bars: 200 μm. E. Representative images of COC expansion after in vitro culture with medium supplemented with various stimuli. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-2855626","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":198450365,"identity":"d5bea92a-3ff5-4444-94b9-41ef89da4719","order_by":0,"name":"Yaoxue Yin","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAxklEQVRIiWNgGAWjYJCCAwwVDMxgFg/xWs6QqoWBsQ3KIEqLwY0cw8OF8+6w685IYHzwto1B3pygljNnDA7P3PaM2exGArPh3DYGw50NhLQc7zE4zLvtMEgLmzRvG0OCwQFCWg7zALXMAWth/02cFrAtDRBbmInSInnmWMFhnmNALWceNkvOOSdhuIGQFr4byZs/89QcTjY7nnzww5syG3mCtigc4DAA0cnA2GkA0hIE1AOBfAP7AxBtR1jpKBgFo2AUjFgAAKyYQ1RMT0CZAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0002-2730-3381","institution":"Nanjing Medical University","correspondingAuthor":true,"prefix":"","firstName":"Yaoxue","middleName":"","lastName":"Yin","suffix":""},{"id":198450366,"identity":"da3f8044-a1df-4e48-9b9f-9713f08416d8","order_by":1,"name":"Wangjuan Dai","email":"","orcid":"","institution":"Reproductive Medicine Institute","correspondingAuthor":false,"prefix":"","firstName":"Wangjuan","middleName":"","lastName":"Dai","suffix":""},{"id":198450367,"identity":"054ae6e1-99b2-4079-b0e2-2f80f609fd79","order_by":2,"name":"Caihe Wen","email":"","orcid":"","institution":"Reproductive Medicine Institute","correspondingAuthor":false,"prefix":"","firstName":"Caihe","middleName":"","lastName":"Wen","suffix":""},{"id":198450368,"identity":"402c89b5-e827-412a-909e-f24283bc95f7","order_by":3,"name":"Yundong Mao","email":"","orcid":"","institution":"Reproductive Medicine Institute","correspondingAuthor":false,"prefix":"","firstName":"Yundong","middleName":"","lastName":"Mao","suffix":""},{"id":198450369,"identity":"f3423219-60c4-445c-9232-9293b8622736","order_by":4,"name":"Xiang Ma","email":"","orcid":"","institution":"Reproductive Medicine Institute","correspondingAuthor":false,"prefix":"","firstName":"Xiang","middleName":"","lastName":"Ma","suffix":""},{"id":198450370,"identity":"930e15a0-2d39-46db-9cfd-61bff135e568","order_by":5,"name":"Feiyang Diao","email":"","orcid":"","institution":"Reproductive Medicine Institute","correspondingAuthor":false,"prefix":"","firstName":"Feiyang","middleName":"","lastName":"Diao","suffix":""},{"id":198450371,"identity":"1a27182a-a17b-4d87-bb42-ee641f0ed042","order_by":6,"name":"Jing Wang","email":"","orcid":"","institution":"Reproductive Medicine Institute","correspondingAuthor":false,"prefix":"","firstName":"Jing","middleName":"","lastName":"Wang","suffix":""},{"id":198450372,"identity":"90084e40-43c3-46e1-8a76-b4cb968dd987","order_by":7,"name":"Lianju Qin","email":"","orcid":"","institution":"Reproductive Medicine Institute","correspondingAuthor":false,"prefix":"","firstName":"Lianju","middleName":"","lastName":"Qin","suffix":""},{"id":198450373,"identity":"aa9a174a-04ed-4159-b6dd-8ed39630fa7d","order_by":8,"name":"Mengyu Zhang","email":"","orcid":"","institution":"Reproductive Medicine Institute","correspondingAuthor":false,"prefix":"","firstName":"Mengyu","middleName":"","lastName":"Zhang","suffix":""},{"id":198450374,"identity":"e2f929c9-c77a-4e83-8362-d570147eb882","order_by":9,"name":"Zhen Hou","email":"","orcid":"","institution":"Reproductive Medicine Institute","correspondingAuthor":false,"prefix":"","firstName":"Zhen","middleName":"","lastName":"Hou","suffix":""},{"id":198450375,"identity":"45348a14-f5fd-4d92-b336-885e01571466","order_by":10,"name":"Yugui Cui","email":"","orcid":"","institution":"Reproductive Medicine Institute","correspondingAuthor":false,"prefix":"","firstName":"Yugui","middleName":"","lastName":"Cui","suffix":""},{"id":198450376,"identity":"b18e7b48-a211-41f0-9d6e-05446993d44d","order_by":11,"name":"Jiayin Liu","email":"","orcid":"","institution":"Reproductive Medicine Institute","correspondingAuthor":false,"prefix":"","firstName":"Jiayin","middleName":"","lastName":"Liu","suffix":""}],"badges":[],"createdAt":"2023-04-24 15:58:13","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-2855626/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-2855626/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":36928485,"identity":"285d59bb-3da7-48f2-be8d-3085f675e8af","added_by":"auto","created_at":"2023-05-12 03:21:13","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":161105,"visible":true,"origin":"","legend":"\u003cp\u003eDown-regulation of ovulation-related key gene expression in CCs of EMs infertile women. \u003cstrong\u003eA.\u003c/strong\u003e Schematic diagram of the LH-triggered ovulation cascade signal in follicle. \u003cstrong\u003eB-C.\u003c/strong\u003e The expression of genes associated with follicular rupture was downregulated in mural granulosa cells of patients with EMs compared with controls. After the LH surge, proteases and transcription factors encoded in follicular mural granulosa cells played an important role in follicular rupture. Among them, \u003cem\u003eADAMTS\u003c/em\u003e-1 expression was down-regulated in patients with EMs, P \u0026lt; 0.05, while the expression of \u003cem\u003ePGR\u003c/em\u003e encoding transcription factors showed a decreasing trend, P \u0026gt; 0.05. \u003cstrong\u003eD-G.\u003c/strong\u003e Down-regulation of cumulus expansion-related gene expression in cumulus cells. Cumulus expansion is the mucinization of the extracellular matrix, and the cumulus cells produce a cytoskeleton composed mainly of hyaluronic acid (\u003cem\u003eHAS2\u003c/em\u003e), supplemented by other ligand proteins (\u003cem\u003ePTGS2\u003c/em\u003e, \u003cem\u003ePTX3\u003c/em\u003e and \u003cem\u003eTNFAIP6\u003c/em\u003e) as a \"scaffold\". The expression of the genes encoding these proteins in the cumulus cells of EMs women was decreased to different degrees, and the expression of \u003cem\u003eHAS2\u003c/em\u003e and \u003cem\u003ePTGS2\u003c/em\u003e was significantly downregulated compared with the control group, P \u0026lt; 0.05, while the expression of \u003cem\u003eTNFAIP6\u003c/em\u003eand \u003cem\u003ePTX3\u003c/em\u003e was decreased compared with the control group, P \u0026gt; 0.05.\u003cstrong\u003e H-J.\u003c/strong\u003eExpression of EGF-like growth factors \u003cem\u003eAREG\u003c/em\u003e, \u003cem\u003eEREG\u003c/em\u003e and \u003cem\u003eBTC\u003c/em\u003e, responsible for LH signaling, was downregulated in wall granule cells, P \u0026lt; 0.05. \u003cstrong\u003eJ. \u003c/strong\u003e\u003cem\u003eLHCGR\u003c/em\u003e expression was downregulated in cumulus cells of women with EMs, P \u0026lt; 0.05. * P \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"Slide1.png","url":"https://assets-eu.researchsquare.com/files/rs-2855626/v1/d97fc05e14f9b5733730327b.png"},{"id":36928375,"identity":"4f037e2f-8c28-4954-bd7d-ba091cbaf768","added_by":"auto","created_at":"2023-05-12 03:20:56","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":331294,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIL-8/TNF-α inhibits FSH-induced \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eLhcgr\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e expression in OOXs with fewer cumulus cells apoptosis. A. \u003c/strong\u003eRepresentative pictures of TUNEL staining of OOX in cell culture under different conditions. After 24 h of in vitro culture, a certain percentage of OOX underwent apoptosis under FSH induction, whereas OOX did not show a large number of apoptotic cells under exogenous addition of inflammatory factor IL-8/TNFα or in combination.\u003cstrong\u003eB. \u003c/strong\u003eWestern blot analysis of apoptotic factor Bax expression in different culture environments. Oocytes after oocyte removal exhibited enhanced expression of apoptotic factor Bax in response to FSH, and apoptotic factor expression was significantly lower in oocytes in the group with the addition of inflammatory factors, P \u0026lt; 0.05. a,b Different letters indicate P \u0026lt; 0.05, while the same is P \u0026gt; 0.05. Scale bar size in the figure is 50 μm. \u003cstrong\u003eC. \u003c/strong\u003eq-PCR analysis of \u003cem\u003eLhcgr\u003c/em\u003e mRNA expression in different treatment groups. \u003cem\u003eLhcgr\u003c/em\u003e expression was at a very low level in COC, and after removal of oocytes, \u003cem\u003eLhcgr\u003c/em\u003e mRNA expression was significantly higher in oocytes of OOX group, and significantly lower in oocytes cultured with IL-8/TNFα alone or in combination compared with oocytes of OOX group, P \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"Slide2.png","url":"https://assets-eu.researchsquare.com/files/rs-2855626/v1/daae9ddd3a6b651fc3bb1818.png"},{"id":36927494,"identity":"dac4d2ef-7201-4e6c-9fc3-e31debc1d379","added_by":"auto","created_at":"2023-05-12 03:18:15","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":149516,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIL-8/TNF-α reduces methylation of the Sp1 binding site in the \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eLhcgr\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e promoter through activation of the P-SMAD2/3-RA pathway. A.\u003c/strong\u003e Western blot analysis of SMAD2/3 phosphorylation was significantly activated in OOXs when treated with TNF-α alone and IL-8 plus TNF-α. \u003cstrong\u003eB, D, E.\u003c/strong\u003e The expression of \u003cem\u003eAdh1\u003c/em\u003e, \u003cem\u003eAldh1\u003c/em\u003e and \u003cem\u003eAldh5\u003c/em\u003e in OOXs was significantly decreased to varying degrees after the addition of IL-8/TNF-α compared to the control. \u003cstrong\u003eC, F. \u003c/strong\u003eNo significant difference was found for either \u003cem\u003eAdh5\u003c/em\u003e or \u003cem\u003eCyp26b1\u003c/em\u003e in the OOXs with or without the above cytokines. G. Methylation of the SP1 binding site on \u003cem\u003eLhcgr\u003c/em\u003e promoter region was hyperactive in OOXs co-treated with IL-8 and TNF-α compared to OOXs cultured in basal medium.\u003c/p\u003e","description":"","filename":"Slide3.png","url":"https://assets-eu.researchsquare.com/files/rs-2855626/v1/19afd03a2057f44d589df1d6.png"},{"id":36927505,"identity":"ec095d3f-6463-4725-9160-cca087741647","added_by":"auto","created_at":"2023-05-12 03:18:20","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":197067,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIL-8/TNF-indirectly lowers \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eLhcgr\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e expression by inhibiting β-Catenin and AKT phosphorylation in OOXs and schematic representation of IL-8/TNF-α interference with LHCGR expression. A. \u003c/strong\u003eWestern blot analysis of alone or in combination with IL-8 and TNFα had a significant inhibitory effect on the phosphorylation of β-Catenin and AKT proteins in OOXs. P \u0026lt; 0.05. a, b Different letters indicate P \u0026lt; 0.05 and the same letter indicates P \u0026gt; 0.05. \u003cstrong\u003eB. \u003c/strong\u003eIn patients with EMs, ectopic endothelial cells interact with immune cells to secrete large amounts of inflammatory factors into the follicular fluid, leading to an increase in inflammatory factors, mainly IL-8 and TNFα, in the follicular fluid; the FSH-dependent AC-cAMP-PKA/SMAD2/3 signaling pathway promotes LHR expression in cumulus cells, during which P-MAD2/3 is activated upon continuous exposure to pathological levels of IL-8/TNFα, the latter maintaining the Sp1 binding site of the \u003cem\u003eLhcgr\u003c/em\u003e promoter in a highly methylated state by inhibiting RA synthase and promoting RA catabolic enzymes to down-regulate RA levels; and by inhibiting AKT and β-catenin phosphorylation, respectively, causing the transcriptional repressor FOXO1 to exit the nucleus and inhibiting the transcription factor TF3 to replace the transcriptional conjugate GRE, resulting in decreased \u003cem\u003eLhcgr\u003c/em\u003etranscriptional activity and reduced \u003cem\u003eLhcgr\u003c/em\u003emRNA expression.\u003c/p\u003e","description":"","filename":"Slide4.png","url":"https://assets-eu.researchsquare.com/files/rs-2855626/v1/8acb1f0e49692d16cac9ac0b.png"},{"id":37773735,"identity":"8217f9c1-d81f-4284-894d-786f9b2eece4","added_by":"auto","created_at":"2023-05-31 14:41:45","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1465569,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-2855626/v1/e69145d0-df19-4a50-bd45-40f855666425.pdf"},{"id":36926717,"identity":"622ed8cf-7636-4a22-8170-eb7c2996c418","added_by":"auto","created_at":"2023-05-12 03:14:45","extension":"png","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":85833,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSFig.1. Alteration of certain cytokines in follicular fluid of infertile women with endometriosis. A-C. \u003c/strong\u003eThe concentrations of IL-1a, IL-1b, and IL-4 in follicular fluid of women with EMs were not significantly different compared with the control group, P \u0026gt; 0.05. \u003cstrong\u003eD. E. G. \u003c/strong\u003eThe concentrations of IL-8, IL-10, and TNFα in follicular fluid were significantly higher compared with the control group, respectively, P \u0026lt; 0.05; \u003cstrong\u003eF. H. I. \u003c/strong\u003eThe concentrations of IL-13, PGE2, and PGF2α were significantly lower compared with the control group, respectively, P \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"S1.png","url":"https://assets-eu.researchsquare.com/files/rs-2855626/v1/774d0e61ca8f3f143da64a37.png"},{"id":36928388,"identity":"12eeb82e-ba8c-4924-a41b-197fd1c1e9f2","added_by":"auto","created_at":"2023-05-12 03:21:04","extension":"png","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":1166040,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSFig.2. Intra- or extra-ovarian microenvironment inflammatory alteration impairs cumulus expansion in vitro and disrupts ovulation in vivo in mice. A. (I). \u003c/strong\u003eCOCs cultured in normal culture medium without EGF. after 14 hours of incubation in normal culture medium, COCs remained in their original state with \"0\" level of expansion;\u003cstrong\u003e (II). \u003c/strong\u003eCOCs cultured in IVM culture medium with EGF(10ng/mL). after incubation in IVM culture medium, COC oocytes from mice showed a fully expanded state with an obvious outward radiating crown\u003cstrong\u003e; (III). \u003c/strong\u003eCOC cultured in follicular fluid from male factor infertile females. the COC exhibited a near fully expanded state with good cell growth; \u003cstrong\u003e(IV). \u003c/strong\u003eCOC oocytes cultured in follicular fluid from EMs infertile females in an expanded state. Some of the COC's cumulus cells showed granular aggregation, inconspicuous extracellular matrix mucinization, severe cell abscission and poor condition (shown by white triangular arrows). The scale bar size in the figure is 100 μm. \u003cstrong\u003eB.\u003c/strong\u003e Illustration showing the process flow for superovulation induction under various stimuli (saline or follicular fluid) in C57/B6j mice. \u003cstrong\u003eC\u003c/strong\u003e. Superovulation analysis to assess the effect of adding human-derived peritoneal fluid on ovulation induction. Data are presented as the numbers of ovulated COCs and shown as the mean ± sem (n=3). Bars marked with different letters are significantly different (P\u0026lt;0.05). \u003cstrong\u003eD\u003c/strong\u003e. The average numbers of the corpus luteum and anovulatory follicles per mouse. The numbers of the corpus luteum were lower while the anovulatory follicles were more in the EMs group mice than the control group; data are presented as the mean ± sem (n=3). \u003cstrong\u003eE\u003c/strong\u003e. Micrographs of ovarian sections processed with periodic acid-Schiff (PAS) staining. The white arrows indicate unruptured follicles, and the black arrows refer to the corpus luteum. Scale bars: 200 μm. E. Representative images of COC expansion after in vitro culture with medium supplemented with various stimuli.\u003c/p\u003e","description":"","filename":"S2.png","url":"https://assets-eu.researchsquare.com/files/rs-2855626/v1/b041c6bf4680580377c3b613.png"}],"financialInterests":"","formattedTitle":"Elevated IL-8/TNF-α in follicle fluid of infertile women with endometriosis decrease LHCGR expression in cumulus cells","fulltext":[{"header":"Introduction","content":"\u003cp\u003eTo date, there is evidence for many causes of infertility in women with EMs, including ovulation disorders (follicular dysplasia and LUFs), low postoperative ovarian function, abnormal tubal function, and low endometrial tolerance (\u003cspan additionalcitationids=\"CR2 CR3 CR4\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e). In natural menstrual cycles, 13\u0026ndash;73% of women with EMs have a history of LUF resulting in anovulatory infertility, reducing the natural pregnancy rate to less than 11% (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e). In addition, our group recently found that infertile women with EMs have a low oocyte retrieval rate during IVF cycles, which may be related to insufficient cumulus expansion: a critical biological event for ovulation (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). However, the underlying pathophysiological mechanisms between EMs and ovulatory dysfunction are poorly understood.\u003c/p\u003e \u003cp\u003eUnder physiological conditions, binding of LH to its receptor triggers an ovulatory signaling cascade within the mature follicle, where EGF-like growth factors are produced by the granulosa cells and delivered to the cumulus cells, in turn inducing the biological events of cumulus expansion and follicular rupture, leading to ovulation (\u003cspan additionalcitationids=\"CR10\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e). This process resembles an inflammatory response: the follicles become engorged with blood, produce prostaglandins, and synthesize hyaluronic acid-rich ECM containing a variety of cytokines and inflammatory factors (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e). Meanwhile, endometriosis has long been considered a chronic sterile inflammatory disease with elevated levels of various inflammatory factors in the pelvis (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). Previous studies have reported that altered inflammatory factors in the pelvis (the microenvironment in which the ovaries are located) in women with EMs interfere with ovulation (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan additionalcitationids=\"CR16 CR17 CR18\" citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e). Ronnberg's group and Koskimies et al. have previously reported lower LH receptor concentrations in the granulosa cells of either the developing follicle or the corpus luteum in infertile women with EMs than in controls (including male or tubal factor infertility), but have not elucidated the underlying mechanism (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e). In fact, many local factors, including hormones and cytokines, may be involved in the regulation of LHR expression (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e). Previous studies have reported that the endometrial foci induce an inflammatory response that is thought to be mediated by macrophages, lymphocytes, and mononuclear phagocytes (\u003cspan additionalcitationids=\"CR23\" citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e). Cytokines such as interleukin (IL)-1, 6, 8, 10, vascular endothelial growth factor (VEGF), and tumor necrosis factor (TNF)-alpha are found at high levels in the peritoneal fluid (PF) of women with endometriosis (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e). Nakao K et al illustrated that TNF-α inhibits FSH-induced LH receptor expression through transcriptional regulation in rat granulosa cells (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e). Therefore, exploring the relationship between the inflammatory factor and LH receptor expression may help explain the ovulation disorder in women with EMs.\u003c/p\u003e \u003cp\u003eThe study of LH receptor expression in granulosa cells of women with endometriosis has not progressed much over the years due to the lack of ideal study models. In granulosa cells of the developing follicle, FSH activates several signaling pathways including phosphatidylinositol 3-kinase/AKT and inhibits phosphatidylinositol SMAD2/3 to express the LH receptor (\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e). Currently, granulosa cells obtained from immature follicles of female mice or rats are used to study the molecular mechanism of LH receptor expression (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e). However, due to the estrous cycle, it is difficult to ensure that the granulosa cells used in experiments are at an immature stage when LH receptors are almost not expressed (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e). Oocyte-ectomized (OOX) cumulus cells are a better model to study LH receptor de novo synthesis, which is performed by microsurgically removing the oocyte from the COCs, leaving the spherical zona pellucida and its surrounding cumulus cell population, as previously described (\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e). After removal of the oocyte from the COCs, SMAD2/3 dephosphorylation and LH receptor de novo synthesis subsequently occur in the OOXs as the paracrine effect of the oocyte on the cumulus cells is blocked. (\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe aim of the present study was to investigate whether certain inflammatory factors in the follicular fluid of women with EMs are responsible for impaired follicular development or (and) ovulation, and then to explore the underlying mechanisms. The concentration of inflammatory factors in the follicular fluid of infertile women with EMs was determined. Then, we investigated IL-8/TNF-a on FSH-induced \u003cem\u003eLhcgr\u003c/em\u003e mRNA expression levels and mechanisms of regulation in OOXs. We found that elevated IL-8/TNF-α in follicular fluid of women with EMs indirectly maintains \u003cem\u003eLhcgr\u003c/em\u003e promoter hypermethylation through activation of p-Smad2/3, while inhibiting AKT and β-catenin phosphorylation, which together reduce \u003cem\u003eLhcgr\u003c/em\u003e mRNA expression.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n\u003ch2\u003eInclusion criteria and exclusion criteria for clinical sample collection\u003c/h2\u003e\n\u003cp\u003eA total of 80 infertile women (infertility with endometriosis or male factor) undergoing IVF at the Center of Reproductive Medicine, First Affiliated Hospital of Nanjing Medical University (NMU) were recruited for this study. This study was approved by the research ethics committee of the hospital. All infertile women who met the eligibility criteria and agreed to participate in the study provided written informed consent.\u003c/p\u003e\n\u003c/div\u003e\n\u003ch3\u003eInclusion criteria\u003c/h3\u003e\n\u003cp\u003eAll infertile patients were less than 40 years of age. According to the American Society for Reproductive Medicine (ASRM) criteria, we selected the EMs infertile women who were diagnosed by laparoscopic surgery and had a history of LUF as the EMs group. Women with male-factor only infertility who received ovulation induction for ICSI treatment were considered as the control group. Here, we determined the absence of endometriosis in control women by clinical presentation: women without dysmenorrhea, without dyspareunia and without sacral ligament tenderness, and with serum CA125\u0026thinsp;\u0026lt;\u0026thinsp;15 U/ml.\u003c/p\u003e\n\u003ch3\u003eExclusion criteria\u003c/h3\u003e\n\u003cp\u003eWomen over 40 years of age, body mass index\u0026thinsp;\u0026gt;\u0026thinsp;30 kg/m2, alcohol consumption, smoking, chronic anovulation with polycystic ovary syndrome (PCOS) or other causes, autoimmune diseases, diabetes mellitus, hydronephrosis and hypovarian reserve function (DOR), and thyroid disease were excluded.\u003c/p\u003e\n\u003ch3\u003eOvarian stimulation, oocyte retrieval and clinical sample collection\u003c/h3\u003e\n\u003cp\u003eWe selected 40 infertile women with EM and 40 women with male-factor infertility for specimen collection based on the above criteria. Ovarian stimulation, oocyte retrieval and clinical specimen collection were performed as previously described (\u003cspan class=\"CitationRef\"\u003e8\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003eFollicular fluid and cumulus cells (CCs): Follicular fluid containing cumulus cells in 40 patients with EMs and 40 women with male-factor infertility undergoing IVF was aspirated by egg retrieval under ultrasound guidance. Then, the supernatant was collected and processed separately after centrifugation. Cumulus cells were isolated by Percoll density gradient centrifugation and rapidly transferred to Eppendorf (EP) tubes. In addition, we removed some CCs from the outermost layer of the expanded COCs with a 1 ml sterile syringe needle, while ensuring that the quality of the COCs was not compromised.\u003c/p\u003e\n\u003cp\u003ePeritoneal fluid: In addition, peritoneal fluid was collected from women with stage III-IV EM and from women undergoing laparoscopic surgery for other conditions during laparoscopic procedures. All samples were independently frozen at -80\u0026deg;C for follow-up testing.\u003c/p\u003e\n\u003ch3\u003eChemicals and Reagents\u003c/h3\u003e\n\u003cp\u003eAll chemicals and reagents were purchased from Sigma, USA, unless otherwise stated.\u003c/p\u003e\n\u003ch3\u003eELISA test\u003c/h3\u003e\n\u003cp\u003eThe concentration of inflammatory factors in the follicular fluid of 40 patients with EMs and 40 patients with male factors was determined by ELISA (MultiSciences Biotech, 70-EK101A-96, China). To avoid operator error, three independent replicate wells were made for each sample. We calculated the mean concentration of inflammatory factors in follicular fluid for each woman based on the standard curve, and then performed statistical analysis between the two groups.\u003c/p\u003e\n\u003ch3\u003eMice\u003c/h3\u003e\n\u003cp\u003eFemale C57/B6j mice, 22 to 24 days old, were generated and maintained for experimental use at the Animal Center of Nanjing Medical University (NMU). All experimental procedures and protocols were approved by the Animal Care and Use Committee of NMU and were performed in accordance with institutional guidelines for the care and use of laboratory animals. Mice were housed in ventilated cages with a 12-hour light/12-hour dark cycle, constant temperature (22\u0026deg;C), and controlled humidity.\u003c/p\u003e\n\u003ch3\u003eSuperovulation test in mice\u003c/h3\u003e\n\u003cp\u003eTwelve 22- to 24-day-old C57/B6j mice of similar body weight were randomly divided into 2 groups: the control group and the EMs group. Three independent replicate experiments were performed in this study, with six mice in each group during the experiments. Female mice were stimulated to develop follicles by intraperitoneal injection of 0.1 mL (5 IU) of equine chorionic gonadotropin (eCG), while mice in the control group were injected intraperitoneally with 0.1 mL of saline and mice in the experimental group were injected intraperitoneally with 0.1 mL of peritoneal fluid from patients with EMs. After 46\u0026ndash;48 hours, 0.1 mL (5 IU) of human chorionic gonadotropin (HCG) was injected into the peritoneal cavity of the mice to induce ovulation. Twenty-four hours after HCG injection, COCs clusters were collected from the oviducts of euthanized mice. Oocytes were obtained by digesting excess CCs around the COCs with hyaluronidase, followed by statistical analysis.\u003c/p\u003e\n\u003ch3\u003eFollicle count and morphological analysis\u003c/h3\u003e\n\u003cp\u003eIn each group, post-ovulatory ovaries were collected and fixed in 4% formaldehyde, followed by paraffin embedding and serial sectioning at a thickness of 5 \u0026micro;m per section. Subsequently, periodic acid-Schiff (PAS) staining was used for morphological and statistical analysis in this experiment. To avoid duplicate or missed counts, every 25 sections were counted once to assess luteal and anovulatory follicles as accurately as possible.\u003c/p\u003e\n\u003ch3\u003eCumulus expansion in COCs in Vitro\u003c/h3\u003e\n\u003cp\u003eWe isolated COCs by puncturing large luminal follicles with a pair of 26-gauge needles 44\u0026ndash;48 hours after eCG injection, and collected COCs in culture media with a fine-bore glass pipette. COCs were cultured in commercial in vitro maturation (IVM) medium (with and without FSH) (MEM-\u0026alpha;, Gibco, USA), follicular fluid from patients with EM, and follicular fluid from infertile women in the control group. The COCs were incubated in a modular incubation chamber at 37\u0026deg;C with 90% N2, 5% CO2, and 5% O2 for 14 hours. After 14 hours of in vitro incubation, the extent of COC expansion was observed and scored by microscopy.\u003c/p\u003e\n\u003ch3\u003eCumulus cells in OOXs in Vitro culture\u003c/h3\u003e\n\u003cp\u003eOocytectomized (OOX) cumulus cells are prepared by microsurgically removing the oocyte from the COCs, leaving the spherical zona pellucida and its surrounding cumulus cell population. OOX cumulus cells were cultured in basal medium supplemented with 5% fetal bovine serum and 100 U/l FSH and covered with MEM\u0026alpha;-washed mineral oil on 50 \u0026micro;L drops of culture solution. Intact OOX were co-cultured with full-grown oocytes (FGO) at a density of 2 oocytes/\u0026micro;L, TNF-\u0026alpha; (500 pg/mL), and IL-8 (500 pg/mL) in the modular incubation chamber. After 24 hours, we collected only OOX cumulus cells, which were independently snap-frozen and stored in liquid nitrogen at -80\u0026deg;C for subsequent testing.\u003c/p\u003e\n\u003ch3\u003eTotal RNA extraction and reverse transcription in vitro\u003c/h3\u003e\n\u003cp\u003eTotal RNA was extracted from human and mouse CCs using the RNeasy Micro Kit (Qiagen, 74034, Germany) according to the manufacturer's protocol. The quality of extracted total RNA was checked by electrophoresis on a 1% agarose gel. In vitro transcription was performed using the QuantiTect Reverse Transcription Kit (Qiagen) at 42\u0026deg;C for 15 min, as previously described (\u003cspan class=\"CitationRef\"\u003e34\u003c/span\u003e). All steps were performed under RNase-free conditions.\u003c/p\u003e\n\u003ch3\u003eReal-Time PCR analysis\u003c/h3\u003e\n\u003cp\u003eReal-time PCR for the detection of gene expression in cumulus cells was performed using a commercial kit (Takara, Japan). The PCR system (20 \u0026micro;l) contained 10 \u0026micro;l of SYBR Green PCR master mix, 1 \u0026micro;l of forward and reverse primers, 0.4 \u0026micro;l of Rox reference dye, and 6.6 \u0026micro;l of ddH2O and 1 \u0026micro;l of cDNA. Relative fold changes in mRNA levels were calculated using the 2-\u0026Delta;\u0026Delta;Ct method and expressed as relative changes compared to a specific group (control). \u003cem\u003eGAPDH\u003c/em\u003e (human) and \u003cem\u003eRpl19\u003c/em\u003e (mouse) were used as internal controls. The sequences of the primary primer pairs used in this study are listed in Table. 1 in the Supplementary Appendix.\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003ctable id=\"Tab1\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003ePrimary primer pairs used in RT-PCR\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eGene ID\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eForward primers(5\u0026rsquo; \u0026minus;\u0026thinsp;3\u0026rsquo;)\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eReverse primers(5\u0026rsquo; \u0026minus;\u0026thinsp;3\u0026rsquo;)\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eGAPDH\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eLHCGR\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eAREG\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eEREG\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eBTC\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eHAS2\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003ePTGS2\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003ePTX3\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eTNFAIP6\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eADAMTS-1\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003ePGR\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eRpl19\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eLhcgr\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eHas2\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003ePtgs2\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003ePtx3\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eTnfaip6\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eAdh1\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eAdh5\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eAldh1a1\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eAldh1a7\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eCyp26b1\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eACCACAGTCCATGCCATCAC\u003c/p\u003e\n\u003cp\u003eGACGACACTGACTTCACTGGA\u003c/p\u003e\n\u003cp\u003eTCAAAATTTCTGCATTCACGGAG\u003c/p\u003e\n\u003cp\u003eCACAGTCGTCGGTTCCACA\u003c/p\u003e\n\u003cp\u003eCACTGCTCCTGGCCCTTG\u003c/p\u003e\n\u003cp\u003eTCATGCAAAAATGGGGTGGAAA\u003c/p\u003e\n\u003cp\u003eACTAGAGCCCTTCCTCCTGT\u003c/p\u003e\n\u003cp\u003eTGGCCGCGGTGCTAGA\u003c/p\u003e\n\u003cp\u003eGGCCCAACTGTGGATTTGGA\u003c/p\u003e\n\u003cp\u003eTGTGTGTGATCCGAGCAGAA\u003c/p\u003e\n\u003cp\u003eTGGCAGATCCCACAGGAGTT\u003c/p\u003e\n\u003cp\u003eTCAGGCTACAGAAGAGGCTTGC\u003c/p\u003e\n\u003cp\u003eTACATAACCACCATACCAG\u003c/p\u003e\n\u003cp\u003eCGAGTCTATGAGCAGGAGCTG\u003c/p\u003e\n\u003cp\u003eCCCTTCCTCCCGTAGCAGAT\u003c/p\u003e\n\u003cp\u003eTTGCTGAGACCTCGGATGAC\u003c/p\u003e\n\u003cp\u003eATACAAGCTCACCTACGCCGAA\u003c/p\u003e\n\u003cp\u003eTTGGCTGTAAAGCAGCAGGA\u003c/p\u003e\n\u003cp\u003eTGAACACTGCCAAGGTGGAG\u003c/p\u003e\n\u003cp\u003eCCCGGATTTTTGTTGAGGAG\u003c/p\u003e\n\u003cp\u003eCTGTCCCTGTCCAATGCCCA\u003c/p\u003e\n\u003cp\u003eGATCCTACTGGGCGAACACC\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eTCTAGACGGCAGGTCAGGTC\u003c/p\u003e\n\u003cp\u003eGACTCTAGGCCATAGCTCGG\u003c/p\u003e\n\u003cp\u003eATGGACTTTTCCCCACACCG\u003c/p\u003e\n\u003cp\u003eACTCTGGATCCCCTGAGGTA\u003c/p\u003e\n\u003cp\u003eTCCTCAGGGTCTCCACAGAG\u003c/p\u003e\n\u003cp\u003eACACCTCCAACCATGGGATCT\u003c/p\u003e\n\u003cp\u003eCCTGGGGATCAGGGATGAACT\u003c/p\u003e\n\u003cp\u003eCTTCTTGGAACGCATTGGGAA\u003c/p\u003e\n\u003cp\u003eTAAAGACGCCACCACACTCC\u003c/p\u003e\n\u003cp\u003eCACCATTAAGGCTGGCACAC\u003c/p\u003e\n\u003cp\u003eGGGTTTGACTTCGTAGCCCTT\u003c/p\u003e\n\u003cp\u003eATCAGCCCATCCTTGATCAGC\u003c/p\u003e\n\u003cp\u003eAGTTCCTAAAGGCACAGC\u003c/p\u003e\n\u003cp\u003eGTGATTCCGAGGAGGAGAGACA\u003c/p\u003e\n\u003cp\u003eTGAACTCTCTCCGTAGAAGAACCTTT\u003c/p\u003e\n\u003cp\u003eGCGAGTTCTCCAGCATGATGA\u003c/p\u003e\n\u003cp\u003eATCCATCCAGCAGCACAGACAT\u003c/p\u003e\n\u003cp\u003eCATGGGGTTCATGGAGAGGT\u003c/p\u003e\n\u003cp\u003eACGAGGACTTCCTGGATGGA\u003c/p\u003e\n\u003cp\u003eGAGAACACTGTGGGCTGCAC\u003c/p\u003e\n\u003cp\u003eGGTGACTGTATGAGATGTACAGC\u003c/p\u003e\n\u003cp\u003eTGCTCCAGGCTCGAAGTGTA\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003c/div\u003e\n\u003ch3\u003eWestern Blot\u003c/h3\u003e\n\u003cp\u003eOOXs were harvested, lysed with 2x Laemmli sample buffer, and heated at 105\u0026deg;C for 5 minutes, followed by electrophoresis. Collected protein was loaded onto 8% or 10% polyacrylamide gels, resolved by SDS-PAGE, and transferred to polyvinylidene difluoride (PVDF) membranes for protein detection as described in a previous study (\u003cspan class=\"CitationRef\"\u003e35\u003c/span\u003e). In this study, antibodies were purchased from Cell Signaling Technology: rabbit anti-phospho-AKT (1:1000), rabbit anti-AKT (1:1000), rabbit anti-phospho-SMAD2/3 (1:1000), rabbit anti-SMAD2/3 (1:1000); from Abcam: mouse anti-phospho-\u0026beta;-catenin S552 (1:1000); and from Proteintech: rabbit anti-Bax (1:5000), rabbit anti-bcl2 (1:10000). The expression of \u0026beta;-actin (ACTB) detected by anti-\u0026beta;-actin antibody (1:2,000, A1978) was used as an internal control for each sample. Finally, the WB data were quantitatively analysed using Image J software.\u003c/p\u003e\n\u003ch3\u003eGenomic DNA extraction\u003c/h3\u003e\n\u003cp\u003eThe Ezup Column Animal Genomic DNA Purification Kit (Sangon Biotech) was used to obtain genomic DNA from mouse OOXs cells according to the manufacturer's instructions. For NGS sequencing, genomic DNA was prepared.\u003c/p\u003e\n\u003ch3\u003eNext-Generation Sequencing-based Methylation analysis\u003c/h3\u003e\n\u003cp\u003eCombining Bisulfite Sequencing PCR (BSP) technology and high-throughput sequencing technology, the methylation of each CpG site in the target sequence can be detected more rapidly and accurately. The MethPrimer database predicted CpG islands in the putative Lhcgr promoter region.\u0026nbsp; CCCAGGTCAAGGAGAACAGGGACAGG\u003cstrong\u003eCG\u003c/strong\u003eGTGAGAGGGGAGGGCTGGAG\u003cstrong\u003eCG\u003c/strong\u003eGG\u003cstrong\u003eCG\u003c/strong\u003eGGGGC\u003cstrong\u003eCG\u003c/strong\u003eG\u003cstrong\u003eCG\u003c/strong\u003eGGTGGGAAGGCAGGC\u003cstrong\u003eCG\u003c/strong\u003eAGGGG\u003cstrong\u003eCG\u003c/strong\u003eGGCAGAGGGTA\u003cstrong\u003eCG\u003c/strong\u003eGG\u003cstrong\u003eCG\u003c/strong\u003eGGCCCCC\u003cstrong\u003eCG\u003c/strong\u003eGG\u003cstrong\u003eCG\u003c/strong\u003eGTCCAGCA TACTGGCCTAGCCAC\u003cstrong\u003eCG\u003c/strong\u003eGAGCTCACACT CAGGCTGG\u003cstrong\u003eCG\u003c/strong\u003eGGCCATGGGG\u003cstrong\u003eCG\u003c/strong\u003eG\u003cstrong\u003eCG\u003c/strong\u003eGGTCC\u003cstrong\u003eCG\u003c/strong\u003eGCTCTGAGACAGCTGCTGGTGCTGGCAAT. The banded box shows the designed primer positions and the middle part is the sequence to be tested. 16 CpG sites are contained in the M690 gene fragment. The positions in the sequence are as follows: 2, 24, 28, 35, 38, 55, 62, 75, 79, 88, 92, 117, 138, 150, 153, and 160. Numbered 1\u0026ndash;16. For sequence analysis, the PCR product was cloned into the TOPO TA cloning vector. A BigDye Terminator version 3.1/1.1 Cycle Sequencing Kit (Applied Biosystems) was used for sequencing. Percentage methylation of CpG sites in Lhcgr promoter region was analyzed using Quantification tool for methylation analysis as previous reported (\u003cspan class=\"CitationRef\"\u003e35\u003c/span\u003e).\u003c/p\u003e\n\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\n\u003ch2\u003eStatistical Analysis\u003c/h2\u003e\n\u003cp\u003eAll experiments were performed independently at least three times, and data are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM. Statistical analyses were performed using Graphpad Prism 5 software (Graphpad Software, USA). p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 (* and different letters) were defined as significant differences.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eDown-regulation of ovulation-related key gene expression in CCs of EMs infertile women\u003c/h2\u003e \u003cp\u003eAs shown in the schematic, coupling of LH to LH receptors triggers the ovulation cascade signal, which is responsible for key biological events in the follicle, such as cumulus expansion and follicle rupture, during which the expression of many genes show dynamic changes (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). The genes required for ovulation in mouse CCs cells were detected by qRT-PCR in both EMs and control groups. It showed that the expression of ADAMTS-1 was significantly decreased (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in CCs of the EMs group compared with those of the control group, while the expression of PGR was slightly decreased (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB-C). Subsequently, the expression of cumulus expansion-related genes, HAS2 and PTGS2, was significantly reduced in CCs from EMs women (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD-E). In addition, two other genes (TNFAIP6 and PTX3) involved in COC expansion in CCs were slightly decreased in the EMs group (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF-G). Compared to the control group, all genes encoding EGF-like factors were significantly decreased in the CCs of the EMs group to varying degrees (BTC, P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG-I). Interestingly, LHCGR mRNA levels in CCs of infertile women with EMs are significantly lower than in the control group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01, Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG-I).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eElevated expression of certain cytokines in follicular fluid of infertile women with endometriosis\u003c/h3\u003e\n\u003cp\u003eGiven that many cytokines are secreted by ectopic endometrial lesions in the pelvis of women with endometriosis, we wondered whether or not the intrafollicular microenvironment is altered by inflammation. We tested the levels of inflammatory factors in the follicular fluid of infertile women in both groups by ELISA. It showed that the levels of IL-1a, IL-1b, and IL-4 were not significantly different between the control and EMs groups (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05, S Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA-C). However, the concentrations of IL-8, IL-10, and TNF-α in the follicular fluid were increased to different degrees in the EMs group compared with the control group, and all differences were statistically significant (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). In particular, IL-8 and TNF-α were interesting and representative among the increased cytokines (IL-8: 166.8\u0026thinsp;\u0026plusmn;\u0026thinsp;8.8 vs. 223.4\u0026thinsp;\u0026plusmn;\u0026thinsp;12.6; TNF-α: 81.89\u0026thinsp;\u0026plusmn;\u0026thinsp;14 vs. 119.2\u0026thinsp;\u0026plusmn;\u0026thinsp;39.9 in the control group vs. EMs group, P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD, E, G). In addition, the results showed that the levels of IL-13, PGE2, and PGF2α were significantly lower in the control group than in the EMs group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 S Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF, H, I).\u003c/p\u003e \u003cp\u003e \u003cb\u003eIntra- or extra-ovarian microenvironment inflammatory alteration impairs cumulus expansion in vitro and disrupts ovulation in vivo in mice.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eIn vitro, cumulus expansion is the most important visual response to the ovulation signal initiated by the LH surge, and comparing COC expansion in different follicular microenvironments helps to determine their follicular fluid functional changes. After 14 hours of incubation in this experiment, we found that mouse COCs in the blank control group (basal medium only) showed \"0\" degree expansion: the oocytes were distributed in clusters and (or) granules, and the cumulus cells were tightly connected to the oocytes, the cells were in good condition, and some of the outer CCs were detached and growing against the bottom of the culture dish (S Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA (I)). COCs cultured in the positive control group (medium containing 10 ng/ml EGF) showed full expansion, mucinisation of the extracellular matrix between the CCs, increased cell spacing, and outward radiation of the \"radial crown\" between the oocytes and the innermost CCs (S Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE (II)). In addition, when we cultured COCs with follicular fluid from women with male factor infertility, they showed fully expanded COCs after 14 hours, which was similar to the expansion of CCs in the positive control group (S Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA (III)). However, in the EMs group, where COCs were exposed to follicular fluid from infertile women with EMs, some CCs had a morphology similar to that of the blank control group, with a clustered, granular distribution, no outwardly radiating \"radial crown\", and a large number of CCs were shed from the COCs (S Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA (IV)).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn vitro, mice were injected intraperitoneally with eCG along with peritoneal fluid (from EMs women) or normal saline to observe the number of ovulated COCs in the oviduct; unruptured follicles, and corpus luteum in the ovary after ovulation. We found no difference in body weight between mice on the day of eCG injection and on the day of COC retrieval (S Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA), while the mean number of ovulated COCs was 53.5\u0026thinsp;\u0026plusmn;\u0026thinsp;5.7 in the control group and 35.4\u0026thinsp;\u0026plusmn;\u0026thinsp;1.9 in the EMs group. The number of ovulated oocytes was significantly lower in the EMs group compared to the control group (S Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB-C, P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Twenty-four hours after HCG administration, we found that the corpus luteum/corpus luteum\u0026thinsp;+\u0026thinsp;unruptured follicles) was 85.1% in the control mice and 68.9% in the EMs group. After PAS staining, more unruptured mature follicles and fewer post-ovulatory corpus luteum were seen in the EMs group compared to the control group (S Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD-E).\u003c/p\u003e \u003cp\u003e \u003cb\u003eIL-8/TNF-α inhibits FSH-induced\u003c/b\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003eLhcgr\u003c/span\u003e \u003cb\u003eexpression in OOXs with fewer cumulus cells apoptosis.\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe results of TUNEL staining showed that some CCs cultured in basal medium showed apoptosis after in vitro FSH induction, whereas apoptosis (Cy3-dUTP) was significantly attenuated in the oocyte group with the addition of concentrations of 500 pg/ml IL-8 or (and) 500 pg/ml TNF-α (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. A). It was then shown that BAX/BCL2 (considered as a marker of apoptosis) was significantly reduced by the addition of IL-8 or (and) TNF-α compared to OOX cultured in basal medium (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). On the basis of OOXs, \u003cem\u003eLhcgr\u003c/em\u003e expression was extremely increased when the oocyte was removed by microsurgery because the inhibition of paracrine effects was released. \u003cem\u003eLhcgr\u003c/em\u003e mRNA levels were extremely high in OOXs when the oocyte was removed by COCs because the inhibition of its paracrine effects was prevented. However, its expression decreased significantly when co-cultured with FGOs. When 500pg/ml IL-8 or (and) TNF-α was added to the medium, the FSH-induced expression of \u003cem\u003eLhcgr\u003c/em\u003e was significantly downregulated (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003e \u003cb\u003eIL-8/TNF-α reduces methylation of the Sp1 binding site in the Lhcgr promoter through activation of the P-SMAD2/3-RA pathway\u003c/b\u003e \u003c/p\u003e \u003cp\u003eAs previously reported, the oocyte reduces \u003cem\u003eLhcgr\u003c/em\u003e expression through activation of the P-SMSD2/3-RA-Lhcgr promoter region demethylation pathway by paracrine factors (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e). The Western blot result showed that SMAD2/3 phosphorylation was significantly activated in OOXs when treated with TNF-α alone and IL-8 plus TNF-α (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). We analyzed the key genes encoding the rate-limiting enzymes for retinoic acid (RA) synthesis and catabolism. Notably, the expression of \u003cem\u003eAdh1\u003c/em\u003e, \u003cem\u003eAldh1\u003c/em\u003e and \u003cem\u003eAldh5\u003c/em\u003e in OOXs was significantly decreased to varying degrees after the addition of IL-8/TNF-α compared to the control (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB, D, E). No significant difference was found for either \u003cem\u003eAdh5\u003c/em\u003e or \u003cem\u003eCyp26b1\u003c/em\u003e in the OOXs with or without the above cytokines (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC, F). We found hypermethylation at each of the sites in the \u003cem\u003eLhcgr\u003c/em\u003e promoter region in the COCs, whereas demethylation occurs in the OOXs group. Methylation of the \u003cem\u003eLhcgr\u003c/em\u003e promoter region was hyperactive in OOXs co-treated with IL-8 and TNF-α compared to OOXs cultured in basal medium (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eIL-8/TNF-indirectly lowers\u003c/b\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003eLhcgr\u003c/span\u003e \u003cb\u003eexpression by inhibiting β-Catenin and AKT phosphorylation in OOXs\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThrough a cAMP-PKA-dependent mechanism, FSH directly or indirectly increases β-Catenin and AKT phosphorylation in granulosa cells, which in turn activates the transcriptional activity of \u003cem\u003eLhcgr\u003c/em\u003e and promotes its expression. (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e). According to WB results, IL-8 and TNF-α at 500 pg/ml significantly inhibited the phosphorylation of β-catenin and AKT, which ultimately resulted in a downregulation of \u003cem\u003eLhcgr\u003c/em\u003e expression in OOXs. Notably, IL-8 inhibited their phosphorylation to a greater extent than TNF-α (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA-B).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe aim of our study was to investigate the possible mechanism of frequent LUF and difficult oocyte retrieval in infertile women with EMs. We have shown that key ovulation genes are downregulated in cumulus granulosa cells of infertile women with EMs, as evidenced by dysregulated LHCGR-mediated ovulation cascade signaling. IL-8/TNF-α are represented and significantly elevated cytokines in follicular fluid during LH-mediated ovulation in women with EMs. OOXs used in this experiment could be considered as an ideal cell model to mimic FSH-induced do novo synthesis of \u003cem\u003eLhcgr\u003c/em\u003e. Addition of 500 pg/ml IL-8/TNF-α inhibits \u003cem\u003eLhcgr\u003c/em\u003e expression in OOXs with fewer cumulus cell apoptosis. We also demonstrated that the reduced RA production in cumulus cells was due to the activation of P-SMAD2/3 by IL-8/TNF-α, then the attenuation of \u003cem\u003eLhcgr\u003c/em\u003e promoter methylation, and finally the impaired Lhcgr expression. On the other hand, the cytokines indirectly affected \u003cem\u003eLhcgr\u003c/em\u003e translational activity by inhibiting P-β-catenin and P-AKT, resulting in lower levels of \u003cem\u003eLhcgr\u003c/em\u003e mRNA in OOXs (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003eThe higher incidence of LUF in natural cycles and difficult egg retrieval in ovarian induction cycles can be considered as a poor response to LH surge, as there was no significant difference in peripheral LH concentration between EM and other infertile women in our previous study (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). Antral follicles begin to express LHR upon FSH induction, and as the follicles mature, LH acts on the mural granulosa cells to promote their expression of EGF-like growth factors (\u003cem\u003eAREG/EREG/BTC\u003c/em\u003e), which in turn act on the cumulus cells to promote the expression of cumulus expansion genes (\u003cem\u003eHAS2/PTGS2/PTX3/TNFAIP6\u003c/em\u003e), followed by the expression of protease-related genes (\u003cem\u003eADAMTS-1/RIP140\u003c/em\u003e) and transcription factors (\u003cem\u003ePGR\u003c/em\u003e) in the mural granulosa cells in preparation for ovulation(\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e). A deficiency of any of these cytokines will affect cumulus expansion and consequently ovulation (\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e). We believe that the ovulation signaling cascades initiated from \u003cem\u003eLHCGR\u003c/em\u003e in the follicles of EMs infertile women were defective, and many studies also show downregulation of \u003cem\u003ePTGS\u003c/em\u003e-2, \u003cem\u003eHAS\u003c/em\u003e-2, \u003cem\u003eEREG\u003c/em\u003e, and LHCGR in EMs women, which is similar to our findings (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e). Based on this result, it seems understandable that LUF and follicular dysplasia are common in EMs sterility.\u003c/p\u003e \u003cp\u003eAbnormal founcation and cytokines of Follicular fluid were observed in EMs women. The follicle is the smallest functional unit within the ovary, and the internally filled follicular fluid is the immediate living environment for COC survival. Indeed, alteration in composition will inevitably lead to functional changes. We have confirmed that the follicular fluid and peritoneal fluid of EM women are not sufficient to support cumulus expansion and ovulation. It should be noted that induction of ovulation in mice with human follicular fluid may slightly affect ovulation due to species-specific rejection reactions. In EMs, lots of cytokines in follicular fluid altered, especially IL-8 and TNF-α. In two other recent studies, researchers found that IL-6 and TNF-α were significantly elevated in the follicular fluid of patients with EMs (\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e). The concentration of cytokines detected in this experiment always correlates positively with the severity of endometriosis and provides a reference for later addition of IL-8 and TNF-α. The concentrations of inflammatory factors used in this study were determined based on the concentrations of IL-8 and TNFα measured in the follicular fluid of patients, which were able to cause a decrease in LHR expression in mice at the corresponding concentrations, while not causing massive apoptosis of mouse cumulus cells, so we did not explore the effect of the concentration gradient of the two inflammatory factors. Recently, Yu Tanaka et al. found that TNF-α expression could be suppressed by inhibiting inflammatory factor-induced neutrophil chemokine activity, which in turn reduced follicular atresia and apoptosis (\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e), but this study did not investigate the causal relationship between TNF-α and cumulus cell apoptosis at specific concentrations. In another study, bovine follicular cumulus cells were monitored in vitro using different concentrations of TNF-α (1, 10, 100, and 200 ng/ml) and their survival status was observed, and it was found that 1 ng/ml caused apoptosis and follicular atresia in antral follicular cumulus cells (\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e). However, the concentration used in this study was much higher than the dose of TNF-α concentration (500 pg/ml) used in this study.\u003c/p\u003e \u003cp\u003eLHR-specific dominant expression in granulosa cells is important for the transition from FSH-dependent to LH-dependent follicles, especially for the morphology and function of mature follicles (\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e). LHR is a G protein-coupled 7-transmembrane glycoprotein, and its expression is extremely low on the surface of granulosa cells and oocytes in the wall of the pre-antral follicular phase. FSH promotes retinoic acid synthesis in granulosa cells, which mediates regulation to stimulate demethylation of the LH receptor promoter region on the granulosa cell surface and increased LHCGR expression. In cumulus cells, oocytes promote the SMAD2/3 pathway through the release of oocyte-derived paracrine factors (ODPFs) to inhibit retinoic acid synthesis, and the LH receptor promoter region is maintained at a high level of methylation, resulting in lower levels of \u003cem\u003eLHCGR\u003c/em\u003e on the surface of cumulus cells. (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e). In this study, we found that higher concentrations of IL-8/TNFα, which cause little apoptosis in cumulus cells, could differentially activate P-SMAD2/3 to reduce RA production, maintain higher methylation levels of the \u003cem\u003eLhcgr\u003c/em\u003e promoter Sp1 binding region, and reduce Lhcgr transcriptional activity, resulting in reduced \u003cem\u003eLhcgr\u003c/em\u003e mRNA expression. It has been reported that TNFα inhibits the transcriptional activity of the Lhcgr proximal promoter by promoting the entry of NF-κB (p65 protein) into the nucleus, although the \u003cem\u003eLhcgr\u003c/em\u003e promoter region has no NF-κB binding site and NF-κB can achieve \u003cem\u003eLhcgr\u003c/em\u003e transcriptional regulation through protein-protein interactions. (\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e). However, the exact mechanism has not been clarified, and it is speculated that the p65 protein is involved in the synthesis of the \u003cem\u003eLhcgr\u003c/em\u003e promoter transcriptional repressor (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e). In addition, we found that IL-8/TNF-α can also indirectly activate PI3K to repress P-AKT, which promotes \u003cem\u003eLhcgr\u003c/em\u003e expression by promoting the exit of transcriptional repressor FOXO1 from the nucleus and relieving the repressive effect on \u003cem\u003eLhcgr\u003c/em\u003e transcription, while at the same time, inhibition of β-catenin phosphorylation fails to induce the transcription factor TF3 to replace the transcriptional conjugate bound to the \u003cem\u003eLhcgr\u003c/em\u003e promoter GRE, thereby indirectly reducing \u003cem\u003eLhcgr\u003c/em\u003e transcriptional activity. In this study, we focused only on Lhcgr expression, the LH-LHR binding efficiency should be explored.\u003c/p\u003e \u003cp\u003eThe design idea of this project originated from common clinical phenomena, and scientific questions were raised based on actual clinical difficulties to find the elevated inflammatory factors in the microenvironment - follicular fluid - on which COC depends, and to explore the mechanism. Therefore, to provide a new perspective to clinically address the problem of poor response to LH during ovulation in patients with EMs, we used an ideal in vitro cell culture model to discover the relationship between IL-8/TNFα and \u003cem\u003eLhcgr\u003c/em\u003e expression in cumulus cells and to first explore the potential specific molecular mechanisms.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIncreased IL-8/TNF-α in the follicular fluid of women with EMs indirectly maintains the hypermethylation of the \u003cem\u003eLhcgr\u003c/em\u003e promoter through activation of P-SMAD2/3, while inhibiting AKT and β-catenin phosphorylation, which together reduce the expression of \u003cem\u003eLhcgr\u003c/em\u003e. This may explain, in part, the poor response to LH in the (induction of) ovulation in infertile women with EMs.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was approved by the Research Ethics Committee of the hospital. All infertile women who met the eligibility criteria and agreed to participate in the study provided written informed consent. Mice were raised under the standard conditions at the Research Animal Center at Nanjing Medical University. All mouse procedures and protocols were approved by the Animal Care and Use Committee of each institution, and conducted in accordance with the institutional guides for the care and use of laboratory animals.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNo applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eThe data underlying this article will be shared on reasonable request to the corresponding author.\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by projects from the National Nature and Science Foundation (82101728, 81730041) and the National Key Research and Development Program of China (2017YFC1001604 and 2017YFC1001300) and the Nature and Science Foundation of Jiangsu Province (BK20191491). The funding bodies had no role in the design of the study; the collection, analysis, and interpretation of the data; or the writing of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn this study, Yaoxue Yin collected data by interviewing the infertile women, and wrote the final draft of the manuscript. Yaoxue Yin, Caihe Wen, and Wangjuan Dai performed the molecular biological analysis. Jing Wang and Mengyu Zhang helped with clinical data analysis. Yundong Mao and Xiang Ma participated in the initial conception of the study and the protocol. Feiyang Diao modified and polished the entire manuscript. Lianju Qin helped with the statistical methods and polish of the manuscript. Yugui Cui provided the design and protocol of the research and reviewed and modified the final version of the manuscript. Jiayin Liu and Zhen Hou, as the main investigators, conceived of this project and reviewed and ensured the final version of this manuscript. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors gratefully acknowledge the efforts of the doctors, nurses, embryologists, and the entire staff at the Clinical Reproductive Medicine Center of the First Affiliated Hospital in Nanjing Medical University, Nanjing, China.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eBulun SE. Endometriosis. N Engl J Med. 2009;360:268\u0026ndash;79.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKoninckx PR, Kennedy SH, Barlow DH. Endometriotic disease: the role of peritoneal fluid. Hum Reprod Update. 1998;4:741\u0026ndash;51.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDu YB, Gao MZ, Shi Y, Sun ZG, Wang J. Endocrine and inflammatory factors and endometriosis-associated infertility in assisted reproduction techniques. Arch Gynecol Obstet. 2013;287:123\u0026ndash;30.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMacer ML, Taylor HS. Endometriosis and infertility: a review of the pathogenesis and treatment of endometriosis-associated infertility. Obstet Gynecol Clin N Am. 2012;39:535\u0026ndash;49.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTanbo T, Fedorcsak P. Endometriosis-associated infertility: aspects of pathophysiological mechanisms and treatment options. Acta Obstet Gynecol Scand. 2017;96:659\u0026ndash;67.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKoskimies AI, Liukkonen S, Tenhunen A, Huhtaniemi I. Low LH receptor content in corpora lutea in luteinized unruptured follicle (LUF) syndrome. Hum Reprod. 1987;2:367\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKaya H, Oral B. Effect of ovarian involvement on the frequency of luteinized unruptured follicle in endometriosis. Gynecol Obstet Invest. 1999;48:123\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYin Y, Mao Y, Liu A, Shu L, Yuan C, Cui Y, et al. Insufficient Cumulus Expansion and Poor Oocyte Retrieval in Endometriosis-Related Infertile Women. Reproductive Sci. 2021;28:1412\u0026ndash;20.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSu YQ, Sugiura K, Li Q, Wigglesworth K, Matzuk MM, Eppig JJ. Mouse oocytes enable LH-induced maturation of the cumulus-oocyte complex via promoting EGF receptor-dependent signaling. Mol Endocrinol. 2010;24:1230\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEppig JJ, Wigglesworth K, Pendola FL. The mammalian oocyte orchestrates the rate of ovarian follicular development. Proc Natl Acad Sci USA. 2002;99:2890\u0026ndash;4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWigglesworth K, Lee KB, O'Brien MJ, Peng J, Matzuk MM, Eppig JJ. Bidirectional communication between oocytes and ovarian follicular somatic cells is required for meiotic arrest of mammalian oocytes. Proc Natl Acad Sci USA. 2013;110:E3723\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRichards JS, Liu Z, Shimada M. Immune-like mechanisms in ovulation. Trends Endocrinol Metab. 2008;19:191\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTaylor HS, Kotlyar AM, Flores VA. Endometriosis is a chronic systemic disease: clinical challenges and novel innovations. Lancet. 2021;397:839\u0026ndash;52.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChapron C, Marcellin L, Borghese B, Santulli P. Rethinking mechanisms, diagnosis and management of endometriosis. Nat reviews Endocrinol. 2019;15:666\u0026ndash;82.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWeiss G, Goldsmith LT, Taylor RN, Bellet D, Taylor HS. Inflammation in reproductive disorders. Reproductive Sci. 2009;16:216\u0026ndash;29.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBulun SE, Yilmaz BD, Sison C, Miyazaki K, Bernardi L, Liu S, et al. Endometr Endocr reviews. 2019;40:1048\u0026ndash;79.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFilip L, Duica F, Pradatu A, Cretoiu D, Suciu N, Cretoiu SM et al. Endometriosis Associated Infertility: A Critical Review and Analysis on Etiopathogenesis and Therapeutic Approaches. Medicina 2020;56.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu MH, Shoji Y, Chuang PC, Tsai SJ. Endometriosis: disease pathophysiology and the role of prostaglandins. Expert Rev Mol Med. 2007;9:1\u0026ndash;20.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNothnick W, Alali Z. Recent advances in the understanding of endometriosis: the role of inflammatory mediators in disease pathogenesis and treatment. F1000Research 2016;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRonnberg L, Kauppila A, Rajaniemi H. Luteinizing hormone receptor disorder in endometriosis. Fertil Steril. 1984;42:64\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNakao K, Kishi H, Imai F, Suwa H, Hirakawa T, Minegishi T. TNF-alpha Suppressed FSH-Induced LH Receptor Expression Through Transcriptional Regulation in Rat Granulosa Cells. Endocrinology 2015;156:3192 \u0026ndash; 202.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHaney AF, Muscato JJ, Weinberg JB. Peritoneal fluid cell populations in infertility patients. Fertil Steril. 1981;35:696\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHill JA, Anderson DJ. Lymphocyte activity in the presence of peritoneal fluid from fertile women and infertile women with and without endometriosis. Am J Obstet Gynecol. 1989;161:861\u0026ndash;4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHammond MG, Oh ST, Anners J, Surrey ES, Halme J. The effect of growth factors on the proliferation of human endometrial stromal cells in culture. Am J Obstet Gynecol. 1993;168:1131\u0026ndash;6. discussion 6\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu MY, Ho HN. The role of cytokines in endometriosis. Am J Reprod Immunol. 2003;49:285\u0026ndash;96.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eArici A. Local cytokines in endometrial tissue: the role of interleukin-8 in the pathogenesis of endometriosis. Ann N Y Acad Sci. 2002;955:101\u0026ndash;9. discussion 18.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eImai F, Kishi H, Nakao K, Nishimura T, Minegishi T. IL-6 up-regulates the expression of rat LH receptors during granulosa cell differentiation. Endocrinology. 2014;155:1436\u0026ndash;44.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou P, Baumgarten SC, Wu Y, Bennett J, Winston N, Hirshfeld-Cytron J, et al. IGF-I signaling is essential for FSH stimulation of AKT and steroidogenic genes in granulosa cells. Mol Endocrinol. 2013;27:511\u0026ndash;23.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin X, Tong X, Zhang Y, Gu W, Huang Q, Zhang Y et al. Decreased Expression of EZH2 in Granulosa Cells Contributes to Endometriosis-Associated Infertility by Targeting IL-1R2. Endocrinology 2022;164.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLottini T, Iorio J, Lastraioli E, Carraresi L, Duranti C, Sala C, et al. Transgenic mice overexpressing the LH receptor in the female reproductive system spontaneously develop endometrial tumour masses. Sci Rep. 2021;11:8847.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKawai T, Richards JS, Shimada M. The Cell Type-Specific Expression of Lhcgr in Mouse Ovarian Cells: Evidence for a DNA-Demethylation-Dependent Mechanism. Endocrinology. 2018;159:2062\u0026ndash;74.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBuccione R, Vanderhyden BC, Caron PJ, Eppig JJ. FSH-induced expansion of the mouse cumulus oophorus in vitro is dependent upon a specific factor(s) secreted by the oocyte. Dev Biol. 1990;138:16\u0026ndash;25.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSu YQ, Wu X, O'Brien MJ, Pendola FL, Denegre JN, Matzuk MM, et al. Synergistic roles of BMP15 and GDF9 in the development and function of the oocyte-cumulus cell complex in mice: genetic evidence for an oocyte-granulosa cell regulatory loop. Dev Biol. 2004;276:64\u0026ndash;73.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSu YQ, Yin Y, Guo J, Gong X, Tian Y, Shi L. MTOR-mediated interaction between the oocyte and granulosa cells regulates the development and function of both compartments in micedagger. Biol Reprod. 2022;107:76\u0026ndash;84.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBashtrykov P, Jeltsch A. DNA Methylation Analysis by Bisulfite Conversion Coupled to Double Multiplexed Amplicon-Based Next-Generation Sequencing (NGS). Methods in molecular biology 2018;1767:367 \u0026ndash; 82.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSu YQ, Sugiura K, Wigglesworth K, O'Brien MJ, Affourtit JP, Pangas SA, et al. Oocyte regulation of metabolic cooperativity between mouse cumulus cells and oocytes: BMP15 and GDF9 control cholesterol biosynthesis in cumulus cells. Development. 2008;135:111\u0026ndash;21.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhan H, Peng B, Ma J, Lin K, Xu K, Lin J, et al. Epidermal growth factor promotes stromal cells migration and invasion via up-regulation of hyaluronate synthase 2 and hyaluronan in endometriosis. Fertil Steril. 2020;114:888\u0026ndash;98.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eda Luz CM, da Broi MG, Donabela FC, Paro de Paz CC, Meola J, Navarro PA. PTGS2 down-regulation in cumulus cells of infertile women with endometriosis. Reprod Biomed Online. 2017;35:379\u0026ndash;86.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNing Y, Liu B, Han B, Guo J, Liu X, Fan G, et al. [Analysis of influence of inflammatory factor in patients with ovarian endometriosis follicular fluid on the outcome of in vitro fertilization]. Zhonghua yi xue za zhi. 2015;95:3829\u0026ndash;32.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGonzalez MB, Lane M, Knight EJ, Robker RL. Inflammatory markers in human follicular fluid correlate with lipid levels and Body Mass Index. J Reprod Immunol. 2018;130:25\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTanaka Y, Kuwahara A, Ushigoe K, Yano Y, Taniguchi Y, Yamamoto Y, et al. Expression of cytokine-induced neutrophil chemoattractant suppresses tumor necrosis factor alpha expression and thereby prevents the follicles from undergoing atresia and apoptosis. Reproductive Med biology. 2017;16:157\u0026ndash;65.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSilva AWB, Ribeiro RP, Menezes VG, Barberino RS, Passos JRS, Dau AMP, et al. Expression of TNF-alpha system members in bovine ovarian follicles and the effects of TNF-alpha or dexamethasone on preantral follicle survival, development and ultrastructure in vitro. Anim Reprod Sci. 2017;182:56\u0026ndash;68.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWohlres-Viana S, Arashiro EKN, Machado MA, Camargo LSA, Siqueira LGB, Palhao MP, et al. Intrafollicular oestradiol production, expression of the LH receptor (LHR) gene and its isoforms, and early follicular deviation in Bos indicus. Reprod Fertil Dev. 2017;29:1958\u0026ndash;70.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTodorov VT, Volkl S, Muller M, Bohla A, Klar J, Kunz-Schughart LA, et al. Tumor necrosis factor-alpha activates NFkappaB to inhibit renin transcription by targeting cAMP-responsive element. J Biol Chem. 2004;279:1458\u0026ndash;67.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Endometriosis, ovulation, IL-8, TNF-α, LHCGR","lastPublishedDoi":"10.21203/rs.3.rs-2855626/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-2855626/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground:\u003c/strong\u003e To study whether ILs/TNFs in the follicular fluid (FF) of women with EMs are responsible for impaired follicular development or (and) ovulation or not, and then to explore the underlying mechanisms.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods: \u003c/strong\u003efollicular fluid (containing cumulus granulosa cells) was collected from women with EM and male factor infertility at our Clinical Reproductive Medicine Center, and peritoneal fluid was collected from the above patients with EMs. The expression of ovulation-related genes in cumulus cells was analysed by RT-PCR. Mouse cumulus cells expansion degree was assessed after cultured in follicle fluid from infertile women. Follicle fluid was detected by ELISA. Oocytectmized complex cell model was established, and cultured in vitro medium with addition of 100 IU/ml FSH. TUNEL staining was used to determine the apoptosis of cumulus cells. Then, we explored expression of P-SMAD2/3,key enzyme for retinoic acid metabolism, and methylation of SP1 binding sites in \u003cem\u003eLhcgr\u003c/em\u003e promoter region. Meanwhile, the P-AKT and P-catenin were assessed by Western blot. All experiments were performed independently at least three times, and data are presented as mean ± SEM. Statistical analyses were performed using Graphpad Prism 5 software p\u0026lt;0.05 (* and different letters) were defined as significant differences.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults:\u003c/strong\u003e In cumulus cells, expression of genes related to ovulation decreased significantly than that in controls (P \u0026lt; 0.05), especially starting from\u003cem\u003e LHCGR\u003c/em\u003e. The concentrations of IL-8 and TNF-α in follicle fluid were significantly higher in infertile women with endometriosis than in controls (P \u0026lt; 0.05). The function of follicle fluid and pelvic fluid of endometriosis women have changed. Addition of 500 pg/mL IL-8/TNF-α to medium did not cause significant apoptosis of cumulus cells, but inhibited P-AKT and P-β-catenin. On the other hand, expression of P-SMAD2/3 and retinoic acid production were reduced, while hypermethylation of the Sp1 binding sequence on \u003cem\u003eLhcgr\u003c/em\u003e promoter was identified, and \u003cem\u003eLhcgr\u003c/em\u003e expression was significantly reduced compared to control (P\u0026lt;0.05).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion:\u003c/strong\u003e Elevated IL-8/TNF-α in follicular fluid of women with endometriosis indirectly maintains \u003cem\u003eLhcgr\u003c/em\u003epromoter hypermethylation through activation of P-SMAD2/3, while inhibiting AKT and β-Catenin phosphorylation, which together reduce \u003cem\u003eLHCGR\u003c/em\u003e mRNA expression.\u003c/p\u003e","manuscriptTitle":"Elevated IL-8/TNF-α in follicle fluid of infertile women with endometriosis decrease LHCGR expression in cumulus cells","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-05-11 21:30:04","doi":"10.21203/rs.3.rs-2855626/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"55e7ca33-7948-4ba7-a9db-a7b36953fb27","owner":[],"postedDate":"May 11th, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2023-05-31T14:41:38+00:00","versionOfRecord":[],"versionCreatedAt":"2023-05-11 21:30:04","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-2855626","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-2855626","identity":"rs-2855626","version":["v1"]},"buildId":"0U-iFTyB6qxOgVj8rjrZV","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Condition tags

endometriosisinfertility

Citation neighborhood

Papers in the corpus that this work cites (lower rings, blue) and that cite this one (upper rings, green). Dot size scales with the paper's in-corpus citation count — bigger dot = more influential within the endo/adeno field. Click a dot to open that paper. [ expand to 2 hops ] — adds papers reached through this work's immediate citers/citees. Heavier; up to 60 extra dots.

References (41)

Source provenance

europepmc
last seen: 2026-08-17T06:23:50.590068+00:00
openalex
last seen: 2026-06-10T17:14:06.276822+00:00
License: CC0 · commercial use OK