Author
SS, KN, and SK investigated and conceptualized the study. SS, KK, and RS carried out experiments. SS, KK, RS, MI, TI, and HY curated the data and SS, KN, SK formally analyzed the data. SS and SK wrote the original draft manuscript and all authors reviewed and edited the manuscript.
Ethical
Approval of the research protocol by an institutional review board: The protocol for acquiring and using tissue specimens was approved by the Institutional Review Board of Shimane University Hospital (IRB No. 20070305‐1 and No. 20070305‐2).
Informed consent: Informed consent was obtained from the subjects.
Registry and registration no. of the study/trial: N/A.
Animal studies: N/A.
Results
We detected mutations of KRAS or PIK3CA in single endometrial glands using the Sanger method rather than NGS in consideration of cost benefits and utility in clinical practice. The present study is the first to use the Sanger method to detect oncogenic mutations in a single gland. Ten microscopically isolated single glands from each of the nine regions of the entire endometrium were subjected to sequencing (Figure 1 ). KRAS or PIK3CA mutations were detected at different rates in each region (Figure 2A ), some of which showed identical mutations in multiple glands, whereas others had no mutations detected, exhibiting region specificity. Figure 2B summarizes the detection rate of oncogenic mutations by each region, which varied from 0% to 50%. The frequencies of detected mutations were 6.6% (6/90) in case 1, 14.4% (13/90) in case 2 and 6.6% (6/90) in case 3, respectively. Overall, mutations in KRAS or PIK3CA were detected in 9.3% (25/270) of isolated single glands in the present study. Next, we sought to examine the clonality of these mutations by ddPCR. The average MAFs of KRAS G12V and PIK3CA E542Q were 1.1 ± 0.49% and 16.4% ± 6.57%, respectively (Figure 2C ), suggesting clonal expansion, especially in PIK3CA‐ mutated cells.
Detection of gene mutations in endometrial single glands using the Sanger method. (A) Endometrial single glands were microscopically collected from endometrial minced specimens (magnification, ×40). (B) Representative cases of PIK3CA or KRAS mutations detected by Sanger sequencing
Frequency of PIK3CA and KRAS mutations detected in each region of the entire endometrium. (A) The endometrium of surgically removed uteri in each case was divided into nine areas (A–I). A total of 10 single endometrial glands from each region were randomly picked up after collagenase treatment with microscopic manipulation and were subjected to mutational analyses of KRAS or PIK3CA hotspots by the Sanger method. The mutations observed in each region are shown for each case. There were no multiple mutations within the same gland. (B) Summary of the mutational analysis in each area of Case 1–3. Frequency of mutated glands per tested glands is shown as a percentage in each area or in entire endometrium. Eventually, a total of tested 270 glands contained 25 (9.3%) mutated glands. (C) Droplet digital PCR for the single glands with KRAS G12V and PIK3CA E542Q showed 1.1% and 16.4% of the mutant allele frequency (MAF), respectively. The horizontal and vertical axes indicate the fluorescence intensity of WT HEX and mutant‐type FAM droplets, respectively. Blue dots, MT alleles alone; green dots, WT alleles alone; brown dots, both WT and MT alleles; gray dots, no allele amplified
We next determined the source of oncogenic mutations in the glands. Considering the monoclonal composition of cells in a gland, it is possible that such mutations could be present in stem or stem‐like cells. The existence of stem or stem‐like cells in endometrial glands has been postulated, especially in the basal layers of the endometrium.
15
However, pure isolation of a single stem cell has not been accomplished, despite multiple potential markers having been reported. To reconstitute stem‐rich populations, spheroid cultures have been proposed.
16
We thus grew spheroid cultures from a single gland isolated from each region of the endometria and attempted to identify the oncogenic mutations. The regional specificity of oncogenic mutations in the endometrium led us to expect that the efficiency of spheroid formation is higher in mutation‐prone regions.
Thirty glands were isolated from each of the nine endometrial regions per patient, and long‐term spheroid culturing was carried out for a total of 27 regions. Single endometrial glands were cultured with stem cell media in nonadhesive dishes. They first showed morphologically round shapes, after which most cells gradually became isolated, scattered, and eventually dropped to the bottom of the dish, while some cells remained floating, forming spheroid‐like structures (Figure 3A ). Some spheroids gradually increased in size (Figure 3B,C ) and eventually became macroscopically visible (Figure 3D ). Each spheroid with a diameter of 2 mm or more after 3 months was isolated and subjected to Sanger sequencing. Table 1 summarizes the KRAS / PIK3CA mutations in the spheroids. A total of 33 spheroids (9 for Case 1, 23 for Case 2, and 1 for Case 3) were grown to over 2 mm in size, and the number of spheroids was different for each region. Curiously, many spheroids were formed in areas where oncogenic mutations in the endometrial glands were not identified, such as area D of Case 1 or F of Case 2 (Figure 2A,B ; Table 1 ). Mutational analysis detected oncogenic mutations in hotspots of PIK3CA in 22 of 33 grown spheroids (63.3%), while no pathogenic mutations of KRAS were observed.
Microscopic and macroscopic views of spheroid growth. (A, B) Spheroidizing cells (arrows). (C) Representative spheroid under a microscope. (D) Macroscopic image of grown spheroids
Spheroids grew frequently with PIK3CA mutations and not necessarily from mutation‐prone regions of the entire endometrium
Next, IHC was carried out to characterize the properties of the spheroids. First, the expression of ALDH1A1, Axin2, and SOX9, previously reported stem cell marker of endometrial epithelium,
17
was examined in spheroids after grown in stem‐cell media for over 3 months. As shown in Figure 4A , the predominant expressions of cytoplasmic ALDH1A1, nuclear Axin2, and SOX9 were confirmed in all the spheroids examined, suggesting that spheroids were mainly composed of cells with stem‐like characteristics through long‐term culture. Next, to identify the origin of the components in the spheroids, PAX8
18
,
19
expression was examined for spheroids obtained from region F of Case 2 while using sections of the proliferative‐phase endometrium from the same patient as a control. Nuclear PAX8 staining was confirmed in most components of the spheroids as well as endometrial epithelium in control (Figure 4B ), suggesting that long‐term spheroid cultures can purify endometrial epithelial cells. In addition, β‐catenin was expressed in the cell membrane, and estrogen receptor was expressed in the cytoplasm or nucleus in both spheroids and endometrium (data not shown). Overall, spheroids seem to sustain epithelial glandular characteristics. Of note, most cells in spheroids expressed Axin2 in the nucleus (Figure 4B ). In contrast, in the normal control endometrium, Axin2 was mainly expressed in the cytoplasm of some columnar cells. However, interestingly, we found that a cell population at the bottom of the gland markedly expressed nuclear Axin2 (Figure 4B ), consistent with the potentially assumed localization of endometrial glandular stem cells. These findings prompted us to examine the proliferative potential of Axin2‐expressing cells by confocal fluorescent staining of Ki‐67 in the control endometrium of this patient. A small number of cells expressing Axin2 in the nucleus (not cytoplasm) at the bottom of the endometrial gland were confirmed (Figure 4C ), and these cells were found to be negative for Ki‐67, suggestive of quiescence despite the proliferative phase. These results support the possibility that spheroids obtained from long‐term stem cell cultures might be at least partly derived from quiescent cell populations with nuclear Axin2 expression located at the bottom of the endometrial gland.
Immunohistochemistry of epithelial stem cell markers and PAX8 in spheroids and endometrium from the same patient. (A) Expression of ALDH1A1, Axin2, and SOX9 in cells composing spheroids. (B) Expression of PAX8 and Axin2 in spheroids and the normal proliferative‐phase endometrium (EM) in the same patient (Case 2). The circle and small square indicate nuclear Axin2‐positive cells at the bottom of the endometrial gland. (C) Merged image with multiple fluorescent‐immunostaining of Axin2, DAPI, and Ki‐67 in the EM of a randomly selected patient. Arrows indicate nuclear (but not cytoplasmic) Axin2‐positive cells at the bottom of the endometrial gland
Discussion
Our data show that oncogenic mutations of KRAS / PIK3CA are common in the normal endometrium of perimenopausal women and can be detected by the Sanger method (Figure 1 ). Previous studies using Sanger sequencing have reported that such oncogenic mutations are absent in normal endometrium, unlike endometrial cancer or its precursors.
20
,
21
The reason for this discrepancy might be due to our unique methodology using microscopic isolation of single glands, which can increase the purity of the glandular components while minimizing contamination with stromal components. As a single gland is known to be mainly composed of monoclonal cells, mutant cells are likely to account for a considerable portion of a whole gland, potentially enabling detection by Sanger sequencing. In fact, the ddPCR suggested clonal expansion of mutated cells, especially for PIK3CA mutations with 16% of MAFs.
Of note, pathogenic mutations occurred territorially (Figure 2 ). In support of our results, a somatic mutation analysis of cancer‐related genes using NGS for 1311 endometrial glands from 37 women has also shown that multiple glands with the same somatic mutation occupy a substantial area of the endometrium.
22
Interestingly, recent studies focusing on the 3D structure of the endometrium by in vivo lineage tracing using mtDNA mutations and tissue clearing‐based 3D imaging showed that the endometrial glands form a horizontal network in the basal layer. Additionally, each vertical gland of the functionalis extends from there in a single or interconnected manner, respectively.
23
,
24
This horizontal network can clearly explain the region specificity of oncogenic mutations; mutant cells can extend over a gland horizontally to neighboring ones, forming a territory with identical mutations.
One critical question is whether these mutations originated from stem‐like cells in a gland. We thus conducted long‐term stem cell (spheroid) cultures that can efficiently propagate stem cells and detected oncogenic mutations. Unexpectedly, spheroids tended to form from regions where oncogenic mutations were not detected in a single gland, rather than in mutation‐prone regions (Figure 2 , Table 1 ). However, interestingly, all mutations identified in spheroids were PIK3CA mutations, not KRAS , and the detection rate of mutations in spheroids was much higher than that of a single gland. Taken together, these findings indicate that cells with the PIK3CA mutation have a prominent ability to form spheroids in a nonadhesive dish environment, unlike with KRAS mutations.
Many theories have been reported so far regarding the character of stem cells in the endometrial epithelium.
25
,
26
,
27
,
28
However, the roles of epithelial stem cells in endometrial regeneration and uterine tumorigenesis are controversial. Therefore, the clinical application of epithelial stem cells remains unresolved.
25
Here, we focused on Axin2 as a protein that negatively regulates the β‐catenin pathway. Axin2 has long been known to be expressed in the basal layer of the endometrium
15
and has been reported to be a marker for endometrial epithelial stem cell regeneration and endometrial cancer.
29
We found that spheroids produced by long‐term stem cell culture express Axin2 in the nucleus, not cytoplasm. They also expressed nuclear SOX9 and cytoplasmic ALDH1A1, known epithelial stem cell markers (Figure 4 ). In the functional layer of normal endometrium, cells expressing Axin2 were scattered in the cytoplasm, while nuclear Axin2‐positive cells were rarely present near the basal layer, lacking Ki‐67 expression. We speculated that the latter population might represent stem‐like characteristics and could be the source of the spheroids. Considering the high MAF of PIK3CA mutation (16.4%) in a single gland as well as extremely high frequency of PIK3CA mutations (66%) in spheroids, they may promote epithelial stem cell propagation.
Although oncogenic mutations of PTEN, KRAS , and PIK3CA are frequently observed in endometrial cancer and are thought to be the major drivers,
30
these mutations are also present in the normal endometrium,
3
,
31
albeit at a lesser frequency. It has been postulated that some of these mutations in normal endometrium might be involved in carcinogenesis. However, the fact that normal endometrium cyclically exhibits complete shedding during menstrual periods raises question as to how they are involved in carcinogenesis. Recent in vivo experiments suggest that mesenchymal‐to‐epithelial transition does not occur in the endometrial epithelium.
32
Furthermore, gene mutational profiles are completely different between endometrial epithelium and stroma.
33
Thus, the carcinogenesis of epithelial malignancies is likely based on abnormal epithelial cells. Our data clearly suggest that nuclear PAX8‐ and Axin2‐positive cells with PIK3CA mutations are major constituents of spheroids. This finding supports the stem cell hit theory, in which stem or stem‐like cells with PIK3CA mutations, probably localized in the basal layers, continue to provide daughter cells with the same mutations even after shedding so that they could account for a considerable portion of a whole gland or extend to neighboring glands.
1
Supporting this theory, a recent NGS study clearly showed that a mutant gland in the functional layer originated vertically from several stem cells located in the basal layer.
22
,
23
,
24
However, to the best of our knowledge, it is still unclear whether oncogenic mutations detected in normal endometrium contribute to carcinogenesis. Although NGS has enabled the detection of cancer‐related gene mutations with low MAF, their functional significance remains to be elucidated. One of the major barriers for analyzing the functional significance of these mutations is a lack of in vitro or in vivo systems available for long‐term culture of mutated cells, for which our spheroid culture might be useful.
In contrast to the stem cell hit theory, another hypothesis is that genetic hits can occur in nonstem cells under the special circumstance of a lack of cyclic shedding. Assuming that some areas of the functional layer remain during menstruation that escape shedding, it is thought that pathogenic mutations can accumulate in nonstem daughter cells and could partly contribute to carcinogenesis. Supporting this, a study using hysteroscopy and electron microscopy to capture morphological changes in the endometrium during menstruation showed that menstrual shedding occurs in a piecemeal manner.
34
They revealed that areas of unshed, shed, and healing endometrium coexist, and that a single gland remains like a clay tube after shedding. Notably, 1 day after the start of menstruation, stromal cells quickly cover the surface of the endometrium, and the uterine lumen becomes flat when observed with a hysteroscope.
34
Therefore, we may not have clinically captured the area of normal endometrium that does not shed. Recently, age‐related accumulation of mutations in an endometrial cancer driver gene was shown in endometrial polyps that are not affected by regular shedding.
35
Abnormal endometrial repair mechanisms during the menstrual cycle may be involved in the accumulation of gene mutations in the endometrium. However, this needs further consideration.
Our research has the following limitations. First, mutations other than KRAS / PIK3CA hotspots were not evaluated. Second, it is possible that mutations with low mutation allele frequency were missed because NGS was not used. Third, this is a prospective experiment using clinical specimens with a limited number of patients in the proliferative phase. However, even considering these limitations, this study clearly identified that major oncogenic mutations of KRAS and PIK3CA in normal endometrium can be detected by the simple and inexpensive Sanger method.
Currently, no early detection method for endometrial cancer in asymptomatic women has been established other than conventional cytological screening. Attempts have been made to detect genetic mutations with cytological samples,
36
but the results are inadequate.
37
Analysis using the Sanger method with a single gland is practical and clinically useful to identify oncogenic mutations in normal endometrium, and this could be developed as a novel tool to predict endometrial disorders or malignancies in perimenopausal or postmenopausal women with high risk factors.
In conclusion, Sanger sequencing detected KRAS or PIK3CA mutations in normal endometria with regional diversity. Spheroids grown from a single gland frequently had PIK3CA mutations expressing epithelial stem cell markers, supporting the stem cell hit theory. This information improves our understanding of endometrial physiology as well as stem cell‐oriented endometrial regeneration and carcinogenesis.
Introduction
Normal endometrium periodically exfoliates and regenerates in reproductive women. Its functional or genetic abnormalities are tightly associated with many gynecological disorders, such as endometrial cancer and endometriosis.
1
,
2
,
3
Recently, it has been revealed that pathogenic mutations of oncogenes occur not only in these disorders but in the normal endometrium.
4
,
5
,
6
,
7
,
8
,
9
,
10
,
11
,
12
However, their biological significance for the etiology of gynecologic diseases or abnormal conditions in menstrual women is uncertain. We previously reported that each endometrial gland exhibits a monoclonal growth pattern with regional diversity.
13
To explain the monoclonal growth of each endometrial gland, we have proposed a hypothesis in which stem‐like cells are present probably in the basal layers in each gland, and the daughter cells occupy the whole gland with monoclonality, which is linked to the vigorous proliferation of endometrial glands in each cycle or the development of endometrial cancer when oncogenic mutations are added.
13
,
14
To test this hypothesis, in the present study we focused on the frequency and regional distribution in the entire endometrium of PIK3CA and KRAS mutations, which are representative driver genes for endometrial cancer that are also present in normal endometrial glands.
4
Furthermore, we observed the rates of spheroid formation in vitro from a single gland in each endometrial region and examined the diversity in the region as well as the types of oncogenic mutation. Finally, the immunohistochemical characteristics of these spheroids obtained by long‐term stem cell culture were evaluated.
Coi Statement
The authors have no conflicts of interest to declare.
Materials And Methods
The endometria in the proliferative phase of the menstrual cycle were examined from three perimenopausal women who underwent total hysterectomy with a diagnosis of uterine fibroids (Cases 1 and 2) or adenomyosis (Case 3). The protocol for acquiring and using tissue specimens was approved by the Institutional Review Board of Shimane University Hospital (IRB No. 20070305‐1 and No. 20070305‐2, version 10; last update, 8 December 2019). Written informed consent for using removed uterine specimens for research analyses were obtained from all patients. The study was conducted in accordance with the tenets of the Declaration of Helsinki and Title 45 (US Code of Federal Regulations), Part 46 (Protection of Human Subjects), effective 13 December 2001.
Immediately after hysterectomy, a gynecologist macroscopically divided the endometrium into nine regions with a scalpel or scissors. A total of 40 endometrial glands were randomly picked up and collected with microscopic manipulation
13
from each region after collagenase treatment. Ten of these glands in each region were DNA‐extracted and subjected to mutational analysis for KRAS and PIK3CA using the Sanger method, and the remaining 30 were subjected to long‐term spheroid cultures. To examine the clonality of the single glands sampled in our experiment, we used ddPCR for analyzing the MAFs of KRAS G12V and PIK3CA E542Q detected by the Sanger methods. Spheroids grown to a diameter of 2 mm or more were collected and subjected to mutational analysis in the same manner as for single glands. Immunohistochemistry was carried out to characterize the spheroid constituents and origin of the expression of endometrial epithelial marker PAX8, endometrial stem cell markers Axin2, ALDH1A1, and SOX9, and indicator of cell proliferation Ki‐67.
As described above, the normal endometrium was divided into nine sections. Thirty single glands collected under a microscope from each region were isolated. All single glands obtained from one section were cultured together in one well of a 6‐well nonadhesive dish (#3471; Corning) for 3 months in a humidified atmosphere containing 5% CO 2 at 37°C. Each well was filled with appropriate media: StemPro hESC SFM (#A1000701; Thermo Fisher Scientific), FGF‐Basic (AA10‐155) REC HU (#PHG0021; Thermo Fisher Scientific), 2‐mercaptoethanol (#21985‐023; Thermo Fisher Scientific), Y‐27632 (#3471; Wako), and insulin (#11376497001; Roche Diagnostics). Cells clumped to the bottom of nonadherent plates were removed as appropriate. The media were changed every 3–4 days. No passaging was undertaken until the spheroids were collected.
DNA was extracted by the alkaline method. Single glands or spheroids were collected from a nonadhesive dish with a sterile micropipette tip and suspended in 50 μL sterile water, then washed twice with 1 mL PBS. After adding 15 μL of 100 mM NaOH to the samples, they were heated at 95°C for 10 min, followed by adding 3 μL of 1 M Tris–HCl (pH 7.0). After centrifugation at 8000–10,000 g for 1 min, the supernatants were collected to prepare DNA samples.
Extracted DNAs were amplified by PCR using primers for exon 2 of KRAS and exons 9 and 20 of PIK3CA . We focused on analyzing the exons that have been reported to harbor the majority of mutations in each of the genes. The primers used for amplification were: KRAS ‐exon 2, forward primer 5′‐TTAACCTTATGTGTGACATGTTCTAA and reverse primer 5′‐AGAATGGTCCTGCACCAGTAA; PIK3CA ‐exon 9, forward primer 5′‐ACAGAGTAACAGACTAGCTAGAG and reverse primer 5′‐CATGTAAATTCTGCTTTATTTATTCC; PIK3CA ‐exon 20, forward primer 5′‐ATGATGCTTGGCTCTGGAAT and reverse primer 5′‐GGTCTTTGCCTGCTGAGAGT. The thermal cycle profile for all gene amplifications included one cycle at 95°C for 30 s followed by 40 cycles at 55°C and extension at 72°C for 15 s. All PCR‐amplified products were sequenced by Beckman Coulter and analyzed using Mutation Surveyor DNA Variant Analysis Software. The pathogenicity of each mutation was confirmed using the Catalogue of Somatic Mutations in Cancer (COSMIC).
To confirm the clonality of the endometrial glands, MAFs were analyzed by ddPCR using each of the four glands containing KRAS G12V or PIK3CA E542Q. We used the ddPCR KRAS Screening Multiplex Kit (#1863506, Bio‐Rad), a multiplex ddPCR assay able to detect alterations in exons 12 and 13 in the KRAS gene. Furthermore, ddPCR primers and probe sets were designed to detect mutations involving PIK3CA E542Q, and internal controls. Internal controls were used as validity indicators of the state of the specimen, DNA extraction, and PCR processes. All processes were carried out according to the manufacturer's protocols. All probes corresponding to mutant or WT alleles were labeled with either 6‐FAM or HEX fluorophores. Reaction mixtures (22 μL) containing digested sample cDNA, ddPCR Supermix for Probes (#1863023; Bio‐Rad), 1100 nM of each primer, and 250 nM of each probe were loaded into the Automated Droplet Generator (#1864101ja; Bio‐Rad). The samples were amplified on a C1000 Touch Thermal Cycler (#1864003ja, Bio‐Rad) (95°C for 10 min, followed by 40 cycles of 94°C for 30 s and 60°C [ PIK3CA‐ E542Q] or 55°C [ KRAS‐ G12V] for 60 s, with a final elongation step of 98°C for 10 min). After completion of the PCR process, the plate was read using a QX200 Droplet Reader (#1864003ja; Bio‐Rad) with the following settings: channel 1, FAM; channel 2, HEX. After droplet reading, analysis was carried out using QuantaSoft Software (version 1.7; Bio‐Rad). The MAF was calculated as follows: MAF = absolute quantification of mutant clone / absolute quantification of mutant + WT clones.
The expressions of PAX8, Axin2, ALDH1A1, and SOX9 were evaluated by IHC analysis. The FFPE spheroid sections (3 µm thick) were dewaxed in xylene and hydrated in graded alcohol. After antigen retrieval in sodium citrate buffer, the slides were incubated in overnight at 4°C with Abs at the following dilutions: 1:500 PAX8 (10336‐1‐AP; Proteintech), 1:200 Axin2 (20540‐1‐AP; Proteintech), 1:200 ALDH1A1 (15910‐1‐AP; Proteintech), and 1:500 SOX9 (HPA001758; Atlas Antibodies). Two gynecologic oncologists (S.S. and S.K.) independently evaluated the samples under a light microscope. Sections of normal endometria in the same patients were used as positive controls for all markers.
For immunofluorescence staining, FFPE spheroids or endometrium slides were loaded into a glass slide holder and dewaxed in xylene and then hydrated with alcohol. Sodium citrate buffer pH 6.0 was used for antigen retrieval in an autoclave for 10 min followed by incubation with primary Abs at a dilution of Axin2 1:200 and Ki‐67 1:100 overnight at 4°C followed by incubation with fluorescence‐labeled secondary Abs for 1 h at room temperature. Slides were then counterstained with Fluoroshield Mounting Medium with DAPI (Sigma‐Aldrich), and the immunofluorescence was detected using a Nikon Eclipse 50i fluorescence microscope with the appropriate filter.
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.