The role and regulatory mechanism of USP25 in pancreatic microcirculatory disturbance in severe acute pancreatitis.

SAP is characterized by marked pancreatic edema, bleeding, necrosis, and intense inflammatory infiltration. As expected, SAP rats exhibited significantly elevated serum amylase and lipase levels compared with the Sham group ( P  < 0.01, Fig.  1 A,B). Histopathological examination revealed extensive pancreatic tissue injury, including pronounced interstitial edema, hemorrhage, extensive inflammatory cell infiltration, widespread acinar cell necrosis, resulting in markedly higher pathological scores ( P  < 0.01, Fig.  1 C). USP25 expression was significantly upregulated in the pancreatic tissue of SAP rats ( P  < 0.01, Fig.  1 D,E). To further elucidate the functional role of USP25 in SAP, adenovirus-mediated knockdown was performed. Adenoviral delivery effectively reduced USP25 expression in pancreatic tissue ( P  < 0.01, Fig.  1 D-E). Notably, suppression of USP25 markedly ameliorated in SAP–related pathological manifestations, as evidenced by reduced serum amylase and lipase levels and improved histopathological scores ( P  < 0.01, Fig.  1 A–C). Fig. 1 Inhibition of USP25 improves symptoms in SAP rats. Adenovirus-packaged Ad-sh-USP25 was intravenously injected into rats, with Ad-sh-NC as the control. After 7 days, the rat model of SAP was established by injection of 3% sodium taurocholate. ( A , B ) Analysis of serum amylase and lipase activity using an automatic biochemical analyzer, n  = 12. ( C ) Observation and scoring of pancreatic tissue pathological changes using H&E staining, n  = 6. ( D , E ) Detection of USP25 expression in pancreatic tissue using qRT-PCR and Western blot, n  = 6. The data are presented as mean ± SD and analyzed by one-way ANOVA, followed by Tukey’s multiple comparisons test. Sham, sham group; SAP, model group; SAP + Ad-sh-NC, a SAP model was established by injecting 3% sodium taurocholate 7 days after injection of Ad-sh-NC via tail vein; SAP + Ad-sh-USP25, a SAP model was established by injecting 3% sodium taurocholate 7 days after injection of Ad-sh-USP25 via tail vein. Inhibition of USP25 improves symptoms in SAP rats. Adenovirus-packaged Ad-sh-USP25 was intravenously injected into rats, with Ad-sh-NC as the control. After 7 days, the rat model of SAP was established by injection of 3% sodium taurocholate. ( A , B ) Analysis of serum amylase and lipase activity using an automatic biochemical analyzer, n  = 12. ( C ) Observation and scoring of pancreatic tissue pathological changes using H&E staining, n  = 6. ( D , E ) Detection of USP25 expression in pancreatic tissue using qRT-PCR and Western blot, n  = 6. The data are presented as mean ± SD and analyzed by one-way ANOVA, followed by Tukey’s multiple comparisons test. Sham, sham group; SAP, model group; SAP + Ad-sh-NC, a SAP model was established by injecting 3% sodium taurocholate 7 days after injection of Ad-sh-NC via tail vein; SAP + Ad-sh-USP25, a SAP model was established by injecting 3% sodium taurocholate 7 days after injection of Ad-sh-USP25 via tail vein. Pancreatic microcirculatory disturbance is a hallmark of severe pancreatitis. Compared with the Sham group, SAP rats exhibited profound reductions in red blood cell flow, flow velocity, number of blood vessels, and number of functional microvessels ( P  < 0.01, Fig.  2 A), confirming severe microcirculatory impairment. SAP rats showed markedly elevated serum levels of Ang II, ET, and NO ( P  < 0.01, Fig.  2 B–D), consistent with endothelial dysfunction. Inflammatory cytokines TNF-α, IL-1β, and IL-6 were also significantly increased ( P  < 0.01, Fig.  2 E). Additionally, oxidative stress markers, including HIF-1α and MDA were significantly upregulated ( P  < 0.01, Fig.  2 F,G), while SOD activity was reduced ( P  < 0.01, Fig.  2 H). Following USP25 inhibition, all microcirculation-related parameters, inflammatory cytokines, and oxidative stress markers showed significant reversal toward baseline levels ( P  < 0.01, Fig.  2 A–H). These results demonstrate that inhibiting USP25 effectively attenuates pancreatic microcirculatory disturbance in SAP rats. Fig. 2 Inhibition of USP25 improves pancreatic microcirculatory disturbance in SAP rats. Adenovirus-packaged Ad-sh-USP25 was intravenously injected into rats, with Ad-sh-NC as the control. After 7 days, the rat model of SAP was established by injection of 3% sodium taurocholate. ( A ) Detection of pancreatic tissue microcirculation function after tail vein injection of FITC-RBC, including red blood cell flow rate, flow velocity, number of blood vessels, and number of functional blood vessels, n  = 6. ( B , C ) Detection of serum Ang II and ET using ELISA, n  = 12. ( D ) Detection of serum NO using nitrate reductase method, n  = 12. ( E ) Detection of serum TNF-α, IL-1β, and IL-6 using ELISA, n  = 12. ( F ) Detection of HIF-1α expression in pancreatic tissue using Western blot, n  = 6. ( G , H ) Detection of MDA and SOD in pancreatic tissue using kits, n  = 6. The data are presented as mean ± SD. The data in panels ( A – D , F – H ) were analyzed by one-way ANOVA, and data in panel E were analyzed by two-way ANOVA, followed by Tukey’s multiple comparisons test. Sham, sham group; SAP, model group; SAP + Ad-sh-NC, a SAP model was established by injecting 3% sodium taurocholate 7 days after injection of Ad-sh-NC via tail vein; SAP + Ad-sh-USP25, a SAP model was established by injecting 3% sodium taurocholate 7 days after injection of Ad-sh-USP25 via tail vein. Inhibition of USP25 improves pancreatic microcirculatory disturbance in SAP rats. Adenovirus-packaged Ad-sh-USP25 was intravenously injected into rats, with Ad-sh-NC as the control. After 7 days, the rat model of SAP was established by injection of 3% sodium taurocholate. ( A ) Detection of pancreatic tissue microcirculation function after tail vein injection of FITC-RBC, including red blood cell flow rate, flow velocity, number of blood vessels, and number of functional blood vessels, n  = 6. ( B , C ) Detection of serum Ang II and ET using ELISA, n  = 12. ( D ) Detection of serum NO using nitrate reductase method, n  = 12. ( E ) Detection of serum TNF-α, IL-1β, and IL-6 using ELISA, n  = 12. ( F ) Detection of HIF-1α expression in pancreatic tissue using Western blot, n  = 6. ( G , H ) Detection of MDA and SOD in pancreatic tissue using kits, n  = 6. The data are presented as mean ± SD. The data in panels ( A – D , F – H ) were analyzed by one-way ANOVA, and data in panel E were analyzed by two-way ANOVA, followed by Tukey’s multiple comparisons test. Sham, sham group; SAP, model group; SAP + Ad-sh-NC, a SAP model was established by injecting 3% sodium taurocholate 7 days after injection of Ad-sh-NC via tail vein; SAP + Ad-sh-USP25, a SAP model was established by injecting 3% sodium taurocholate 7 days after injection of Ad-sh-USP25 via tail vein. To further elucidate the cellular mechanism, we established a cell model of pancreatitis by treating immortalized rat pancreatic acinar cells (AR42J cells) with cerulein in vitro, and inhibited the expression of USP25 in cells ( P  < 0.01, Fig.  3 A-C). Cerulein treatment markedly increased USP25 expression ( P  < 0.01, Fig.  3 B-C), reduced cell viability ( P  < 0.01, Fig.  3 D), and increased cell death ( P  < 0.01, Fig.  3 E). USP25 knockdown efficiently reduced USP25 expression ( P  < 0.01, Fig.  3 A–C), significantly enhanced cell viability and lowered cell death rates ( P  < 0.01, Fig.  3 D,E). Moreover, suppression of USP25 markedly decreased cerulein-induced secretion of TNF-α, IL-1β, and IL-6 ( P  < 0.01, Fig.  3 F). Collectively, these findings suggest that USP25 inhibition protects pancreatic acinar cell from cerulein-induced injury by reducing inflammatory responses and cell death. Fig. 3 Inhibition of USP25 alleviates cerulein-induced pancreatic acinar cell injury in vitro. An in vitro model of pancreatitis was established by inducing rat pancreatic acinar AR42J cells with cerulein (10 nM), with an equal amount of PBS as a control (Blank). Subsequently, sh-USP25 was transfected into AR42J cells, with sh NC as a control. ( A ) Detection of transfection efficiency using qRT-PCR. ( B , C ) Detection of USP25 expression using qRT-PCR and Western blot. ( D ) Detection of cell viability using CCK-8 assay. ( E ) Detection of cell survival using Hoechst33342 and PI staining. ( F ) Detection of TNF-α, IL-1β, and IL-6 in cells using ELISA. Three biological replicates were conducted. The data are presented as mean ± SD. The data in panel A were analyzed by t test. The data in ( B – E ) were analyzed by one-way ANOVA, and data in ( F ) were analyzed by two-way ANOVA, followed by Tukey’s multiple comparisons test. Blank, PBS-treated AR42J cells; cerulein, 10 nM cerulein-induced model cells; cerulein + sh-NC, model cells transfected with sh-NC; cerulein + sh-USP25, model cells transfected with sh-USP25. Inhibition of USP25 alleviates cerulein-induced pancreatic acinar cell injury in vitro. An in vitro model of pancreatitis was established by inducing rat pancreatic acinar AR42J cells with cerulein (10 nM), with an equal amount of PBS as a control (Blank). Subsequently, sh-USP25 was transfected into AR42J cells, with sh NC as a control. ( A ) Detection of transfection efficiency using qRT-PCR. ( B , C ) Detection of USP25 expression using qRT-PCR and Western blot. ( D ) Detection of cell viability using CCK-8 assay. ( E ) Detection of cell survival using Hoechst33342 and PI staining. ( F ) Detection of TNF-α, IL-1β, and IL-6 in cells using ELISA. Three biological replicates were conducted. The data are presented as mean ± SD. The data in panel A were analyzed by t test. The data in ( B – E ) were analyzed by one-way ANOVA, and data in ( F ) were analyzed by two-way ANOVA, followed by Tukey’s multiple comparisons test. Blank, PBS-treated AR42J cells; cerulein, 10 nM cerulein-induced model cells; cerulein + sh-NC, model cells transfected with sh-NC; cerulein + sh-USP25, model cells transfected with sh-USP25. USP25 functions as a deubiquitinase that stabilizes target proteins by removing ubiquitination, while TRAF6 is known to be highly expressed in AP 29 . Prediction using the Ubibrowser database 30 indicated that USP25 is among the deubiquitinases capable of binding TRAF6 (Fig. 4 A). Co-immunoprecipitation further confirmed this interaction, demonstrating that USP25 physically associates with TRAF6 (Fig. 4 B). In both in vivo and in vitro SAP models, TRAF6 exhibited a reduced level of ubiquitination (represented by fewer smear-like bands), whereas inhibition of USP25 significantly increased TRAF6 ubiquitination (more scattered bands) (Fig. 4 C). TRAF6 protein abundance was markedly elevated in pancreatic tissue from SAP rats and cerulein-treated AR42J cells ( P < 0.01, Fig. 4 D,E). Suppression of USP25 significantly decreased TRAF6 protein levels ( P 0.05, Fig. 4 F). These findings indicate that USP25 stabilizes TRAF6 protein expression by preventing deubiquitination. Fig. 4 USP25 stabilizes TRAF6 protein expression through deubiquitination. ( A ) Online prediction of deubiquitinase binding to TRAF6 through the Ubibrowser database ( http://ubibrowser.bio-it.cn/ubibrowser_v3/ ). ( B ) Validation of the binding between USP25 and TRAF6 using Co-IP assay, with IgG as a negative control. ( C ) Detection of the ubiquitination level of TRAF6 in tissues ( n  = 6) and cells ( n  = 3) using Co-IP assay. ( D , E ) Detection of TRAF6 expression in tissues ( n  = 6) and cells ( n  = 3) using Western blot. ( F ) Detection of TRAF6 expression in tissues ( n  = 6) and cells ( n  = 3) using qRT-PCR. The data are presented as mean ± SD and analyzed by one-way ANOVA, followed by Tukey’s multiple comparisons test. Sham, sham group; SAP, model group; SAP + Ad-sh-NC, a SAP model was established by injecting 3% sodium taurocholate 7 days after injection of Ad-sh-NC via tail vein; SAP + Ad-sh-USP25, a SAP model was established by injecting 3% sodium taurocholate 7 days after injection of Ad-sh-USP25 via tail vein; Blank, PBS-treated AR42J cells; cerulein, 10 nM cerulein-induced model cells; cerulein + sh-NC, model cells transfected with sh-NC; cerulein + sh-USP25, model cells transfected with sh-USP25. USP25 stabilizes TRAF6 protein expression through deubiquitination. ( A ) Online prediction of deubiquitinase binding to TRAF6 through the Ubibrowser database ( http://ubibrowser.bio-it.cn/ubibrowser_v3/ ). ( B ) Validation of the binding between USP25 and TRAF6 using Co-IP assay, with IgG as a negative control. ( C ) Detection of the ubiquitination level of TRAF6 in tissues ( n  = 6) and cells ( n  = 3) using Co-IP assay. ( D , E ) Detection of TRAF6 expression in tissues ( n  = 6) and cells ( n  = 3) using Western blot. ( F ) Detection of TRAF6 expression in tissues ( n  = 6) and cells ( n  = 3) using qRT-PCR. The data are presented as mean ± SD and analyzed by one-way ANOVA, followed by Tukey’s multiple comparisons test. Sham, sham group; SAP, model group; SAP + Ad-sh-NC, a SAP model was established by injecting 3% sodium taurocholate 7 days after injection of Ad-sh-NC via tail vein; SAP + Ad-sh-USP25, a SAP model was established by injecting 3% sodium taurocholate 7 days after injection of Ad-sh-USP25 via tail vein; Blank, PBS-treated AR42J cells; cerulein, 10 nM cerulein-induced model cells; cerulein + sh-NC, model cells transfected with sh-NC; cerulein + sh-USP25, model cells transfected with sh-USP25. To further validate whether TRAF6 mediates USP25-dependent effects, TRAF6 was overexpressed in AR42J cells ( P  < 0.01, Fig.  5 A–C) and combined with USP25 silencing. Compared to USP25 alone, the combined TRAF6 overexpression significantly reduced cell viability ( P  < 0.01, Fig.  5 D), increased cell death ( P  < 0.01, Fig.  5 E), and elevated the levels of TNF-α, IL-1β, and IL-6 ( P  < 0.01, Fig.  5 F). The results demonstrate that TRAF6 overexpression counteracts the protective effects of USP25 inhibition on cerulein-induced pancreatic acinar cell injury. Fig. 5 Overexpression of TRAF6 partially offsets the improvement effect of USP25 inhibition on cerulein-induced pancreatic acinar cell injury. oe-TRAF6 was transfected into AR42J cells, with oe-NC as the control, followed by a combined treatment with sh-USP25. ( A ) Detection of transfection efficiency using qRT-PCR. ( B , C ) Detection of TRAF6 expression using qRT-PCR and Western blot. ( D ) Detection of cell viability using CCK-8 assay. ( E ) Detection of cell survival using Hoechst33342 and PI staining. ( F ) Detection of TNF-α, IL-1β, and IL-6 in cells using ELISA. Three biological replicates were conducted. The data are presented as mean ± SD. The data in ( A ) were analyzed by t test. The data in ( B , E ) were analyzed by one-way ANOVA, and data in ( F ) were analyzed by two-way ANOVA, followed by Tukey’s multiple comparisons test. cerulein + sh-USP25, model cells transfected with sh-USP25; cerulein + sh-USP25 + oe-NC, model cells transfected with sh-USP25 and oe-NC; cerulein + sh-USP25 + oe-TRAF6, model cells transfected with sh-USP25 and oe-TRAF6. Overexpression of TRAF6 partially offsets the improvement effect of USP25 inhibition on cerulein-induced pancreatic acinar cell injury. oe-TRAF6 was transfected into AR42J cells, with oe-NC as the control, followed by a combined treatment with sh-USP25. ( A ) Detection of transfection efficiency using qRT-PCR. ( B , C ) Detection of TRAF6 expression using qRT-PCR and Western blot. ( D ) Detection of cell viability using CCK-8 assay. ( E ) Detection of cell survival using Hoechst33342 and PI staining. ( F ) Detection of TNF-α, IL-1β, and IL-6 in cells using ELISA. Three biological replicates were conducted. The data are presented as mean ± SD. The data in ( A ) were analyzed by t test. The data in ( B , E ) were analyzed by one-way ANOVA, and data in ( F ) were analyzed by two-way ANOVA, followed by Tukey’s multiple comparisons test. cerulein + sh-USP25, model cells transfected with sh-USP25; cerulein + sh-USP25 + oe-NC, model cells transfected with sh-USP25 and oe-NC; cerulein + sh-USP25 + oe-TRAF6, model cells transfected with sh-USP25 and oe-TRAF6. We next overexpressed TRAF6 in SAP rats ( P  < 0.01, Fig.  6 A,B) and performed combined treatment with Ad-sh-USP25. Compared with USP25 inhibition alone, TRAF6 overexpression markedly increased serum amylase and lipase levels ( P  < 0.01, Fig.  6 C-D), intensified pancreatic tissue injury, elevated pathological scores ( P  < 0.01, Fig.  6 E). Microcirculatory parameters, including red blood cell flow, flow velocity, vessel count, and functional vessel number were further impaired ( P  < 0.01, Fig.  6 F-I), Serum inflammatory cytokines were significantly elevated ( P  < 0.01, Fig.  6 J). Additionally, TRAF6 overexpression increased HIF-1α and MDA levels in pancreatic tissues ( P  < 0.01, Fig.  6 B, K), while reducing SOD activity ( P  < 0.01, Fig.  6 L). Together, these findings indicate that TRAF6 overexpression partially abolishes the beneficial effects of USP25 inhibition on pancreatic microcirculatory disturbance in SAP rats. Fig. 6 Overexpression of TRAF6 partially abolishes the improvement effect of USP25 inhibition on pancreatic microcirculatory disturbance in SAP rats. Adenovirus-packaged Ad-oe-TRAF6 was injected into the tail vein of rats, with Ad-oe-NC as the control, followed by a combined treatment with Ad-sh-USP25. After 7 days, the rat model of SAP was established by injecting 3% sodium taurocholate. ( A ) Detection of TRAF6 expression in pancreatic tissue using qRT-PCR, n  = 6. ( B ) Detection of TRAF6 and HIF-1α expression in pancreatic tissue using Western blot, n  = 6. ( C , D ) Analysis of serum amylase and lipase activity using an automatic biochemical analyzer, n  = 12. ( E ) Observation and scoring of pancreatic tissue pathological changes using H&E staining, n  = 6. ( F ) Detection of pancreatic tissue microcirculation function after tail vein injection of FITC-RBC, including red blood cell flow rate, flow velocity, number of blood vessels, and number of functional blood vessels, n  = 6. ( G , H ) Detection of serum Ang II and ET using ELISA, n  = 12. ( I ) Detection of serum NO using nitrate reductase method, n  = 12. J: Detection of serum TNF-α, IL-1β, and IL-6 using ELISA, n  = 12. K-L: Detection of MDA and SOD in pancreatic tissue using kits, n  = 6. The data are presented as mean ± SD. The data in panels A, C-I, K-L were analyzed by one-way ANOVA, and data in panels B, J were analyzed by two-way ANOVA, followed by Tukey’s multiple comparisons test. SAP + Ad-sh-USP25, a SAP model was established by injecting 3% sodium taurocholate 7 days after injection of Ad-sh-USP25 via tail vein; SAP + Ad-sh-USP25 + Ad-oe-NC, a SAP model was established by injecting 3% sodium taurocholate 7 days after injection of Ad-sh-USP25 + Ad-oe-NC via tail vein; SAP + Ad-sh-USP25 + Ad-oe-TRAF6, a SAP model was established by injecting 3% sodium taurocholate 7 days after injection of Ad-sh-USP25 and Ad-oe-TRAF6. Overexpression of TRAF6 partially abolishes the improvement effect of USP25 inhibition on pancreatic microcirculatory disturbance in SAP rats. Adenovirus-packaged Ad-oe-TRAF6 was injected into the tail vein of rats, with Ad-oe-NC as the control, followed by a combined treatment with Ad-sh-USP25. After 7 days, the rat model of SAP was established by injecting 3% sodium taurocholate. ( A ) Detection of TRAF6 expression in pancreatic tissue using qRT-PCR, n  = 6. ( B ) Detection of TRAF6 and HIF-1α expression in pancreatic tissue using Western blot, n  = 6. ( C , D ) Analysis of serum amylase and lipase activity using an automatic biochemical analyzer, n  = 12. ( E ) Observation and scoring of pancreatic tissue pathological changes using H&E staining, n  = 6. ( F ) Detection of pancreatic tissue microcirculation function after tail vein injection of FITC-RBC, including red blood cell flow rate, flow velocity, number of blood vessels, and number of functional blood vessels, n  = 6. ( G , H ) Detection of serum Ang II and ET using ELISA, n  = 12. ( I ) Detection of serum NO using nitrate reductase method, n  = 12. J: Detection of serum TNF-α, IL-1β, and IL-6 using ELISA, n  = 12. K-L: Detection of MDA and SOD in pancreatic tissue using kits, n  = 6. The data are presented as mean ± SD. The data in panels A, C-I, K-L were analyzed by one-way ANOVA, and data in panels B, J were analyzed by two-way ANOVA, followed by Tukey’s multiple comparisons test. SAP + Ad-sh-USP25, a SAP model was established by injecting 3% sodium taurocholate 7 days after injection of Ad-sh-USP25 via tail vein; SAP + Ad-sh-USP25 + Ad-oe-NC, a SAP model was established by injecting 3% sodium taurocholate 7 days after injection of Ad-sh-USP25 + Ad-oe-NC via tail vein; SAP + Ad-sh-USP25 + Ad-oe-TRAF6, a SAP model was established by injecting 3% sodium taurocholate 7 days after injection of Ad-sh-USP25 and Ad-oe-TRAF6.

All animal experiment procedures were reviewed and approved by the Animal Ethics Committee of The Second Hospital of Shandong University and were conducted in strict accordance with the Guide for the Care and Use of Laboratory Animals 26 . The study is reported in compliance with ARRIVE guidelines. A total of 72 male SD rats (6–8 weeks old, weighing 180–220 g) were purchased from the Experimental Animal Center of Wuhan University. Rats were housed under natural light at a constant temperature of 25℃, relative humidity of 50%, and a noise level of < 60 dB. Cages were regularly cleaned, and animals had free access to water and food. The facility was maintained with 8–12 air changes per hour, ammonia concentration ≤ 20, and airflow of 10–25 cm/s. The SAP model was established based on a previously described method 5 . Rats were fasted for 12 h before surgery and allowed water for 4 h. After induction of anesthesia via intraperitoneal injection of 3% pentobarbital sodium (1 mL/kg), rats were placed on the operating table, and the abdominal hair was shaved. Following routine disinfection, a midline laparotomy was performed. The abdominal cavity was opened to expose the duodenal papilla, where the common bile duct and pancreatic duct converge into the duodenum. The proximal common bile duct was gently clamped using minimally invasive vascular forceps. The distal common bile duct was ligated with Prolene suture. A fine needle was inserted through the duodenal papilla into the proximal end of the duct. After correct placement, the distal duct was ligated, and 3% sodium taurocholate (1 mL/kg) was slowly injected retrogradely into the duct using an automatic micro pump. Successful model induction was confirmed when the pancreas became visibly infused with the sodium taurocholate-methylene blue mixture. The forceps were released, insertion point on the duodenum was sutured, and the abdomen was closed in layers. Sham-operated rats underwent the identical procedure except for the sodium taurocholate injection. After 3 days of routine feeding, rats were anesthetized with 3% pentobarbital sodium (1 mL/kg). The abdomen was reopened, and two blood samples (5 mL each) were collected from the abdominal aorta, one into an EDTA anticoagulant tube and one into a standard tube. Six rats per group were randomly selected for FITC-RBC in vivo imaging. All rats were subsequently euthanized by intraperitoneal injection of pentobarbital sodium (200 mg/kg) and pancreatic tissues were harvested. Part of each specimen was fixed in 10% neutral buffered formalin for 48 h for histological analysis, and the remaining tissues were stored at -80℃ for molecular studies. All animals reached the end point, and no animals were excluded during the experiment. Adenovirus-packaged sh-USP25 (Ad-sh-USP25), overexpression vector oe-TRAF6 (Ad-oe-TRAF6) and corresponding negative controls (Ad-sh-NC, Ad-oe-NC) were obtained from GenePharma (Shanghai, China). Viral vectors were administered via tail vein injection 7 days prior to SAP induction (5 × 10 9 pfu). Rats were numbered by body weight and randomly assigned (12 rats per group) into the following groups: Sham group, SAP group, SAP + Ad-sh-NC group, SAP + Ad-sh-USP25 group, SAP + Ad-sh-USP25 + Ad-oe-NC group, and SAP + Ad-sh-USP25 + Ad-oe-TRAF6 group. Pancreatic tissues were fixed overnight in 4% paraformaldehyde, dehydrated through an ethanol gradient, and embedded in paraffin. After sectioning, H&E staining was performed. Histological morphology was examined using an optical microscope (ZEISS, Jena GmbH). Pancreatic injury was scored independently blindly by two pathologists according to established criteria 27 , which included edema, inflammatory infiltration, and necrosis. The scoring system was as follows: edema: absent (0), local widening of the gap between lobules < 20% (1), extensive widening gap between lobules by 20%-50% (2), destruction and separation of acinar cells (3); inflammatory infiltration: absent (0), occurring in the ducts or around margins (1), occurring in the parenchyma ( 50% of the lobules) (3); necrosis: absent (0), necrosis around the ducts (< 5%) (1), focal necrosis of the parenchyma (5–20%) (2), extensive necrosis of the parenchyma (20%-50%). As described previously 5 , each rat received an intravenous injection of FITC-RBC (1.5 mL, hematocrit adjusted to 50%) via the tail vein. The pancreas was exteriorized and positioned on a transparent window of a perfusion box filled with physiological saline. After stabilization for 5 min, fluorescence microscopy imaging was performed using an Olympus X-70 microscope (Tokyo, Japan). Microcirculatory parameters, red blood cell flow, blood flow velocity, number of blood vessels, and number of functional blood vessels were quantified using the BI-2000 medical imaging microcirculation analysis system. The experiment was conducted by researchers who were blinded to the study grouping. Serum amylase and lipase were measured using an automated biochemical analyzer (Olympus, Tokyo, Japan) according to standard procedures. The levels of TNF-α (MBS175904, MyBiosource, San Diego, CA, USA), IL-1β (MBS3807738/MBS702717, MyBiosource), and IL-6 (MBS164245/ MBS2885203, MyBiosource) in serum or cell supernatant were quantified using ELISA kits (Jiancheng Bioengineering Institute, Nanjing, China). Malondialdehyde (MDA) (Jiancheng Bioengineering Institute) and superoxide dismutase (SOD) (Jiancheng Bioengineering Institute) in pancreatic tissues were determined using the corresponding commercial assay kits from the same manufacturer. Serum levels of the vasoconstrictor ET (MBS727124, MyBiosource) and the angiogenesis marker angiotensin II (MBS705139, MyBiosource) were measured using ELISA. Serum NO content was determined using the nitrate reductase method (NO assay kit, Jiancheng Bioengineering Institute). All kits were commercially sourced, and experimental procedures strictly followed the manufacturers’ protocols. Rat pancreatic acinar AR42J cells (ATCC, Rockville, MD, USA) were cultured in F12K medium supplemented with 20% FBS, 100 U/mL penicillin and 100 mg/mL streptomycin under standard conditions (37℃, 5% CO 2 ). A pancreatitis cell model 28 was established by stimulating cells with cerulein (10 nM), while PBS-treated cells served as the Blank control group. shRNA targeting USP25 (sh-USP25), the TRAF6 overexpression vector (oe-TRAF6), and their respective negative controls (sh-NC, oe-NC) were obtained from GenePharma. AR42J cells were transfected with 20 nM shRNA or 10 µg plasmid using Lipofectamine 3000 (Thermo Fisher Scientific, Waltham, MA, USA). After 48 h, transfection efficiency was evaluated using qRT-PCR. Cell viability was assessed using the CCK-8 assay. AR42J cells (6 × 10 3 ) were seeded into 96-well plates and incubated overnight. After 24 h, 10 µL of CCK-8 solution (Beyotime, Shanghai, China) was added to each well and the plates were incubated for an additional 4 h at 37℃. Absorbance at 450 nm was measured using a microplate reader (Thermo Scientific). Three independent biological replicates were performed. Cells subjected to different treatments were stained with Hoechst33342 (50 µg/mL) and PI (1 µM). Fluorescent images were captured using a fluorescence microscope (ZEISS A2/AX10 cam HRC). The percentage of dead cells (PI-positive) was calculated relative to the total number of cells, with a minimum of 1000 cells per condition. Three biological replicates were indicated. The experiment was conducted by researchers who were blinded to the study grouping. Cells were lysed in IP lysis buffer (Pierce Biotechnology, Waltham, MA, USA), and protein concentration was determined using the bicinchoninic acid method (Invitrogen, Carlsbad, CA, USA). Equal protein amounts were incubated with primary antibodies against USP25 (1:5012199-1-AP, Proteintech, Rosemont, IL, USA), TRAF6 (1:200, ab137452, Abcam, Cambridge, MA, USA), or negative control IgG (1:200, ab205720, Abcam) followed by incubation with protein A agarose beads (Pierce Biotechnology) at 4℃ overnight. After washing, samples were subjected to SDS-PAGE, and Western blotting was performed to detect TRAF6 (1:1000, ab137452, Abcam) or anti-ubiquitin antibodies (1:2000, ab134953, Abcam). Three biological replicates were conducted. Total RNA was isolated from tissues or cells using TRIzol ® reagent (Takara, Japan). Reverse transcription of 2 µg RNA was performed using the RT First Strand cDNA Synthesis Kit (Servicebio, Wuhan, China) with oligo (dT) primers. qRT-PCR system was carried out using SYBR Green PCR Mix (Servicebio) on an Applied Biosystems system (Table  1 ). Gene expression levels were normalized to GAPDH, and relative expression was calculated using the 2-ΔΔCt method. Table 1 PCR primer sequences. Name Sequence (5’-3’) USP25 F: TTTTGCCCTTGTTGCTGGTG R: TTGGCAGAAAATCCGTCAGC TRAF6 F: TCTGCTTGATGGCTTTACGG R: ACTTGGTGATGCAGGCTTTG GAPDH F: ATGCCCCCATGTTTGTGATG R: TCCACGATGCCAAAGTTGTC Note: USP25: ubiquitin specific peptidase 25; TRAF6: TNF receptor associated factor 6; GAPDH: glyceraldehyde-3-phosphate dehydrogenase. PCR primer sequences. Note: USP25: ubiquitin specific peptidase 25; TRAF6: TNF receptor associated factor 6; GAPDH: glyceraldehyde-3-phosphate dehydrogenase. Total protein was extracted from cells using radio-immunoprecipitation assay, and protein concentrations were quantified using a bicinchoninic acid assay kit (Beyotime). Equal amounts of protein were separated by SDS-PAGE and transferred onto polyvinylidene fluoride membranes (Millipore, Billerica, MA, USA). Membranes were blocked with 5% BSA (Beyotime) and incubated overnight at 4℃ with the following primary antibodies: USP25 (1:1000, 12199-1-AP, Proteintech), TRAF6 (1:1000, ab137452, Abcam), HIF-1α (1:1000, ab179483, Abcam), and β-actin (1:2500, ab8227, Abcam). After washing, membranes were incubated with the secondary antibody IgG (1:2000, ab6721, Abcam) at room temperature for 1 h. Protein bands were visualized using an enhanced chemiluminescence assay kit (Bio-rad, Hercules, CA, USA), band intensities were quantified and normalized to β-actin. All statistical analyses and figure generation were performed using SPSS 21.0 (IBM Corp., Armonk, NY, USA) and GraphPad Prism 8.0 (GraphPad Software Inc., San Diego, CA, USA). Data were assessed for normal distribution and homogeneity of variance prior to analysis. Differences between two groups were evaluated using an unpaired two-tailed t test. Comparisons among multiple groups were analyzed using one-way or two-way analysis of variance (ANOVA) followed by Tukey’s multiple comparison test. Data are presented as mean ± standard deviation (SD), and P   0.9.

SAP carries high mortality, primarily due to pancreatic and extra-pancreatic necrosis, subsequent infection, and multi-organ failure 31 . Accumulating evidence highlights pancreatic microcirculatory disturbance as a central pathogenic driver of SAP 5 . In this study, we demonstrated that USP25 expression is markedly elevated in SAP and that USP25 aggravates pancreatic microcirculatory disturbance by stabilizing TRAF6 via deubiquitination (Fig. 7 ). Fig. 7 SAP promotes the expression of USP25, which in turn elevates the protein expression of TRAF6 through deubiquitination, thus exacerbating pancreatic acinar cell death and causing pancreatic microcirculatory disturbance. Inhibition of USP25 can promote the ubiquitination degradation of TRAF6, inhibit pancreatic acinar cell death, and alleviate pancreatic microcirculatory disturbance caused by pancreatitis. The material in the figure is from the public material library SMART ( https://smart.servier.com/ ). SAP promotes the expression of USP25, which in turn elevates the protein expression of TRAF6 through deubiquitination, thus exacerbating pancreatic acinar cell death and causing pancreatic microcirculatory disturbance. Inhibition of USP25 can promote the ubiquitination degradation of TRAF6, inhibit pancreatic acinar cell death, and alleviate pancreatic microcirculatory disturbance caused by pancreatitis. The material in the figure is from the public material library SMART ( https://smart.servier.com/ ). Ubiquitination is a highly orchestrated post-translational modification essential for diverse physiological processes, including cell survival, differentiation, and immune homeostasis 32 . Within inflammatory responses, ubiquitination dynamically regulates inflammasome activation by manipulating protein stability, complex formation, or receptor activity 33 , and also modulates multiple programmed cell death pathways 34 . USP25, a deubiquitinase, stabilizes KLF4 expression and promotes acinar cell pyroptosis in AP 13 . It also exacerbates AP and AP-associated multi-organ injury by enhancing pro-inflammatory cytokine release and disputing pancreatic tight junction integrity 12 . Despite these insights, the role of USP25 in SAP-induced microcirculatory disturbance remains elusive. Pancreatic microcirculation is essential for maintaining tissue homeostasis and its disruption is a hallmark of SAP 4 . In this study, we applied sodium taurocholate-induced SAP model. We found that USP25 expression was significantly increased in pancreatic tissues of SAP rats, and inhibition of USP25 not only alleviated SAP severity but also mitigated pancreatic microcirculatory disturbance. It is worth noting that although the sodium taurocholate-induced SAP model is widely used, it primarily reflects biliary SAP. Thus, caution is required when extrapolating our findings to other SAP etiologies such as hyperlipidemia or alcohol. To further dissect the mechanism, we used cerulein-treated AR42J pancreatic acinar cells as an in vitro model of SAP. SAP is characterized by acinar cell death and sustained inflammation 35 . The mode of cell death including necrosis, apoptosis, autophagy, necroptosis or pyroptosis, critically influences disease severity 36 , but distinguishing these forms is complex due to dynamic pathway switching 37 . Therefore, we focused on assessing overall acinar cell viability. Our results showed that USP25 inhibition increased cell viability and reduced inflammatory cytokine (TNF-α, IL-1β, and IL-6) secretion, indicating the protective effects of USP25 inhibition against cerulein-induced acinar cell injury. Mechanistically, previous literature has reported that USP25 interacts with TRAF6 and inhibits its K63 polyubiquitination 25 . TRAF6, a central adaptor in TLR signaling, orchestrates inflammatory responses in both acute or chronic settings 38 . In AP mouse models, TLR4-TRAF6 activity correlates with inflammation severity 39 . Hence, we inferred that USP25 stabilizes TRAF6 protein expression by deubiquitination. Through Ubibrowser prediction and co-immunoprecipitation assay, we confirmed the direct interaction between USP25 and TRAF6. Our experimental results revealed an upregulation of TRAF6 expression in SAP pancreatic tissues and cerulein-treated cells, but a downregulation of TRAF6 ubiquitination level. Functional inhibition of USP25 further supported a post-translational regulatory mechanism between USP25 and TRAF6. TRAF6 activates NF-κB to drive pro-inflammatory cytokine release and exacerbate SAP 21 . TRAF6 inhibitors ameliorate pancreatic and intestinal injury through suppression of TLR4/NF-κB signaling 22 , and that TRAF6 inhibition reduces pyroptosis in pancreatic acinar cells 20 , 40 . Consistently, our rescue experimental results demonstrated that TRAF6 overexpression abolished the protective effects of USP25 inhibition on pancreatic microcirculatory disturbance in vivo and cerulein-induced acinar cell injury in vitro. Collectively, this study demonstrates that USP25 stabilizes TRAF6 protein expression through deubiquitination and thus exacerbates pancreatic microcirculatory disturbance in SAP. However, several limitations warrant discussion. Firstly, only the sodium taurocholate SAP model was used. Since SAP has heterogenous etiologies, future studies will incorporate L-arginine and caerulein + LPS models to enhance generalizability. Secondly, AR42J cells are an immortalized rat acinar cell line with limited clinical relevance; validation in human primary pancreatic acinar cells or pancreatic organoid models is necessary. Thirdly, Hoechst33342/PI dual-staining cannot clearly distinguish pyroptosis from apoptosis and necrosis; thus, our assessment represents combined cell death outcomes. Fourthly, NF-κB activation is not experimentally assessed, and TRAF6 ubiquitination is examined globally, without distinguishing between K63- and K48-linked chains. Therefore, our conclusions regarding downstream signaling are based on prior literature rather than direct experimental evidence. Moreover, no functional inhibition of TRAF6 downstream signaling pathways is included. UPS25-mediated deubiquitination is not exclusive to TRAF6, and other deubiquitinases may regulate TRAF6. Last but not least, the work remains preclinical; clinical samples and patient data are needed for translational confirmation. In summary, this study supports a role of USP25–TRAF6 in SAP-associated pancreatic microcirculatory disturbance and provides mechanistic insights into the development of targeted therapeutic strategies.

Acute pancreatitis (AP) is a common inflammatory disorder of the pancreas, and a substantial proportion of patients progress to severe acute pancreatitis (SAP), one of the most lethal acute abdominal conditions with markedly high mortality rates 1 . Owing to the absence of definitive therapies, SAP management remains challenging and relies primarily on supportive interventions, including fluid resuscitation, nutritional support, and analgesia 2 , 3 . Microcirculatory disturbance, recognised as a major driver of parenchymal necrosis, has been acknowledged as a critical pathological event in SAP progression 4 . The resultant reduction in local perfusion promotes pancreatic acinar cell necrosis and exacerbates pancreatic injury 4 , 5 . Thus, therapeutic strategies aimed at improving microcirculatory disturbance may offer clinical benefit in SAP. Ubiquitination is a dynamic and reversible post-translational modification regulated by deubiquitinases, which counteract ubiquitin chain formation by removing ubiquitin chain moieties from target proteins 6 . This ubiquitination/deubiquitination system modulates key pathological processes such as excessive inflammation, regulated cell death, and oxidative stress injury 7 . USP25, a deubiquitinating enzyme (DUB) that stabilizes proteins by preventing their proteasomal degradation 8 , has emerged as an important regulator of immunity, inflammation and tumorigenesis 9 – 11 . Clinically, USP25 serum levels are significantly elevated in AP patients and correlate positively with disease severity 12 . Experimental studies demonstrate that USP25 expression is increased in AP models, and USP25 knockdown enhances acinar cell viability and suppresses pyroptosis 13 . USP25 can also potentiate inflammatory signaling by stabilizing the histone acetyltransferase HBO1, thereby promoting HBO1-mediated transcription of inflammatory genes 14 . Given that NF-κB activation occurs within minutes of SAP onset and is central to disease pathology 15 , the ability of USP25 deficiency to activate the TBK1-NF-κB axis and drive inflammatory cytokine production in macrophages further highlights its importance 16 . Despite these findings, how USP25 contributes to pancreatic microcirculatory disturbance in SAP remains largely unknown. Tumor necrosis factor receptor (TNFR)-associated factors (TRAFs) constitute a conserved family of cytoplasmic adaptor proteins that orchestrate immune and inflammatory signaling 17 . Among them, TRAF6 uniquely mediates downstream signaling of both the TNFR superfamily and the interleukin-1 receptor (IL-1R)/TLR superfamily, regulating ubiquitination, autophagy, and inflammatory activation primarily via TLR4 pathways 18 . TRAF6 activates NF-κB to promote pro-inflammatory cytokine production and initiate inflammatory cascades 19 . TRAF6 is highly upregulated in cerulein-induced hyperlipidemic AP model 20 , and genetic or pharmacological inhibition of TRAF6 attenuates pancreatic injury while suppressing NLRP3-mediated pyroptosis 20 . Excessive TRAF6 expression facilitates NF-κB nuclear translocation, amplifying cytokine production and driving SAP progression 21 . TRAF6 inhibition significantly reduces pancreatic and intestinal injury in AP models through suppression of TLR4/NF-κB signaling, thereby preventing microcirculatory and barrier dysfunction 22 , 23 . Collectively, these findings support TRAF6 as a potential inflammatory mediator of pancreatic microcirculatory disturbance in SAP. USP25 has been shown to deubiquitinate and stabilise TRAF6, thereby regulating TRAF6-mediated inflammatory responses 24 , 25 . The present study aims to determine the mechanism by which USP25-mediated deubiquitination of TRAF6 contributes to pancreatic microcirculatory disturbance in SAP. To our knowledge, this is among the first studies to reveal a disease specific USP25-TRAF6-microcirculatory disturbance axis that drives SAP pathology. This provides mechanistic insights and potential therapeutic targets with significant conceptual relevance for SAP treatment.

Below is the link to the electronic supplementary material. Supplementary Material 1 Supplementary Material 1