Exosomes derived from mesenchymal stem cells repair ovarian function by suppressing NLRP3-mediated pyroptosis in cyclophosphamide-induced premature ovarian failure

Background Premature ovarian failure (POF) is a debilitating condition impairing fertility and health in women. Mesenchymal stem cell-derived exosomes (MSC-EVs) have emerged as a promising therapeutic option for POF due to their regenerative capabilities. This study explores the effectiveness of human umbilical cord mesenchymal stem cell-derived exosomes (HuMSCs-Exos) in counteracting NLRP3-mediated pyroptosis and restoring ovarian function in a cyclophosphamide (CTX)-induced POF model.

HuMSCs-Exos were characterized using transmission electron microscopy (TEM), nanoparticle tracking analysis (NTA), and western blot for exosomal markers. A CTX-induced POF mouse model was treated with HuMSCs-Exos to assess their impact on ovarian morphology, function, and fertility. Additionally, in vitro studies on granulosa cells (GCs) evaluated the effects of HuMSCs-Exos on cell viability, apoptosis, oxidative stress, and NLRP3 inflammasome pathway components.

In the CTX-induced POF model, HuMSCs-Exos treatment significantly improved ovarian structure, increased follicle counts, restored estrous cycles, and enhanced fertility outcomes. Hormonal balance was also achieved, with a notable reduction in NLRP3 inflammasome activation and oxidative stress markers. In vitro, HuMSCs-Exos promoted GCs viability and reduced apoptosis and oxidative damage, further inhibiting the NLRP3 inflammasome pathway.

HuMSCs-Exos effectively mitigate CTX-induced POF through the suppression of NLRP3-mediated pyroptosis, enhancing ovarian function and fertility. This study underscores the potential of MSC-EV-based therapies for treating POF and possibly other inflammatory and degenerative reproductive disorders.

Premature ovarian failure (POF), Human umbilical cord mesenchymal stem cells (HuMSCs), Exosomes, NLRP3 inflammasome, Cyclophosphamide (CTX) Exosomes derived from mesenchymal stem cells repair ovarian function by suppressing NLRP3-mediated pyroptosis in cyclophosphamide-induced premature ovarian failure Xiangrong Cui1, Huihui Li1, Xia Huang2, Tingting Xue2, Shu Wang2, Xinyu Zhu2 and Xuan Jing2* Page 2 of 13 Cui et al. Journal of Ovarian Research (2025) 18:216

Premature ovarian failure (POF) represents a significant clinical challenge characterized by the loss of normal ovarian function before the age of 40 [ 1, 2]. It is a mul - tifactorial syndrome that leads to infertility, decreased estrogen levels, and various health complications, includ- ing osteoporosis and cardiovascular disease [ 3, 4]. The etiology of POF is complex, involving genetic, autoim - mune, and iatrogenic factors, among others [5– 7]. Cyclo- phosphamide (CTX), a chemotherapeutic agent, has been known to induce POF, highlighting the need for effective therapeutic strategies to mitigate this adverse effect and restore ovarian function [1]. Mesenchymal stem cells (MSCs), with their potent regenerative and immunomodulatory properties, have been at the forefront of regenerative medicine research [1, 8– 10]. MSCs can differentiate into a variety of cell types and secrete bioactive molecules that promote tis - sue repair and modulate inflammatory responses [ 8]. Among the therapeutic entities secreted by MSCs, exo - somes, small extracellular vesicles, have garnered signifi - cant attention [ 7, 11]. These vesicles carry nucleic acids, proteins, and lipids, mediating intercellular communica - tion and facilitating the regenerative processes [ 12, 13]. Human umbilical cord mesenchymal stem cells (HuM - SCs) are particularly appealing due to their abundance, non-invasive collection, and low immunogenicity, mak - ing them an ideal source of therapeutic exosomes [1, 14]. Recent studies have elucidated the role of the NLRP3 inflammasome in the pathogenesis of various inflamma - tory and degenerative diseases, including POF [ 15, 16]. The NLRP3 inflammasome, a multiprotein complex, plays a critical role in the activation of inflammatory responses and pyroptosis, a form of programmed cell death associated with inflammation [ 17, 18]. In the con - text of POF, NLRP3-mediated pyroptosis contributes to follicular atresia and ovarian dysfunction, suggesting that targeting NLRP3 inflammasome activation could be a viable therapeutic strategy. Against this backdrop, the present study aims to inves - tigate the therapeutic potential of HuMSC-derived exo - somes (HuMSCs-Exos) in a CTX-induced POF model. We hypothesize that HuMSCs-Exos can ameliorate CTX- induced ovarian damage by suppressing NLRP3-medi - ated pyroptosis, thereby restoring ovarian function and fertility. Through a combination of in vivo and in vitro experiments, this study explores the effects of HuM - SCs-Exos on ovarian morphology, function, hormonal balance, and the NLRP3 inflammasome pathway. By elucidating the mechanisms underlying the regenerative effects of HuMSCs-Exos, this research contributes to the development of MSC-EV-based therapies for POF and potentially other inflammatory and degenerative repro - ductive disorders.

Laboratory animals and POF model establishment Female C57BL/6J mouse ( n = 36, 5 weeks old) were obtained from Shanxi Medical University’s Experimental Animal Center, with all procedures approved by its Medi- cal Ethics Committee and in accordance with National Institutes of Health of China guidelines. Mouse were acclimatized for a week in conditions of 22 ± 2  °C and a 12-hour light/dark cycle, with free access to food and water. Post-acclimatization, mouse weighing 18 ± 2  g were divided into control ( n = 9) and POF model groups (n = 27). The POF model was induced using cyclophos - phamide (CTX): 50 mg/kg on day one, followed by 8 mg/ kg for 14 days, while controls received saline. Post-induc- tion, the POF group was subdivided into POF ( n = 9), saline-treated POF (POF + NC, n = 9), and exosome- treated POF (POF + Exosomes, n = 9). MSC-EVs were administered via intraperitoneal injection at a dose of 100 µg in 200 µL PBS per mouse. The injection was per - formed once every three days for a total of 28 days start - ing immediately after POF induction. Euthanasia was performed after 21 days via CO 2 asphyxiation for hormone analysis and ovarian function assessment, including ovarian coefficient and volume cal- culations, and fertility evaluation through mating trials. Histology analysis and follicle counting Ovarian tissues were fixed in 4% paraformaldehyde (PFA) for 24 h, followed by dehydration in an ascending ethanol series and paraffin embedding. Sections of 5  μm thick - ness were cut using a microtome and every fifth sec - tion was stained with Hematoxylin and Eosin (H&E) for examination under light microscopy. Follicles were cat - egorized into primordial, primary, secondary, antral, and atretic based on established criteria [ 19– 23], as follows: primordial follicles were identified as oocytes surrounded by a single layer of flattened squamous granulosa cells; primary follicles were defined as oocytes enclosed by a single layer of cuboidal granulosa cells; secondary fol - licles contained oocytes surrounded by two or more lay - ers of cuboidal granulosa cells, without an antral cavity; antral follicles were characterized by the presence of a clearly visible antral cavity; atretic follicles were identi - fied by morphological signs of degeneration, including pyknotic granulosa cells, shrunken oocytes, and dis - rupted follicular structure. To estimate the total follicle count, the number of primordial follicles was counted on every fifth section and multiplied by. This approach was similarly applied for atretic, preantral, and antral follicle counts. The entire process aimed to minimize observer bias and ensure accurate assessment of ovarian morphol - ogy and follicular status. Page 3 of 13 Cui et al. Journal of Ovarian Research (2025) 18:216 Estrous cycle characterization Vaginal smears from mice were collected daily over 10 days, stained with alkaline methylene blue, and examined under a light microscope to distinguish the estrous cycle stages: proestrus, estrus, metestrus, and diestrus, based on cell types [ 24]. The cycle’s phases were identified by the presence of nucleated epithelial cells, keratinized cells, and leukocytes in varying proportions. Trypan Blue staining of vaginal secretions was used for daily detection of the cycle phase, particularly identifying diestrus. MSC-EVs isolation and identification HuMSCs were cultured in accordance with previ - ously established protocols [ 11] and ethical guidelines approved by Shanxi Medical University. Briefly, HuM - SCs were maintained in a suitable complete medium until they reached 70–80% confluence. Subsequently, the medium was replaced with serum-free medium to promote EV secretion. To isolate MSC-derived EVs, the cell culture supernatant was subjected to a series of centrifugation steps to remove cellular debris and non-specifically secreted factors. This was followed by ultracentrifugation at 100,000×g to pellet the EVs. The isolated EVs were then characterized for size and con - centration using nanoparticle tracking analysis (NTA). Morphological assessment was performed via transmis - sion electron microscopy (TEM), while the presence of EV markers CD81, CD63, and HSP70 was confirmed by Western blotting. The final MSC-derived EVs were stored at -80 °C for subsequent analyses. Enzyme-linked immunosorbent assay (ELISA) Serum levels of Anti-Müllerian Hormone (AMH), Fol - licle-Stimulating Hormone (FSH), Estradiol (E2), and Luteinizing Hormone (LH), as well as the concentrations of interleukin-1 beta (IL-1β) and interleukin-18 (IL-18) in cell supernatants, were determined using commer - cial ELISA kits (Elabscience, Wuhan, China), following the manufacturer’s instructions. Briefly, serum samples were diluted 10-fold and added to 96-well plates pre- coated with corresponding antibodies, followed by a 2-hour incubation period. The optical density (OD) was measured using a microplate reader at a wavelength of 450 nm to determine the hormone concentrations in the serum. The concentrations were then calculated based on standard curves. TUNEL assay for apoptosis detection In the study, the TUNEL assay was employed to detect apoptosis in both ovarian tissue sections and cultured granulosa cells. The procedure for ovarian tissue involved deparaffinization, rehydration, and permeabilization using 50 µg/ml Proteinase K for 30 min, followed by incu- bation with the TUNEL reaction mixture for 2  h in the dark. The sections were then washed, stained with DAPI for 5 min to label all nuclei, and mounted with an anti- fade medium for fluorescence microscopy analysis using specific filters for DAPI and FITC. For cultured granulosa cells, the preparation included washing with PBS, fixation with 4% paraformaldehyde for 15 min, and permeabiliza - tion with 0.5% Triton X-100 for 5 min. Similar to tissue staining, cells were treated with the TUNEL mixture for 1.5 h at 37 °C in a humidified chamber, followed by DAPI staining and mounting. Fluorescence microscopy enabled the identification and quantification of apoptotic cells (TUNEL-positive, green or red) in contrast to all nuclei (DAPI-stained, blue), providing insights into the extent of apoptosis in the context of ovarian function and granu - losa cell viability. Ovarian tissue immunofluorescence Ovarian tissues were collected and fixed in 4% para - formaldehyde (PFA) for formalin fixation, followed by dehydration in 30% sucrose at 4  °C. The tissues were then sectioned into 20  μm slices. To block non-specific binding, sections were incubated with 5% bovine serum albumin (BSA) at room temperature (20–25 ℃) for 1  h. Subsequently, the sections were incubated with primary antibodies: DDX4 (51042-1-AP , 1:2000; Proteintech) and PCNA (AF0239, 1:2000; Affinity) to target specific pro - teins of interest. After primary antibody incubation, the sections were exposed to a FITC-conjugated second - ary antibody (ab150077, 1:100; Abcam) for visualiza - tion. Nuclei were stained with DAPI to highlight cellular nuclei. Finally, the sections were sealed with an anti-fade solution and observed and analyzed using a confocal sys - tem (Nikon) to examine the localization and expression of the targeted proteins within the ovarian tissue. Western blot analysis For Western blot analysis, proteins were extracted from ovarian tissues, granulosa cells, and extracellular vesicles using RIPA buffer with inhibitors (KeyGEN BioTECH). Protein levels were measured with the BCA Kit (Sigma- Aldrich, Merck KGaA), and 30 µg of protein were sepa - rated on a 10% SDS-PAGE gel and transferred to PVDF membranes (Merck Millipore). Membranes were blocked with 5% BSA for 1  h, then incubated overnight at 4  °C with primary antibodies: NLRP3, Caspase-1, IL-1β, IL-18 (1:1000), GAPDH, β-actin (1:5000) from Abcam; CYP19A1 (1/500, Bioss); AMH (1/1000, ABclonal); FSHR (1/1000, Proteintech); Bcl-2 (1/500), Bax (1/1000) from Affinity. This ensured specific protein detection. After primary antibody incubation, membranes were washed with TBST, incubated with HRP-conjugated secondary antibodies for 1.5 h, and visualized using an ECL kit (Mil- lipore) and Image J software (Bio-Rad). This streamlined protocol allows for accurate protein identification and Page 4 of 13 Cui et al. Journal of Ovarian Research (2025) 18:216 quantification, providing insights into ovarian biology and disorders. Fluorescence quantitative PCR Total RNA was isolated from mouse ovarian tissues and granulosa cells using TRIzol reagent (Termo Fisher), and cDNA was synthesized using the PrimeScript RT reagent Kit (Takara). The expression levels of the genes DDX4, PCNA, IL-1β, IL-18, Caspase-1, and NLRP3 were quanti - fied by fluorescence quantitative PCR (FQ-PCR) employ - ing SYBR Premix Ex Taq (Bao Biological Engineering, Dalian, China) on a CFX-96 Real-Time PCR Detection System (BIO-RAD) (Table  1). PCR conditions included an initial denaturation, followed by 40 cycles of denatur - ation and annealing/extension, with a final melting curve analysis to ensure specificity. Gene expression was ana - lyzed using the 2 −ΔΔCt method, with results normalized to an internal control and expressed as mean values from triplicate experiments. Cell culture and treatment The human granulosa cell tumor cell line KGN, obtained from Procell Life Science & Technology (China), was cultured in DMEM/F12 medium (KeyGEN BioTECH, China) supplemented with 10% fetal bovine serum (ExCell Bio, China) and 1% penicillin-streptomycin (New Cell & Molecular Biotech, China). The cells were main - tained in a humidified incubator at 37  °C with 5% CO 2. For the treatments, granulosa cells (GCs) were exposed to 500µM cyclophosphamide (CTX) and subsequently divided into four groups: Control, Model, Model + NC, and Model + Exosomes. Following these treatments, GCs were collected for further experimental analyses. Cell viability assay Cell viability was assessed using a Cell Counting Kit-8 (CCK-8, APExBIO Technology, USA) following the man- ufacturer’s protocol. GCs were seeded at 8,000 cells/well in 96-well plates for 24  h. Post 48-hour co-culture with CTX or HuMSCs-Exos, 10% CCK-8 reagent was added, followed by a 2-hour incubation. Optical density (OD) was measured at 450 nm using a microplate reader. The assay was performed in triplicate, and the mean OD from three independent experiments was used to evaluate cell viability under different conditions. Assessment of oxidative stress Oxidative stress was assessed by quantifying malondi - aldehyde (MDA), superoxide dismutase (SOD), lactate dehydrogenase (LDH) and glutathione peroxidase (GSH) using specific assay kits (Nanjing Jiancheng Bioengineer - ing Institute, Nanjing, China), following the manufac - turer’s protocols. Ovarian tissue homogenates and cell culture supernatants were centrifuged to obtain clear samples for analysis. The absorbance for each marker was measured with a microplate reader at kit-specified wavelengths. Concentrations of MDA and LDH were reported in nM/mg and U/L, while SOD and GSH activi - ties were expressed in U/mg protein and µM/mg protein, respectively. Statistical analysis Statistical evaluations of the data were performed uti - lizing GraphPad Prism 9.0 (GraphPad Software, USA). The results are expressed as mean ± standard error of the mean (SEM). To determine the statistical significance among groups, data were subjected to either one-way analysis of variance (ANOVA), contingent upon the data distribution and homogeneity of variance. Each experi - mental condition was replicated a minimum of three times to ensure reliability of the findings. A P-value < 0.05 was considered to denote statistical significance.

Characterization of HuMSCs-Exos To investigate the therapeutic potential of MSC-EVs for POF we isolated MSC-EVs from the supernatant of human umbilical cord mesenchymal stem cells (HuM - SCs). Characterization techniques including transmission electron microscopy (TEM), nanoparticle tracking analy - sis (NTA) with high-sensitivity flow cytometry, and west- ern blot analysis were employed. TEM images showed the MSC-EVs as round, bilayered vesicles (Fig.  1A), with exosomal markers CD81, Hsp70, and CD63 confirmed via western blot (Fig.  1C). NTA revealed a size range of 30–150  nm and a concentration of 2.1 × 10^10 par - ticles/ml (Fig.  1B). This characterization confirms the Table 1 Sequences of primers used for fluorescence quantitative PCR in this study Gene Primer sequence (forward) Primer sequence (reverse) DDX4 GAGAACACATCTACAACTGGTGG CCTCGCTTGGAAAACCCTCT PCNA CCTCGCTTGGAAAACCCTCT GGTGAACAGGCTCATTCATCTCT IL-1β CGAAGACTACAGTTCTGCCATT GACGTTTCAGAGGTTCTCAGAG IL-18 GAAGTGATAGCAGTCCCA AGCTAAAATCAGCAAAGTGTC NLRP3 ATTACCCGCCCGAGAAAGG CATGAGTGTGGCTAGATCCAAG Caspase-1 TGCCCAGAGCACAAGACTTC TCCTTGTTTCTCTCCACGGC GAPDH AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA Page 5 of 13 Cui et al. Journal of Ovarian Research (2025) 18:216 MSC-EVs’ identity and supports further exploration of their therapeutic effects on POF. HuMSCs-Exos restored ovarian morphology and structure in CTX-induced POF mice To evaluate the therapeutic effects of HuMSCs-Exos on POF in mice, we meticulously assessed ovarian morphol - ogy and structure following the administration of HuM - SCs-Exos. The experimental design for animal treatment is illustrated in Fig.  2A. The POF model was established by administering cyclophosphamide (CTX) at a dos - age of 50 mg/kg on the first day, followed by 8 mg/kg for the subsequent seven days, whereas the control group received saline. Our findings revealed that compared to the standard model group, treatment with HuMSCs- Exos significantly ameliorated ovarian organ coefficients and ovarian volume (Fig.  2B and C) . Histopathological assessments further demonstrated that the POF + Exo- somes group exhibited an increase in the total number of follicles, antral follicles, secondary follicles, primary follicles, and primordial follicles, alongside a reduction in the number of atretic follicles, as shown in Figs.  2D and E . These results suggest that HuMSCs-Exos effec - tively restored ovarian morphology and structure in Fig. 2 HuMSCs-Exos restored ovarian morphology and structure in CTX-induced POF mice. (A) Schematic representation of the experimental design for animal treatment. Mice were divided into control, POF model, and POF + Exosomes groups. (B) Ovarian organ coefficients and (C) ovarian volume measurements indicating significant improvement in each group. (D) Representative histological sections of ovaries stained with H&E from each group. Scale bars represent 100 μm. (E) Quantitative analysis of follicles at different developmental stages (primordial, primary, secondary, and antral follicles) and atretic follicles. *P < 0.05; **P < 0.01, n = 9 Fig. 1 Characterization of MSC-EVs Isolated from HuMSCs. (A) TEM images displaying the typical morphology of MSC-EVs as round, bilayered vesicles. Scale bar represents 100 nm. (B) NTA indicating the size distribution of MSC-EVs, with most particles ranging between 30–150 nm in diameter. The con- centration of MSC-EVs is shown as 2.1 × 10^10 particles/ml. (C) Western blot analysis confirming the presence of exosomal markers CD81, Hsp70, and CD63 in the MSC-EVs, verifying their exosomal nature. These characterizations affirm the MSC-EVs’ identity and suggest their potential for further investi- gation in the therapeutic management of POF Page 6 of 13 Cui et al. Journal of Ovarian Research (2025) 18:216 CTX-induced POF mice. The increase in follicle numbers across various developmental stages indicates a potential reversal of the detrimental effects induced by CTX, high - lighting the therapeutic potential of HuMSCs-Exos in the treatment of POF. HuMSCs-Exos restored ovarian function and fertility in CTX-induced POF mice Subsequently, we evaluated the estrous cycle and hor - mone levels to further understand the impact of HuM - SCs-Exos on the CTX-induced POF mice. The results demonstrated significant improvements in the proes - trus and estrus phases of the estrous cycle following HuMSCs-Exos transplantation (Fig.  3A). Additionally, fertility mice, including the number of pregnant moth - ers and offspring, were assessed, revealing that exosomes significantly enhanced the reproductive capacity of POF mice (Figs.  3B and C). Further analysis of hormone lev - els showed notable changes in anti-Müllerian hormone (AMH) (Fig.  3D), estradiol (E2) (Fig.  3E), follicle-stimu- lating hormone (FSH) (Fig.  3F), and luteinizing hormone (LH) (Fig. 3G) in the POF + Exosomes group compared to the POF group. These findings indicate a restoration of hormonal balance critical for ovarian function. To con - firm the regulatory effects on GCs, Western blotting was employed to detect the expression levels of functional proteins associated with GCs (FSHR, AMH, CYP19A1, and FOXL2) in the ovaries. The results revealed that the protein expression levels in the POF + Exosomes group were significantly higher than those in the POF group, further substantiating that GCs are a regulatory target of HuMSCs-Exos. This highlights the therapeutic poten - tial of HuMSCs-Exos in treating POF by modulating the ovarian microenvironment and granulosa cell function. HuMSCs-Exos enhance ovarian regenerative capacity in CTX-induced POF mice We investigated the therapeutic potential of HuMSCs- Exos in a mouse model of POF induced by CTX. To assess the extent of cellular apoptosis within the CGs, Tunel assay was employed, with the findings depicted in Figs. 4A and B. Compared to the control group, the POF model mice exhibited a significant elevation in the level of cellular apoptosis, indicating the detrimental impact of CTX treatment on ovarian granulosa cells. How - ever, upon administration of HuMSCs-Exos, a notable reduction in apoptosis levels was observed, suggesting the protective and restorative effects of the exosomes against CTX-induced cellular damage. Further analysis was conducted to evaluate the expression levels of DDX4 (DEAD-box helicase 4) and PCNA (Proliferating Cell Nuclear Antigen) both at the mRNA and protein levels, as indicators of ovarian follicle health and cell prolifera - tion, respectively. Our results demonstrated a significant upregulation in the expression of DDX4 and PCNA in the POF model mice treated with HuMSCs-Exos, as compared to the untreated POF group (Fig.  4C-H). This upsurge in DDX4 and PCNA levels signifies not only Fig. 3 HuMSCs-Exos restored ovarian function and fertility in CTX-induced POF mice. (A) Analysis of the estrous cycle phases showing significant im - provements in the proestrus and estrus phases in each group. (B) The number of pregnant mice and (C) the total number of offspring in the POF + Exo- somes group, indicating enhanced reproductive capacity following HuMSCs-Exos treatment. (D-G) Hormone level assessments in serum: (D) AMH, (E) E2, (F) FSH, and (G) LH, demonstrating a restoration of hormonal balance in the POF + Exosomes group compared to the POF model group. (H) Western blot analysis of GCs functional proteins (FSHR, AMH, CYP19A1, and FOXL2) in ovarian tissues, with significantly higher expression levels observed in the POF + Exosomes group, indicating the regulatory effects of HuMSCs-Exos on GCs function. *P < 0.05; **P < 0.01, n = 9 Page 7 of 13 Cui et al. Journal of Ovarian Research (2025) 18:216 a restoration of ovarian function but also an enhance - ment in the regenerative capacity of the ovarian tissue post-exosome treatment. These findings collectively underscore the potential of HuMSCs-Exos in mitigating CTX-induced apoptosis in CGs and promoting ovar - ian tissue repair and regeneration, as evidenced by the upregulation of crucial markers DDX4 and PCNA. HuMSCs-Exos ameliorate CTX-induced POF by alleviating inflammasome-induced pyroptosis Furthermore, we evaluated the effects of HuMSCs-Exos on inflammatory cytokine expression and inflamma - some activation in CTX-induced POF mice. Our findings revealed that treatment with HuMSCs-Exos significantly downregulated the protein expression of inflamma - tory cytokines IL-1β and IL-18 in the ovarian tissues of the POF model ( p < 0.05) (Fig. 5A, D, and E). Compared to the control group, the expression levels of NLRP3, ASC, and caspase-1, which are critical components of the inflammasome pathway, were markedly increased in the ovaries of POF mice. However, in the POF + Exo- somes group, the expression of NLRP3 was significantly reduced. Similarly, the expression levels of ASC and cas - pase-1 were also lower in the POF + Exosomes group (Fig.  5A-C). To further elucidate the potential mecha - nisms underlying GCs pyroptosis, we assessed the levels of oxidative stress in ovarian tissues. The results indi - cated significant changes in the levels of MDA, GSH, and SOD activity in the POF + Exosomes group compared to the POF group (Fig.  5F-H). These findings suggest that HuMSCs-Exos can ameliorate CTX-induced POF by alleviating inflammasome-induced pyroptosis, poten - tially through the downregulation of inflammatory cyto - kines and the modulation of oxidative stress markers in ovarian tissues. HuMSCs-Exos inhibit CTX-induced pyroptosis by inhibiting NLRP3 inflammasome activation in GCs To explore the effect of HuMSCs-Exos on CTX-induced pyroptosis in GCs, we conducted a series of experiments to assess cell apoptosis, viability, oxidative damage, and the expression of apoptosis-related markers and com - ponents of the NLRP3 inflammasome pathway. Tunel assay results demonstrated a significant increase in apop- tosis levels in the model group of immortalized human granulosa cells compared to the control group. How - ever, transfection with HuMSCs-Exos led to a notable decrease in apoptosis levels (Figs.  6A and B). The CCK8 assay revealed a significant reduction in cell viability in the model group compared to the control group, which was significantly reversed upon transfection with HuM - SCs-Exos, indicating an enhancement in granulosa cell viability (Fig.  6C). Furthermore, oxidative damage was evaluated by measuring levels of GSH, MDA) and LDH. Our findings indicated that HuMSCs-Exos could mitigate oxidative damage in GCs (Figs. 6D-F). Western blot anal- ysis of apoptosis markers showed a significant decrease in Bcl-2 expression and an increase in Bax expression in the model group compared to the normal group, which was ameliorated by HuMSCs-Exos treatment (Figs. 6G-H). Fig. 4 HuMSCs-Exos enhance ovarian regenerative capacity in CTX-induced POF mice. (A) Representative images of Tunel assay in ovarian sections of each groups. Scale bar represents 100 μm. (B) Quantitative analysis of Tunel-positive cells per section. (C and D) RT-qPCR analysis showing the relative mRNA expression levels of DDX4 and PCNA. (E-H) Immunofluorescence detection and graphical representation for DDX4 and PCNA. *P < 0.05; **P < 0.01, n = 9 Page 8 of 13 Cui et al. Journal of Ovarian Research (2025) 18:216 In addition, compared to the control group, CTX treat- ment resulted in elevated levels of IL-1β and IL-18 in the supernatant of GCs ( P < 0.05). Treatment with HuMSCs- Exos was able to reduce the levels of IL-1β and IL-18 induced by CTX in GCs ( P < 0.05), suggesting an anti- inflammatory effect. To further investigate whether the therapeutic effect of HuMSCs-Exos on POF is associ - ated with the NLRP3/Caspase-1 pathway, we examined the mRNA and protein expression of NLRP3, caspase-1, IL-1β, and IL-18 in GCs. Following CTX treatment, a significant increase in the expression of these mark - ers was observed ( P < 0.05). However, treatment with HuMSCs-Exos led to a significant decrease in their levels (P < 0.05), as shown in Figs.  7C-K. These findings suggest that HuMSCs-Exos inhibit CTX-induced pyroptosis in granulosa cells by inhibiting the activation of the NLRP3 inflammasome pathway, thereby ameliorating inflamma - tion and oxidative damage, and enhancing cell viability.

In light of the global endeavor to counteract declin - ing birth rates, the challenge of infertility, particularly stemming from ovarian aging, remains a formidable obstacle for a significant proportion of women desiring to conceive [ 25, 26]. The process of ovarian aging, lead - ing to a decrease in reproductive capacity, is not only clinically irreversible with existing pharmacological interventions but also presents a significant health risk Fig. 5 HuMSCs-Exos ameliorate CTX-induced POF by alleviating inflammasome-induced pyroptosis. (A) Western blot analysis of inflammasome compo- nents (NLRP3, caspase-1) and inflammatory cytokines (IL-1β, IL-18) in ovarian tissues of each groups. (B-E) Quantitative analysis of the expression levels of NLRP3, IL-1β, IL-18 and caspase-1. (F-H) Assessment of oxidative stress markers in ovarian tissues: (F) MDA levels, (G) GSH content, and (H) SOD activity. *P < 0.05; **P < 0.01, n = 9 Page 9 of 13 Cui et al. Journal of Ovarian Research (2025) 18:216 to perimenopausal women [ 7, 27, 28]. This includes an elevated risk of osteoporosis and cardiovascular diseases. The present study elucidates the therapeutic potential of HuMSCs-Exos in ameliorating CTX-induced POF by counteracting NLRP3-mediated pyroptosis, thereby restoring ovarian function and fertility (Fig.  8). Our find- ings align with the emerging paradigm that MSC-EVs possess regenerative capabilities, which can be harnessed for treating various degenerative diseases, including reproductive disorders such as POF. This not only under- scores the intricate interplay between cellular senescence mechanisms and reproductive health but also opens new doors for addressing the pressing issue of infertility linked to ovarian aging. In the field of regenerative medicine, the use of exo - somes derived from HuMSCs presents a novel approach that addresses the limitations of direct stem cell therapies [29, 30]. Traditional stem cell treatments face challenges such as embolism, immunogenicity, and potential for malignant transformation [ 31– 33]. Exosomes, however, do not express major histocompatibility complex (MHC) class I or II molecules, significantly reducing the risk of immune rejection and enhancing their safety for thera - peutic use [ 34– 36]. Exosomes from HuMSCs, sourced from bone marrow, adipose tissue, and amniotic mem - branes, contain a variety of bioactive molecules capable of promoting tissue regeneration [ 37– 39]. This makes them particularly advantageous for targeting ovarian dysfunction and improving female fertility, without the risks of embolism and malignant transformation associ - ated with cell-based therapies. Their non-cellular nature, coupled with ease of isolation and storage, positions exo - somes as a practical and versatile option in regenerative medicine. HuMSC-derived exosomes thus offer a prom - ising strategy for overcoming reproductive challenges by leveraging stem cell regenerative capabilities while mini - mizing associated risks. Our in vivo results demonstrated that HuMSCs-Exos treatment significantly improved ovarian structure, enhanced follicle counts, restored estrous cycles, and improved fertility outcomes in a CTX-induced POF mouse model. These findings are particularly noteworthy, as they suggest that HuMSCs-Exos can reverse the detri - mental effects of CTX on ovarian function, offering hope for fertility preservation in patients undergoing cytotoxic treatments. Furthermore, the restoration of hormonal balance and the observed reduction in NLRP3 inflammasome activa - tion and oxidative stress markers underscore the com - prehensive therapeutic potential of HuMSCs-Exos in combating ovarian aging. The NLRP3 inflammasome, a critical component of the innate immune system, plays a Fig. 6 HuMSCs-Exos Mitigate CTX induced death in GCs. (A) Representative images of Tunel assay in GCs from each groups, showing apoptotic cells (red fluorescence). Scale bar represents 100 μm. (B) Quantification of Tunel-positive cells, indicating a significant decrease in apoptosis in the Model + Exo- somes group compared to the model group. (C) Cell viability assessed by CCK8 assay. (D-F) Oxidative damage markers in GCs: (D) LDH activity, (E) GSH levels, and (F) MDA content. (G-I) The expression levels of Bcl-2 and Bax exhibited significant changes in the Model + Exosomes group, indicating a po- tential attenuation of apoptosis. *P < 0.05; **P < 0.01, n = 3 Page 10 of 13 Cui et al. Journal of Ovarian Research (2025) 18:216 pivotal role in the pathogenesis of inflammatory diseases by facilitating the production of pro-inflammatory cyto - kines such as IL-1β and IL-18. In the context of ovarian aging, the activation of the NLRP3 inflammasome con - tributes to a chronic inflammatory state, exacerbating fol- licular atresia and diminishing ovarian reserve [40– 42]. Concurrently, oxidative stress, characterized by an imbalance between ROS production and antioxidant defense mechanisms, further accelerates ovarian aging through the induction of DNA damage, apoptosis, and lipid peroxidation, thereby impairing oocyte quality and ovarian function. This intricate interplay between anti- inflammatory and antioxidative mechanisms positions HuMSCs-Exos as a potent therapeutic agent against ovarian aging. The ability of HuMSCs-Exos to simulta - neously address the inflammatory and oxidative under - pinnings of ovarian aging not only elucidates their therapeutic efficacy but also underscores the complex - ity of ovarian aging as a multifactorial condition. Future investigations into the precise molecular pathways mod - ulated by HuMSCs-Exos will further elucidate their role in rejuvenating ovarian function and potentially extend - ing reproductive lifespan. The suppression of NLRP3-mediated pyroptosis by HuMSCs-Exos represents a critical mechanism through which these vesicles restore ovarian function and fertil - ity. Pyroptosis, a form of programmed cell death associ - ated with inflammation, has been implicated in various pathological conditions, including POF [ 18, 43– 45]. In our vitro studies on GCs provided additional insights into the cellular and molecular mechanisms underlying the therapeutic effects of HuMSCs-Exos. The promotion of GC viability, alongside the reduction in death and oxi - dative damage, highlights the protective role of HuMSCs- Exos against CTX-induced cellular stress. Importantly, the inhibition of the NLRP3 inflammasome pathway by HuMSCs-Exos not only prevents cell death but also miti - gate the inflammatory milieu that contributes to ovar - ian dysfunction in POF. This dual action underscores the therapeutic versatility of HuMSCs-Exos and their poten - tial to address the complex pathophysiology of POF. The findings of this study have significant implica - tions for the development of MSC-EV-based therapies for POF and potentially other inflammatory and degen - erative reproductive disorders. Our results demon - strate that MSC-derived exosomes can promote ovarian repair by suppressing NLRP3-mediated pyroptosis in a cyclophosphamide-induced model of POF. This high - lights the therapeutic potential of MSC-EVs in restoring ovarian function and suggests a promising avenue for Fig. 7 HuMSCs-Exos inhibit CTX-induced activation of the NLRP3 inflammasome pathway in GCs. (A-B) ELISA analysis showing the levels of IL-1β and IL-18 in the supernatant of GCs from each group. (C-F) Quantitative RT-qPCR analysis of NLRP3, caspase-1, IL-1β and IL-18 mRNA expression in GCs. (G-K) Western blot analysis and quantification of NLRP3, caspase-1, IL-1β and IL-18 protein levels. *P < 0.05; **P < 0.01, n = 3 Page 11 of 13 Cui et al. Journal of Ovarian Research (2025) 18:216 treating POF and similar conditions. However, several challenges and questions remain. The precise molecular mechanisms through which HuMSCs-Exos exert their therapeutic effects need further elucidation. While our study shows improvements in ovarian function, including increased follicle counts, restored hormonal balance, and reduced pyroptotic activity, it is important to note that exosome treatment was administered for only a period of seven days. The observed improvements were evident two weeks after the completion of treatment, suggest - ing that MSC-derived exosomes may exert short-term, long-lasting effects. However, the sustainability of these benefits over a longer period remains unclear. Given the transient nature of the treatment regimen, we believe that future studies should aim to investigate the long- term effects of exosome therapy. Specifically, it would be essential to assess whether the observed therapeutic benefits are sustained for months or if the positive effects diminish after the exosome treatment ends. Furthermore, it would be valuable to explore whether repeated treat - ments or maintenance therapies could further enhance and prolong the beneficial outcomes of exosome-based interventions for ovarian repair. We acknowledge that this aspect represents a key limitation of the current study and believe that further research in this area would be a worthwhile pursuit. In conclusion, our study provides compelling evidence for the therapeutic efficacy of HuMSCs-Exos in counter - acting NLRP3-mediated pyroptosis and restoring ovarian function in a CTX-induced POF model. These findings highlight the potential of MSC-EV-based therapies as a novel, promising approach for treating POF and under - score the need for further research to translate these findings into clinical practice. Abbreviations POF Premature ovarian failure MSCs Mesenchymal stem cells Tunel TdT-mediated dUTP nick-end labeling HuMSCs Human umbilical cord mesenchymal stem cell-derived exosomes NLRP3 NOD-like receptor family, pyrin domain containing 3 ROS Reactive oxygen species (ROS) GCs Granulosa cells FSH Follicle-Stimulating Hormone E2 Estradiol LH Luteinizing Hormone IL-1 Interleukin-1 beta IL-18 Interleukin-18 Supplementary Information The online version contains supplementary material available at h t t p s : / / d o i . o r g / 1 0 . 1 1 8 6 / s 1 3 0 4 8 - 0 2 5 - 0 1 7 8 5 - 1. Supplementary Material 1 Fig. 8 Schematic overview of HuMSCs-Exos therapeutic action in CTX induced POF Page 12 of 13 Cui et al. Journal of Ovarian Research (2025) 18:216

Not applicable. Author contributions Xiangrong Cui and Xuan Jing chose the subject and gave guidance for every step. Xia Huang, Tingting Xue, Huihui Li, Xinyu Zhu, Shu Wang searched the literature and wrote the article. All authors read and approved the final manuscript. Funding This study was supported by National Natural Science Foundation of China (grant no. 82000722 and 82000302), Natural Science Foundation of Shanxi (grant no. 201901D211519 and 201901D211546), Research Project Supported by Shanxi Scholarship Council of China (grant no. HGKY2019092), China Postdoctoral Science Foundation (grant no. 2020 M670703), Initial Scientifc Research Fund of PhD in Shanxi Provincial People’s Hospital (grant no. b201635), Fund Program for the Scientific Activities of Selected Returned Overseas Professionals in Shanxi Province (grant no. 20200033 and 20220050), Key Research and Development Projects of Shanxi Province (grant no.188821) and Medical and Technological Innovation Team of Shanxi (grant no.2020TD19). Data availability No datasets were generated or analysed during the current study. Declarations Ethics approval and consent to participate This review study was based on published work and therefore did not require approved by an institutional committee. Consent for publication Not applicable. Competing interests The authors declare no competing interests. Clinical trial number Not applicable. Received: 4 September 2024 / Accepted: 11 August 2025

1. Wang L, Mei Q, Xie Q, Li H, Su P , Zhang L, et al. A comparative study of mes- enchymal stem cells transplantation approach to antagonize age-associated ovarian hypofunction with consideration of safety and efficiency. J Adv Res. 2022;38:245–59. 2. Chen W, Xu X, Wang L, Bai G, Xiang W. Low expression of Mfn2 is associated with mitochondrial damage and apoptosis of ovarian tissues in the prema- ture ovarian failure model. PLoS ONE. 2015;10:e0136421. 3. Qin X, Zhao Y, Zhang T, Yin C, Qiao J, Guo W, et al. TrkB agonist antibody ame- liorates fertility deficits in aged and cyclophosphamide-induced premature ovarian failure model mice. Nat Commun. 2022;13:914. 4. Qin Y, Zhao H, Xu J, Shi Y, Li Z, Qiao J, et al. Association of 8q22.3 locus in Chi- nese Han with idiopathic premature ovarian failure (POF). Hum Mol Genet. 2012;21:430–6. 5. Cao L, He X, Ren J, Wen C, Guo T, Yang F, et al. Novel compound heterozy- gous variants in FANCI cause premature ovarian insufficiency. Hum Genet. 2024;143:357–69. 6. Wang X, Wang L, Xiang W. Mechanisms of ovarian aging in women: a review. J Ovarian Res. 2023;16:67. 7. Cui X, Jing X. Stem cell-based therapeutic potential in female ovarian aging and infertility. J Ovarian Res. 2024;17:171. 8. Xu H, Yi Q, Yang C, Wang Y, Tian J, Zhu J. Histone modifications interact with DNA methylation at the GATA4 promoter during differentiation of mesenchy- mal stem cells into cardiomyocyte-like cells. Cell Prolif. 2016;49:315–29. 9. Zhang Y, Zhu J, Xu H, Yi Q, Yan L, Ye L, et al. Time-Dependent internalization of S100B by mesenchymal stem cells via the pathways of Clathrin- and lipid Raft-Mediated endocytosis. Front Cell Dev Biol. 2021;9:674995. 10. Zheng S, Zhang K, Zhang Y, He J, Ouyang Y, Lang R, et al. Human umbilical cord mesenchymal stem cells inhibit pyroptosis of renal tubular epithelial cells through miR-342-3p/Caspase1 signaling pathway in diabetic nephropa- thy. Stem Cells Int. 2023;2023:5584894. 11. Cui X, Bi X, Zhang X, Zhang Z, Yan Q, Wang Y, et al. MiR-9-enriched mesenchy- mal stem cells derived exosomes prevent cystitis-induced bladder pain via suppressing TLR4/NLRP3 pathway in interstitial cystitis mice. Immun Inflamm Dis. 2024;12:e1140. 12. Farhan SH, Jasim SA, Bansal P , Kaur H, Abed Jawad M, Qasim MT et al. Exosomal Non-coding RNA derived from mesenchymal stem cells (MSCs) in autoimmune diseases progression and therapy; an updated review. Cell Biochem Biophys. 2024. 13. Wang Y, Jing L, Lei X, Ma Z, Li B, Shi Y, et al. Umbilical cord mesenchymal stem cell-derived apoptotic extracellular vesicles ameliorate cutaneous wound healing in type 2 diabetic mice via macrophage pyroptosis Inhibition. Stem Cell Res Ther. 2023;14:257. 14. Akhlaghpasand M, Tavanaei R, Hosseinpoor M, Yazdani KO, Soleimani A, Zoshk MY, et al. Safety and potential effects of intrathecal injection of allogeneic human umbilical cord mesenchymal stem cell-derived exosomes in complete subacute spinal cord injury: a first-in-human, single-arm, open- label, phase I clinical trial. Stem Cell Res Ther. 2024;15:264. 15. Zidan A, Elnady M, Khalifa BN. Donepezil protects against cyclophospha- mide-induced premature ovarian failure in mice: A focus on Proinflammatory cytokines and NLRP3/TLR-4/NF-kappaB interplay. Toxicol Appl Pharmacol. 2024;488:116989. 16. Wang X, Yuan P , Zeng M, Sun M, Wang X, Zheng X, et al. Allantoin derived from Dioscorea opposita thunb ameliorates Cyclophosphamide-Induced premature ovarian failure in female rats by attenuating apoptosis, autophagy and pyroptosis. Cureus. 2023;15:e50351. 17. Khallaf WAI, Sharata EE, Attya ME, Abo-Youssef AM, Hemeida RAM. LCZ696 (sacubitril/valsartan) mitigates cyclophosphamide-induced premature ovar- ian failure in rats; the role of TLR4/NF-kappaB/NLRP3/Caspase-1 signaling pathway. Life Sci. 2023;326:121789. 18. Zhang CR, Zhu WN, Tao W, Lin WQ, Cheng CC, Deng H, et al. Moxibus- tion against Cyclophosphamide-Induced premature ovarian failure in rats through inhibiting NLRP3-/Caspase-1-/GSDMD-Dependent pyroptosis. Evid Based Complement Alternat Med. 2021;2021:8874757. 19. Myers M, Britt KL, Wreford NG, Ebling FJ, Kerr JB. Methods for quantifying fol- licular numbers within the mouse ovary. Reproduction. 2004;127:569–80. 20. Kishk EA, Mohammed Ali MH. Effect of a gonadotropin-releasing hormone analogue on cyclophosphamide-induced ovarian toxicity in adult mice. Arch Gynecol Obstet. 2013;287:1023–9. 21. Khedr NF. Protective effect of Mirtazapine and hesperidin on cyclophospha- mide-induced oxidative damage and infertility in rat ovaries. Exp Biol Med (Maywood). 2015;240:1682–9. 22. Elkady MA, Shalaby S, Fathi F, El-Mandouh S. Effects of Quercetin and Rosuv- astatin each alone or in combination on cyclophosphamide-induced prema- ture ovarian failure in female albino mice. Hum Exp Toxicol. 2019;38:1283–95. 23. Said RS, Mantawy EM, El-Demerdash E. Mechanistic perspective of protective effects of Resveratrol against cisplatin-induced ovarian injury in rats: empha- sis on anti-inflammatory and anti-apoptotic effects. Naunyn Schmiedebergs Arch Pharmacol. 2019;392:1225–38. 24. Cora MC, Kooistra L, Travlos G. Vaginal cytology of the laboratory rat and mouse: review and criteria for the staging of the estrous cycle using stained vaginal smears. Toxicol Pathol. 2015;43:776–93. 25. Ma W, Zhao X, Wang Q, Wu X, Yang T, Chen Y, et al. SCM-198 ameliorates the quality of postovulatory and maternally aged oocytes by reducing oxidative stress. J Ovarian Res. 2024;17:178. 26. Dipali SS, Gowett MQ, Kamat P , Converse A, Zaniker EJ, Fennell A et al. Self- organizing ovarian somatic organoids preserve cellular heterogeneity and reveal cellular contributions to ovarian aging. BioRxiv. 2024. 27. Loid M, Obukhova D, Kask K, Apostolov A, Meltsov A, Tserpelis D, et al. Aging promotes accumulation of senescent and multiciliated cells in human endo- metrial epithelium. Hum Reprod Open. 2024;2024:hoae048. 28. Yang L, Lai X, Jin S, Wang H, Lin F, Jin X, et al. Exploring the anti-ovarian aging mechanism of he’s Yangchao formula: insights from multi-omics analysis in naturally aged mice. Phytomedicine. 2024;134:155961. Page 13 of 13 Cui et al. Journal of Ovarian Research (2025) 18:216 29. Xiong Y, Si Y, Quan R, Huo X, Chen J, Xu J, et al. hUMSCs restore ovarian func- tion in POI mice by regulating GSK3beta-mediated mitochondrial dynamic imbalances in Theca cells. Sci Rep. 2024;14:19008. 30. Feng Y, Bao X, Zhao J, Kang L, Sun X, Xu B. MSC-Derived exosomes mitigate myocardial ischemia/reperfusion injury by reducing neutrophil infiltra- tion and the formation of neutrophil extracellular traps. Int J Nanomed. 2024;19:2071–90. 31. Wang Q, Guo W, Niu L, Zhou Y, Wang Z, Chen J, et al. 3D-hUMSCs exosomes ameliorate vitiligo by simultaneously potentiating Treg Cells-Mediated immunosuppression and suppressing oxidative Stress-Induced melanocyte damage. Adv Sci (Weinh). 2024;11:e2404064. 32. Wang C, Jiang C, Yang Y, Xi C, Yin Y, Wu H, et al. Therapeutic potential of HUC- MSC-exos primed with IFN-gamma against LPS-induced acute lung injury. Iran J Basic Med Sci. 2024;27:375–82. 33. Xu T, Chen T, Fang H, Shen X, Shen X, Tang Z, et al. Human umbilical cord mesenchymal stem cells repair endothelial injury and dysfunction by regu- lating NLRP3 to inhibit endothelial cell pyroptosis in Kawasaki disease. Inflam- mation. 2024;47:483–502. 34. Xu B, Guo W, He X, Fu Z, Chen H, Li J, et al. Repair effect of human umbilical cord mesenchymal stem cell-derived small extracellular vesicles on ovarian injury induced by cisplatin. Environ Toxicol. 2024;39:4184–95. 35. Lin L, Huang L, Huang S, Chen W, Huang H, Chi L, et al. MSC-Derived extracel- lular vesicles alleviate NLRP3/GSDMD-Mediated neuroinflammation in mouse model of sporadic alzheimer’s disease. Mol Neurobiol. 2024;61:5494–509. 36. Jiang X, Yang J, Lin Y, Liu F, Tao J, Zhang W, et al. Extracellular vesicles derived from human ESC-MSCs target macrophage and promote anti-inflammation process, angiogenesis, and functional recovery in ACS-induced severe skel- etal muscle injury. Stem Cell Res Ther. 2023;14:331. 37. Yan D, Shi Y, Nan C, Jin Q, Zhuo Y, Huo H, et al. Exosomes derived from human umbilical cord mesenchymal stem cells pretreated by monosialotetera- hexosyl ganglioside alleviate intracerebral hemorrhage by down-regulating autophagy. Exp Cell Res. 2024;436:113960. 38. Park HS, Lee BC, Chae DH, Yu A, Park JH, Heo J, et al. Cigarette smoke impairs the hematopoietic supportive property of mesenchymal stem cells via the production of reactive oxygen species and NLRP3 activation. Stem Cell Res Ther. 2024;15:145. 39. Ma Y, She X, Liu Y, Qin X. MSC-derived Exosomal miR-140-3p improves cognitive dysfunction in sepsis-associated encephalopathy by HMGB1 and S-lactoylglutathione metabolism. Commun Biol. 2024;7:562. 40. Miler M, Zivanovic J, Kovacevic S, Vidovic N, Djordjevic A, Filipovic B et al. Citrus Flavanone effects on the Nrf2-Keap1/GSK3/NF-kappaB/NLRP3 regula- tion and Corticotroph-Stress hormone loop in the old pituitary. Int J Mol Sci. 2024;25. 41. Yang Q, Chen Q, Li S, Luo J. Mesenchymal stem cells ameliorate inflammation and pyroptosis in diabetic cardiomyopathy via the miRNA-223-3p/NLRP3 pathway. Diabetol Metab Syndr. 2024;16:146. 42. Yang X, Wang X, Xia J, Jia J, Zhang S, Wang W, et al. Small extracellular vesicles-derived from 3d cultured human nasal mucosal mesenchymal stem cells during differentiation to dopaminergic progenitors promote neural damage repair via miR-494-3p after manganese exposed mice. Ecotoxicol Environ Saf. 2024;280:116569. 43. Peng S, Liu X, Chang L, Liu B, Zhang M, Mao Y et al. Exosomes derived from rejuvenated stem cells inactivate NLRP3 inflammasome and pyroptosis of nucleus pulposus cells via the transfer of antioxidants. Tissue Eng Regen Med. 2024. 44. Carrillo-Galvez AB, Zurita F, Guerra-Valverde JA, Aguilar-Gonzalez A, Abril- Garcia D, Padial-Molina M, et al. NLRP3 and AIM2 inflammasomes expression is modified by LPS and titanium ions increasing the release of active IL-1beta in alveolar bone-derived MSCs. Stem Cells Transl Med. 2024;13:826–41. 45. Xu S, Zhang Y, Zheng Z, Sun J, Wei Y, Ding G. Mesenchymal stem cells and their extracellular vesicles in bone and joint diseases: targeting the NLRP3 inflammasome. Hum Cell. 2024;37:1276–89. Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.