{"paper_id":"f4ca43a4-91e0-4523-9c6f-65b7960c5bb3","body_text":"RESEARCH Open Access\n© The Author(s) 2025. Open Access  This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 \nInternational License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you \ngive appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the \nlicensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or \nother third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the \nmaterial. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or \nexceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit  h t t p  : / /  c r e a  t i  \nv e c  o m m  o n s .  o r  g / l  i c e  n s e s  / b  y - n c - n d / 4 . 0 /.\nCui et al. Journal of Ovarian Research          (2025) 18:216 \nhttps://doi.org/10.1186/s13048-025-01785-1\nJournal of Ovarian Research\n*Correspondence:\nXuan Jing\njx05070103@163.com\n1Reproductive Medicine Center, The affiliated Children’s Hospital of \nShanxi Medical University, Children’s Hospital of Shanxi, Shanxi Maternal \nand Child Health Hospital, Taiyuan 030001, China\n2Clinical Laboratory, Shanxi Provincial People’s Hospital (Fifth Hospital) of \nShanxi Medical University, Taiyuan 030001, China\nAbstract\nBackground Premature ovarian failure (POF) is a debilitating condition impairing fertility and health in women. \nMesenchymal stem cell-derived exosomes (MSC-EVs) have emerged as a promising therapeutic option for POF due \nto their regenerative capabilities. This study explores the effectiveness of human umbilical cord mesenchymal stem \ncell-derived exosomes (HuMSCs-Exos) in counteracting NLRP3-mediated pyroptosis and restoring ovarian function in \na cyclophosphamide (CTX)-induced POF model.\nMethods HuMSCs-Exos were characterized using transmission electron microscopy (TEM), nanoparticle tracking \nanalysis (NTA), and western blot for exosomal markers. A CTX-induced POF mouse model was treated with \nHuMSCs-Exos to assess their impact on ovarian morphology, function, and fertility. Additionally, in vitro studies on \ngranulosa cells (GCs) evaluated the effects of HuMSCs-Exos on cell viability, apoptosis, oxidative stress, and NLRP3 \ninflammasome pathway components.\nResults In the CTX-induced POF model, HuMSCs-Exos treatment significantly improved ovarian structure, increased \nfollicle counts, restored estrous cycles, and enhanced fertility outcomes. Hormonal balance was also achieved, with a \nnotable reduction in NLRP3 inflammasome activation and oxidative stress markers. In vitro, HuMSCs-Exos promoted \nGCs viability and reduced apoptosis and oxidative damage, further inhibiting the NLRP3 inflammasome pathway.\nConclusion HuMSCs-Exos effectively mitigate CTX-induced POF through the suppression of NLRP3-mediated \npyroptosis, enhancing ovarian function and fertility. This study underscores the potential of MSC-EV-based therapies \nfor treating POF and possibly other inflammatory and degenerative reproductive disorders.\nKeywords Premature ovarian failure (POF), Human umbilical cord mesenchymal stem cells (HuMSCs), Exosomes, \nNLRP3 inflammasome, Cyclophosphamide (CTX)\nExosomes derived from mesenchymal \nstem cells repair ovarian function \nby suppressing NLRP3-mediated pyroptosis \nin cyclophosphamide-induced premature \novarian failure\nXiangrong Cui1, Huihui Li1, Xia Huang2, Tingting Xue2, Shu Wang2, Xinyu Zhu2 and Xuan Jing2*\n\nPage 2 of 13\nCui et al. Journal of Ovarian Research           (2025) 18:216 \nIntroduction\nPremature ovarian failure (POF) represents a significant \nclinical challenge characterized by the loss of normal \novarian function before the age of 40 [ 1, 2]. It is a mul -\ntifactorial syndrome that leads to infertility, decreased \nestrogen levels, and various health complications, includ-\ning osteoporosis and cardiovascular disease [ 3, 4]. The \netiology of POF is complex, involving genetic, autoim -\nmune, and iatrogenic factors, among others [5– 7]. Cyclo-\nphosphamide (CTX), a chemotherapeutic agent, has \nbeen known to induce POF, highlighting the need for \neffective therapeutic strategies to mitigate this adverse \neffect and restore ovarian function [1].\nMesenchymal stem cells (MSCs), with their potent \nregenerative and immunomodulatory properties, have \nbeen at the forefront of regenerative medicine research \n[1, 8– 10]. MSCs can differentiate into a variety of cell \ntypes and secrete bioactive molecules that promote tis -\nsue repair and modulate inflammatory responses [ 8]. \nAmong the therapeutic entities secreted by MSCs, exo -\nsomes, small extracellular vesicles, have garnered signifi -\ncant attention [ 7, 11]. These vesicles carry nucleic acids, \nproteins, and lipids, mediating intercellular communica -\ntion and facilitating the regenerative processes [ 12, 13]. \nHuman umbilical cord mesenchymal stem cells (HuM -\nSCs) are particularly appealing due to their abundance, \nnon-invasive collection, and low immunogenicity, mak -\ning them an ideal source of therapeutic exosomes [1, 14].\nRecent studies have elucidated the role of the NLRP3 \ninflammasome in the pathogenesis of various inflamma -\ntory and degenerative diseases, including POF [ 15, 16]. \nThe NLRP3 inflammasome, a multiprotein complex, \nplays a critical role in the activation of inflammatory \nresponses and pyroptosis, a form of programmed cell \ndeath associated with inflammation [ 17, 18]. In the con -\ntext of POF, NLRP3-mediated pyroptosis contributes to \nfollicular atresia and ovarian dysfunction, suggesting that \ntargeting NLRP3 inflammasome activation could be a \nviable therapeutic strategy.\nAgainst this backdrop, the present study aims to inves -\ntigate the therapeutic potential of HuMSC-derived exo -\nsomes (HuMSCs-Exos) in a CTX-induced POF model. \nWe hypothesize that HuMSCs-Exos can ameliorate CTX-\ninduced ovarian damage by suppressing NLRP3-medi -\nated pyroptosis, thereby restoring ovarian function and \nfertility. Through a combination of in vivo and in vitro \nexperiments, this study explores the effects of HuM -\nSCs-Exos on ovarian morphology, function, hormonal \nbalance, and the NLRP3 inflammasome pathway. By \nelucidating the mechanisms underlying the regenerative \neffects of HuMSCs-Exos, this research contributes to the \ndevelopment of MSC-EV-based therapies for POF and \npotentially other inflammatory and degenerative repro -\nductive disorders.\nMaterials and methods\nLaboratory animals and POF model establishment\nFemale C57BL/6J mouse ( n = 36, 5 weeks old) were \nobtained from Shanxi Medical University’s Experimental \nAnimal Center, with all procedures approved by its Medi-\ncal Ethics Committee and in accordance with National \nInstitutes of Health of China guidelines. Mouse were \nacclimatized for a week in conditions of 22 ± 2  °C and a \n12-hour light/dark cycle, with free access to food and \nwater. Post-acclimatization, mouse weighing 18 ± 2  g \nwere divided into control ( n = 9) and POF model groups \n(n = 27). The POF model was induced using cyclophos -\nphamide (CTX): 50 mg/kg on day one, followed by 8 mg/\nkg for 14 days, while controls received saline. Post-induc-\ntion, the POF group was subdivided into POF ( n = 9), \nsaline-treated POF (POF + NC, n = 9), and exosome-\ntreated POF (POF + Exosomes, n = 9). MSC-EVs were \nadministered via intraperitoneal injection at a dose of \n100 µg in 200 µL PBS per mouse. The injection was per -\nformed once every three days for a total of 28 days start -\ning immediately after POF induction.\nEuthanasia was performed after 21 days via CO 2 \nasphyxiation for hormone analysis and ovarian function \nassessment, including ovarian coefficient and volume cal-\nculations, and fertility evaluation through mating trials.\nHistology analysis and follicle counting\nOvarian tissues were fixed in 4% paraformaldehyde (PFA) \nfor 24 h, followed by dehydration in an ascending ethanol \nseries and paraffin embedding. Sections of 5  μm thick -\nness were cut using a microtome and every fifth sec -\ntion was stained with Hematoxylin and Eosin (H&E) for \nexamination under light microscopy. Follicles were cat -\negorized into primordial, primary, secondary, antral, and \natretic based on established criteria [ 19– 23], as follows: \nprimordial follicles were identified as oocytes surrounded \nby a single layer of flattened squamous granulosa cells; \nprimary follicles were defined as oocytes enclosed by a \nsingle layer of cuboidal granulosa cells; secondary fol -\nlicles contained oocytes surrounded by two or more lay -\ners of cuboidal granulosa cells, without an antral cavity; \nantral follicles were characterized by the presence of a \nclearly visible antral cavity; atretic follicles were identi -\nfied by morphological signs of degeneration, including \npyknotic granulosa cells, shrunken oocytes, and dis -\nrupted follicular structure. To estimate the total follicle \ncount, the number of primordial follicles was counted on \nevery fifth section and multiplied by. This approach was \nsimilarly applied for atretic, preantral, and antral follicle \ncounts. The entire process aimed to minimize observer \nbias and ensure accurate assessment of ovarian morphol -\nogy and follicular status.\n\nPage 3 of 13\nCui et al. Journal of Ovarian Research           (2025) 18:216 \nEstrous cycle characterization\nVaginal smears from mice were collected daily over 10 \ndays, stained with alkaline methylene blue, and examined \nunder a light microscope to distinguish the estrous cycle \nstages: proestrus, estrus, metestrus, and diestrus, based \non cell types [ 24]. The cycle’s phases were identified by \nthe presence of nucleated epithelial cells, keratinized \ncells, and leukocytes in varying proportions. Trypan Blue \nstaining of vaginal secretions was used for daily detection \nof the cycle phase, particularly identifying diestrus.\nMSC-EVs isolation and identification\nHuMSCs were cultured in accordance with previ -\nously established protocols [ 11] and ethical guidelines \napproved by Shanxi Medical University. Briefly, HuM -\nSCs were maintained in a suitable complete medium \nuntil they reached 70–80% confluence. Subsequently, \nthe medium was replaced with serum-free medium to \npromote EV secretion. To isolate MSC-derived EVs, \nthe cell culture supernatant was subjected to a series \nof centrifugation steps to remove cellular debris and \nnon-specifically secreted factors. This was followed by \nultracentrifugation at 100,000×g to pellet the EVs. The \nisolated EVs were then characterized for size and con -\ncentration using nanoparticle tracking analysis (NTA). \nMorphological assessment was performed via transmis -\nsion electron microscopy (TEM), while the presence of \nEV markers CD81, CD63, and HSP70 was confirmed by \nWestern blotting. The final MSC-derived EVs were stored \nat -80 °C for subsequent analyses.\nEnzyme-linked immunosorbent assay (ELISA)\nSerum levels of Anti-Müllerian Hormone (AMH), Fol -\nlicle-Stimulating Hormone (FSH), Estradiol (E2), and \nLuteinizing Hormone (LH), as well as the concentrations \nof interleukin-1 beta (IL-1β) and interleukin-18 (IL-18) \nin cell supernatants, were determined using commer -\ncial ELISA kits (Elabscience, Wuhan, China), following \nthe manufacturer’s instructions. Briefly, serum samples \nwere diluted 10-fold and added to 96-well plates pre-\ncoated with corresponding antibodies, followed by a \n2-hour incubation period. The optical density (OD) was \nmeasured using a microplate reader at a wavelength of \n450 nm to determine the hormone concentrations in the \nserum. The concentrations were then calculated based on \nstandard curves.\nTUNEL assay for apoptosis detection\nIn the study, the TUNEL assay was employed to detect \napoptosis in both ovarian tissue sections and cultured \ngranulosa cells. The procedure for ovarian tissue involved \ndeparaffinization, rehydration, and permeabilization \nusing 50 µg/ml Proteinase K for 30 min, followed by incu-\nbation with the TUNEL reaction mixture for 2  h in the \ndark. The sections were then washed, stained with DAPI \nfor 5 min to label all nuclei, and mounted with an anti-\nfade medium for fluorescence microscopy analysis using \nspecific filters for DAPI and FITC. For cultured granulosa \ncells, the preparation included washing with PBS, fixation \nwith 4% paraformaldehyde for 15 min, and permeabiliza -\ntion with 0.5% Triton X-100 for 5 min. Similar to tissue \nstaining, cells were treated with the TUNEL mixture for \n1.5 h at 37 °C in a humidified chamber, followed by DAPI \nstaining and mounting. Fluorescence microscopy enabled \nthe identification and quantification of apoptotic cells \n(TUNEL-positive, green or red) in contrast to all nuclei \n(DAPI-stained, blue), providing insights into the extent of \napoptosis in the context of ovarian function and granu -\nlosa cell viability.\nOvarian tissue immunofluorescence\nOvarian tissues were collected and fixed in 4% para -\nformaldehyde (PFA) for formalin fixation, followed by \ndehydration in 30% sucrose at 4  °C. The tissues were \nthen sectioned into 20  μm slices. To block non-specific \nbinding, sections were incubated with 5% bovine serum \nalbumin (BSA) at room temperature (20–25 ℃) for 1  h. \nSubsequently, the sections were incubated with primary \nantibodies: DDX4 (51042-1-AP , 1:2000; Proteintech) and \nPCNA (AF0239, 1:2000; Affinity) to target specific pro -\nteins of interest. After primary antibody incubation, the \nsections were exposed to a FITC-conjugated second -\nary antibody (ab150077, 1:100; Abcam) for visualiza -\ntion. Nuclei were stained with DAPI to highlight cellular \nnuclei. Finally, the sections were sealed with an anti-fade \nsolution and observed and analyzed using a confocal sys -\ntem (Nikon) to examine the localization and expression \nof the targeted proteins within the ovarian tissue.\nWestern blot analysis\nFor Western blot analysis, proteins were extracted from \novarian tissues, granulosa cells, and extracellular vesicles \nusing RIPA buffer with inhibitors (KeyGEN BioTECH). \nProtein levels were measured with the BCA Kit (Sigma-\nAldrich, Merck KGaA), and 30 µg of protein were sepa -\nrated on a 10% SDS-PAGE gel and transferred to PVDF \nmembranes (Merck Millipore). Membranes were blocked \nwith 5% BSA for 1  h, then incubated overnight at 4  °C \nwith primary antibodies: NLRP3, Caspase-1, IL-1β, \nIL-18 (1:1000), GAPDH, β-actin (1:5000) from Abcam; \nCYP19A1 (1/500, Bioss); AMH (1/1000, ABclonal); FSHR \n(1/1000, Proteintech); Bcl-2 (1/500), Bax (1/1000) from \nAffinity. This ensured specific protein detection. After \nprimary antibody incubation, membranes were washed \nwith TBST, incubated with HRP-conjugated secondary \nantibodies for 1.5 h, and visualized using an ECL kit (Mil-\nlipore) and Image J software (Bio-Rad). This streamlined \nprotocol allows for accurate protein identification and \n\nPage 4 of 13\nCui et al. Journal of Ovarian Research           (2025) 18:216 \nquantification, providing insights into ovarian biology \nand disorders.\nFluorescence quantitative PCR\nTotal RNA was isolated from mouse ovarian tissues and \ngranulosa cells using TRIzol reagent (Termo Fisher), and \ncDNA was synthesized using the PrimeScript RT reagent \nKit (Takara). The expression levels of the genes DDX4, \nPCNA, IL-1β, IL-18, Caspase-1, and NLRP3 were quanti -\nfied by fluorescence quantitative PCR (FQ-PCR) employ -\ning SYBR Premix Ex Taq (Bao Biological Engineering, \nDalian, China) on a CFX-96 Real-Time PCR Detection \nSystem (BIO-RAD) (Table  1). PCR conditions included \nan initial denaturation, followed by 40 cycles of denatur -\nation and annealing/extension, with a final melting curve \nanalysis to ensure specificity. Gene expression was ana -\nlyzed using the 2 −ΔΔCt  method, with results normalized \nto an internal control and expressed as mean values from \ntriplicate experiments.\nCell culture and treatment\nThe human granulosa cell tumor cell line KGN, obtained \nfrom Procell Life Science & Technology (China), was \ncultured in DMEM/F12 medium (KeyGEN BioTECH, \nChina) supplemented with 10% fetal bovine serum \n(ExCell Bio, China) and 1% penicillin-streptomycin (New \nCell & Molecular Biotech, China). The cells were main -\ntained in a humidified incubator at 37  °C with 5% CO 2. \nFor the treatments, granulosa cells (GCs) were exposed \nto 500µM cyclophosphamide (CTX) and subsequently \ndivided into four groups: Control, Model, Model + NC, \nand Model + Exosomes. Following these treatments, GCs \nwere collected for further experimental analyses.\nCell viability assay\nCell viability was assessed using a Cell Counting Kit-8 \n(CCK-8, APExBIO Technology, USA) following the man-\nufacturer’s protocol. GCs were seeded at 8,000 cells/well \nin 96-well plates for 24  h. Post 48-hour co-culture with \nCTX or HuMSCs-Exos, 10% CCK-8 reagent was added, \nfollowed by a 2-hour incubation. Optical density (OD) \nwas measured at 450 nm using a microplate reader. The \nassay was performed in triplicate, and the mean OD from \nthree independent experiments was used to evaluate cell \nviability under different conditions.\nAssessment of oxidative stress\nOxidative stress was assessed by quantifying malondi -\naldehyde (MDA), superoxide dismutase (SOD), lactate \ndehydrogenase (LDH) and glutathione peroxidase (GSH) \nusing specific assay kits (Nanjing Jiancheng Bioengineer -\ning Institute, Nanjing, China), following the manufac -\nturer’s protocols. Ovarian tissue homogenates and cell \nculture supernatants were centrifuged to obtain clear \nsamples for analysis. The absorbance for each marker \nwas measured with a microplate reader at kit-specified \nwavelengths. Concentrations of MDA and LDH were \nreported in nM/mg and U/L, while SOD and GSH activi -\nties were expressed in U/mg protein and µM/mg protein, \nrespectively.\nStatistical analysis\nStatistical evaluations of the data were performed uti -\nlizing GraphPad Prism 9.0 (GraphPad Software, USA). \nThe results are expressed as mean ± standard error of the \nmean (SEM). To determine the statistical significance \namong groups, data were subjected to either one-way \nanalysis of variance (ANOVA), contingent upon the data \ndistribution and homogeneity of variance. Each experi -\nmental condition was replicated a minimum of three \ntimes to ensure reliability of the findings. A P-value < 0.05 \nwas considered to denote statistical significance.\nResults\nCharacterization of HuMSCs-Exos\nTo investigate the therapeutic potential of MSC-EVs \nfor POF we isolated MSC-EVs from the supernatant of \nhuman umbilical cord mesenchymal stem cells (HuM -\nSCs). Characterization techniques including transmission \nelectron microscopy (TEM), nanoparticle tracking analy -\nsis (NTA) with high-sensitivity flow cytometry, and west-\nern blot analysis were employed. TEM images showed \nthe MSC-EVs as round, bilayered vesicles (Fig.  1A), with \nexosomal markers CD81, Hsp70, and CD63 confirmed \nvia western blot (Fig.  1C). NTA revealed a size range \nof 30–150  nm and a concentration of 2.1 × 10^10 par -\nticles/ml (Fig.  1B). This characterization confirms the \nTable 1 Sequences of primers used for fluorescence quantitative PCR in this study\nGene Primer sequence (forward) Primer sequence (reverse)\nDDX4 GAGAACACATCTACAACTGGTGG CCTCGCTTGGAAAACCCTCT\nPCNA CCTCGCTTGGAAAACCCTCT GGTGAACAGGCTCATTCATCTCT\nIL-1β CGAAGACTACAGTTCTGCCATT GACGTTTCAGAGGTTCTCAGAG\nIL-18 GAAGTGATAGCAGTCCCA AGCTAAAATCAGCAAAGTGTC\nNLRP3 ATTACCCGCCCGAGAAAGG CATGAGTGTGGCTAGATCCAAG\nCaspase-1 TGCCCAGAGCACAAGACTTC TCCTTGTTTCTCTCCACGGC\nGAPDH AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA\n\nPage 5 of 13\nCui et al. Journal of Ovarian Research           (2025) 18:216 \nMSC-EVs’ identity and supports further exploration of \ntheir therapeutic effects on POF.\nHuMSCs-Exos restored ovarian morphology and structure \nin CTX-induced POF mice\nTo evaluate the therapeutic effects of HuMSCs-Exos on \nPOF in mice, we meticulously assessed ovarian morphol -\nogy and structure following the administration of HuM -\nSCs-Exos. The experimental design for animal treatment \nis illustrated in Fig.  2A. The POF model was established \nby administering cyclophosphamide (CTX) at a dos -\nage of 50 mg/kg on the first day, followed by 8 mg/kg for \nthe subsequent seven days, whereas the control group \nreceived saline. Our findings revealed that compared \nto the standard model group, treatment with HuMSCs-\nExos significantly ameliorated ovarian organ coefficients \nand ovarian volume (Fig.  2B and C) . Histopathological \nassessments further demonstrated that the POF + Exo-\nsomes group exhibited an increase in the total number \nof follicles, antral follicles, secondary follicles, primary \nfollicles, and primordial follicles, alongside a reduction \nin the number of atretic follicles, as shown in Figs.  2D \nand E . These results suggest that HuMSCs-Exos effec -\ntively restored ovarian morphology and structure in \nFig. 2 HuMSCs-Exos restored ovarian morphology and structure in CTX-induced POF mice. (A) Schematic representation of the experimental design \nfor animal treatment. Mice were divided into control, POF model, and POF + Exosomes groups. (B) Ovarian organ coefficients and (C) ovarian volume \nmeasurements indicating significant improvement in each group. (D) Representative histological sections of ovaries stained with H&E from each group. \nScale bars represent 100 μm. (E) Quantitative analysis of follicles at different developmental stages (primordial, primary, secondary, and antral follicles) \nand atretic follicles. *P < 0.05; **P < 0.01, n = 9\n \nFig. 1 Characterization of MSC-EVs Isolated from HuMSCs. (A) TEM images displaying the typical morphology of MSC-EVs as round, bilayered vesicles. \nScale bar represents 100 nm. (B) NTA indicating the size distribution of MSC-EVs, with most particles ranging between 30–150 nm in diameter. The con-\ncentration of MSC-EVs is shown as 2.1 × 10^10 particles/ml. (C) Western blot analysis confirming the presence of exosomal markers CD81, Hsp70, and \nCD63 in the MSC-EVs, verifying their exosomal nature. These characterizations affirm the MSC-EVs’ identity and suggest their potential for further investi-\ngation in the therapeutic management of POF\n \n\nPage 6 of 13\nCui et al. Journal of Ovarian Research           (2025) 18:216 \nCTX-induced POF mice. The increase in follicle numbers \nacross various developmental stages indicates a potential \nreversal of the detrimental effects induced by CTX, high -\nlighting the therapeutic potential of HuMSCs-Exos in the \ntreatment of POF.\nHuMSCs-Exos restored ovarian function and fertility in \nCTX-induced POF mice\nSubsequently, we evaluated the estrous cycle and hor -\nmone levels to further understand the impact of HuM -\nSCs-Exos on the CTX-induced POF mice. The results \ndemonstrated significant improvements in the proes -\ntrus and estrus phases of the estrous cycle following \nHuMSCs-Exos transplantation (Fig.  3A). Additionally, \nfertility mice, including the number of pregnant moth -\ners and offspring, were assessed, revealing that exosomes \nsignificantly enhanced the reproductive capacity of POF \nmice (Figs.  3B and C). Further analysis of hormone lev -\nels showed notable changes in anti-Müllerian hormone \n(AMH) (Fig.  3D), estradiol (E2) (Fig.  3E), follicle-stimu-\nlating hormone (FSH) (Fig.  3F), and luteinizing hormone \n(LH) (Fig. 3G) in the POF + Exosomes group compared to \nthe POF group. These findings indicate a restoration of \nhormonal balance critical for ovarian function. To con -\nfirm the regulatory effects on GCs, Western blotting was \nemployed to detect the expression levels of functional \nproteins associated with GCs (FSHR, AMH, CYP19A1, \nand FOXL2) in the ovaries. The results revealed that the \nprotein expression levels in the POF + Exosomes group \nwere significantly higher than those in the POF group, \nfurther substantiating that GCs are a regulatory target \nof HuMSCs-Exos. This highlights the therapeutic poten -\ntial of HuMSCs-Exos in treating POF by modulating the \novarian microenvironment and granulosa cell function.\nHuMSCs-Exos enhance ovarian regenerative capacity in \nCTX-induced POF mice\nWe investigated the therapeutic potential of HuMSCs-\nExos in a mouse model of POF induced by CTX. To \nassess the extent of cellular apoptosis within the CGs, \nTunel assay was employed, with the findings depicted in \nFigs. 4A and B. Compared to the control group, the POF \nmodel mice exhibited a significant elevation in the level \nof cellular apoptosis, indicating the detrimental impact \nof CTX treatment on ovarian granulosa cells. How -\never, upon administration of HuMSCs-Exos, a notable \nreduction in apoptosis levels was observed, suggesting \nthe protective and restorative effects of the exosomes \nagainst CTX-induced cellular damage. Further analysis \nwas conducted to evaluate the expression levels of DDX4 \n(DEAD-box helicase 4) and PCNA (Proliferating Cell \nNuclear Antigen) both at the mRNA and protein levels, \nas indicators of ovarian follicle health and cell prolifera -\ntion, respectively. Our results demonstrated a significant \nupregulation in the expression of DDX4 and PCNA in \nthe POF model mice treated with HuMSCs-Exos, as \ncompared to the untreated POF group (Fig.  4C-H). This \nupsurge in DDX4 and PCNA levels signifies not only \nFig. 3 HuMSCs-Exos restored ovarian function and fertility in CTX-induced POF mice. (A) Analysis of the estrous cycle phases showing significant im -\nprovements in the proestrus and estrus phases in each group. (B) The number of pregnant mice and (C) the total number of offspring in the POF + Exo-\nsomes group, indicating enhanced reproductive capacity following HuMSCs-Exos treatment. (D-G) Hormone level assessments in serum: (D) AMH, (E) \nE2, (F) FSH, and (G) LH, demonstrating a restoration of hormonal balance in the POF + Exosomes group compared to the POF model group. (H) Western \nblot analysis of GCs functional proteins (FSHR, AMH, CYP19A1, and FOXL2) in ovarian tissues, with significantly higher expression levels observed in the \nPOF + Exosomes group, indicating the regulatory effects of HuMSCs-Exos on GCs function. *P < 0.05; **P < 0.01, n = 9\n \n\nPage 7 of 13\nCui et al. Journal of Ovarian Research           (2025) 18:216 \na restoration of ovarian function but also an enhance -\nment in the regenerative capacity of the ovarian tissue \npost-exosome treatment. These findings collectively \nunderscore the potential of HuMSCs-Exos in mitigating \nCTX-induced apoptosis in CGs and promoting ovar -\nian tissue repair and regeneration, as evidenced by the \nupregulation of crucial markers DDX4 and PCNA.\nHuMSCs-Exos ameliorate CTX-induced POF by alleviating \ninflammasome-induced pyroptosis\nFurthermore, we evaluated the effects of HuMSCs-Exos \non inflammatory cytokine expression and inflamma -\nsome activation in CTX-induced POF mice. Our findings \nrevealed that treatment with HuMSCs-Exos significantly \ndownregulated the protein expression of inflamma -\ntory cytokines IL-1β and IL-18 in the ovarian tissues of \nthe POF model ( p < 0.05) (Fig. 5A, D, and E). Compared \nto the control group, the expression levels of NLRP3, \nASC, and caspase-1, which are critical components of \nthe inflammasome pathway, were markedly increased \nin the ovaries of POF mice. However, in the POF + Exo-\nsomes group, the expression of NLRP3 was significantly \nreduced. Similarly, the expression levels of ASC and cas -\npase-1 were also lower in the POF + Exosomes group \n(Fig.  5A-C). To further elucidate the potential mecha -\nnisms underlying GCs pyroptosis, we assessed the levels \nof oxidative stress in ovarian tissues. The results indi -\ncated significant changes in the levels of MDA, GSH, and \nSOD activity in the POF + Exosomes group compared to \nthe POF group (Fig.  5F-H). These findings suggest that \nHuMSCs-Exos can ameliorate CTX-induced POF by \nalleviating inflammasome-induced pyroptosis, poten -\ntially through the downregulation of inflammatory cyto -\nkines and the modulation of oxidative stress markers in \novarian tissues.\nHuMSCs-Exos inhibit CTX-induced pyroptosis by inhibiting \nNLRP3 inflammasome activation in GCs\nTo explore the effect of HuMSCs-Exos on CTX-induced \npyroptosis in GCs, we conducted a series of experiments \nto assess cell apoptosis, viability, oxidative damage, and \nthe expression of apoptosis-related markers and com -\nponents of the NLRP3 inflammasome pathway. Tunel \nassay results demonstrated a significant increase in apop-\ntosis levels in the model group of immortalized human \ngranulosa cells compared to the control group. How -\never, transfection with HuMSCs-Exos led to a notable \ndecrease in apoptosis levels (Figs.  6A and B). The CCK8 \nassay revealed a significant reduction in cell viability in \nthe model group compared to the control group, which \nwas significantly reversed upon transfection with HuM -\nSCs-Exos, indicating an enhancement in granulosa cell \nviability (Fig.  6C). Furthermore, oxidative damage was \nevaluated by measuring levels of GSH, MDA) and LDH. \nOur findings indicated that HuMSCs-Exos could mitigate \noxidative damage in GCs (Figs. 6D-F). Western blot anal-\nysis of apoptosis markers showed a significant decrease in \nBcl-2 expression and an increase in Bax expression in the \nmodel group compared to the normal group, which was \nameliorated by HuMSCs-Exos treatment (Figs. 6G-H).\nFig. 4 HuMSCs-Exos enhance ovarian regenerative capacity in CTX-induced POF mice. (A) Representative images of Tunel assay in ovarian sections of \neach groups. Scale bar represents 100 μm. (B) Quantitative analysis of Tunel-positive cells per section. (C and D) RT-qPCR analysis showing the relative \nmRNA expression levels of DDX4 and PCNA. (E-H) Immunofluorescence detection and graphical representation for DDX4 and PCNA. *P < 0.05; **P < 0.01, \nn = 9\n \n\nPage 8 of 13\nCui et al. Journal of Ovarian Research           (2025) 18:216 \nIn addition, compared to the control group, CTX treat-\nment resulted in elevated levels of IL-1β and IL-18 in the \nsupernatant of GCs ( P < 0.05). Treatment with HuMSCs-\nExos was able to reduce the levels of IL-1β and IL-18 \ninduced by CTX in GCs ( P < 0.05), suggesting an anti-\ninflammatory effect. To further investigate whether the \ntherapeutic effect of HuMSCs-Exos on POF is associ -\nated with the NLRP3/Caspase-1 pathway, we examined \nthe mRNA and protein expression of NLRP3, caspase-1, \nIL-1β, and IL-18 in GCs. Following CTX treatment, a \nsignificant increase in the expression of these mark -\ners was observed ( P < 0.05). However, treatment with \nHuMSCs-Exos led to a significant decrease in their levels \n(P < 0.05), as shown in Figs.  7C-K. These findings suggest \nthat HuMSCs-Exos inhibit CTX-induced pyroptosis in \ngranulosa cells by inhibiting the activation of the NLRP3 \ninflammasome pathway, thereby ameliorating inflamma -\ntion and oxidative damage, and enhancing cell viability.\nDiscussion\nIn light of the global endeavor to counteract declin -\ning birth rates, the challenge of infertility, particularly \nstemming from ovarian aging, remains a formidable \nobstacle for a significant proportion of women desiring \nto conceive [ 25, 26]. The process of ovarian aging, lead -\ning to a decrease in reproductive capacity, is not only \nclinically irreversible with existing pharmacological \ninterventions but also presents a significant health risk \nFig. 5 HuMSCs-Exos ameliorate CTX-induced POF by alleviating inflammasome-induced pyroptosis. (A) Western blot analysis of inflammasome compo-\nnents (NLRP3, caspase-1) and inflammatory cytokines (IL-1β, IL-18) in ovarian tissues of each groups. (B-E) Quantitative analysis of the expression levels of \nNLRP3, IL-1β, IL-18 and caspase-1. (F-H) Assessment of oxidative stress markers in ovarian tissues: (F) MDA levels, (G) GSH content, and (H) SOD activity. \n*P < 0.05; **P < 0.01, n = 9\n \n\nPage 9 of 13\nCui et al. Journal of Ovarian Research           (2025) 18:216 \nto perimenopausal women [ 7, 27, 28]. This includes an \nelevated risk of osteoporosis and cardiovascular diseases. \nThe present study elucidates the therapeutic potential \nof HuMSCs-Exos in ameliorating CTX-induced POF \nby counteracting NLRP3-mediated pyroptosis, thereby \nrestoring ovarian function and fertility (Fig.  8). Our find-\nings align with the emerging paradigm that MSC-EVs \npossess regenerative capabilities, which can be harnessed \nfor treating various degenerative diseases, including \nreproductive disorders such as POF. This not only under-\nscores the intricate interplay between cellular senescence \nmechanisms and reproductive health but also opens \nnew doors for addressing the pressing issue of infertility \nlinked to ovarian aging.\nIn the field of regenerative medicine, the use of exo -\nsomes derived from HuMSCs presents a novel approach \nthat addresses the limitations of direct stem cell therapies \n[29, 30]. Traditional stem cell treatments face challenges \nsuch as embolism, immunogenicity, and potential for \nmalignant transformation [ 31– 33]. Exosomes, however, \ndo not express major histocompatibility complex (MHC) \nclass I or II molecules, significantly reducing the risk of \nimmune rejection and enhancing their safety for thera -\npeutic use [ 34– 36]. Exosomes from HuMSCs, sourced \nfrom bone marrow, adipose tissue, and amniotic mem -\nbranes, contain a variety of bioactive molecules capable \nof promoting tissue regeneration [ 37– 39]. This makes \nthem particularly advantageous for targeting ovarian \ndysfunction and improving female fertility, without the \nrisks of embolism and malignant transformation associ -\nated with cell-based therapies. Their non-cellular nature, \ncoupled with ease of isolation and storage, positions exo -\nsomes as a practical and versatile option in regenerative \nmedicine. HuMSC-derived exosomes thus offer a prom -\nising strategy for overcoming reproductive challenges by \nleveraging stem cell regenerative capabilities while mini -\nmizing associated risks.\nOur in vivo results demonstrated that HuMSCs-Exos \ntreatment significantly improved ovarian structure, \nenhanced follicle counts, restored estrous cycles, and \nimproved fertility outcomes in a CTX-induced POF \nmouse model. These findings are particularly noteworthy, \nas they suggest that HuMSCs-Exos can reverse the detri -\nmental effects of CTX on ovarian function, offering hope \nfor fertility preservation in patients undergoing cytotoxic \ntreatments.\nFurthermore, the restoration of hormonal balance and \nthe observed reduction in NLRP3 inflammasome activa -\ntion and oxidative stress markers underscore the com -\nprehensive therapeutic potential of HuMSCs-Exos in \ncombating ovarian aging. The NLRP3 inflammasome, a \ncritical component of the innate immune system, plays a \nFig. 6 HuMSCs-Exos Mitigate CTX induced death in GCs. (A) Representative images of Tunel assay in GCs from each groups, showing apoptotic cells (red \nfluorescence). Scale bar represents 100 μm. (B) Quantification of Tunel-positive cells, indicating a significant decrease in apoptosis in the Model + Exo-\nsomes group compared to the model group. (C) Cell viability assessed by CCK8 assay. (D-F) Oxidative damage markers in GCs: (D) LDH activity, (E) GSH \nlevels, and (F) MDA content. (G-I) The expression levels of Bcl-2 and Bax exhibited significant changes in the Model + Exosomes group, indicating a po-\ntential attenuation of apoptosis. *P < 0.05; **P < 0.01, n = 3\n \n\nPage 10 of 13\nCui et al. Journal of Ovarian Research           (2025) 18:216 \npivotal role in the pathogenesis of inflammatory diseases \nby facilitating the production of pro-inflammatory cyto -\nkines such as IL-1β and IL-18. In the context of ovarian \naging, the activation of the NLRP3 inflammasome con -\ntributes to a chronic inflammatory state, exacerbating fol-\nlicular atresia and diminishing ovarian reserve [40– 42].\nConcurrently, oxidative stress, characterized by an \nimbalance between ROS production and antioxidant \ndefense mechanisms, further accelerates ovarian aging \nthrough the induction of DNA damage, apoptosis, and \nlipid peroxidation, thereby impairing oocyte quality and \novarian function. This intricate interplay between anti-\ninflammatory and antioxidative mechanisms positions \nHuMSCs-Exos as a potent therapeutic agent against \novarian aging. The ability of HuMSCs-Exos to simulta -\nneously address the inflammatory and oxidative under -\npinnings of ovarian aging not only elucidates their \ntherapeutic efficacy but also underscores the complex -\nity of ovarian aging as a multifactorial condition. Future \ninvestigations into the precise molecular pathways mod -\nulated by HuMSCs-Exos will further elucidate their role \nin rejuvenating ovarian function and potentially extend -\ning reproductive lifespan.\nThe suppression of NLRP3-mediated pyroptosis by \nHuMSCs-Exos represents a critical mechanism through \nwhich these vesicles restore ovarian function and fertil -\nity. Pyroptosis, a form of programmed cell death associ -\nated with inflammation, has been implicated in various \npathological conditions, including POF [ 18, 43– 45]. In \nour vitro studies on GCs provided additional insights \ninto the cellular and molecular mechanisms underlying \nthe therapeutic effects of HuMSCs-Exos. The promotion \nof GC viability, alongside the reduction in death and oxi -\ndative damage, highlights the protective role of HuMSCs-\nExos against CTX-induced cellular stress. Importantly, \nthe inhibition of the NLRP3 inflammasome pathway by \nHuMSCs-Exos not only prevents cell death but also miti -\ngate the inflammatory milieu that contributes to ovar -\nian dysfunction in POF. This dual action underscores the \ntherapeutic versatility of HuMSCs-Exos and their poten -\ntial to address the complex pathophysiology of POF.\nThe findings of this study have significant implica -\ntions for the development of MSC-EV-based therapies \nfor POF and potentially other inflammatory and degen -\nerative reproductive disorders. Our results demon -\nstrate that MSC-derived exosomes can promote ovarian \nrepair by suppressing NLRP3-mediated pyroptosis in a \ncyclophosphamide-induced model of POF. This high -\nlights the therapeutic potential of MSC-EVs in restoring \novarian function and suggests a promising avenue for \nFig. 7 HuMSCs-Exos inhibit CTX-induced activation of the NLRP3 inflammasome pathway in GCs. (A-B) ELISA analysis showing the levels of IL-1β and \nIL-18 in the supernatant of GCs from each group. (C-F) Quantitative RT-qPCR analysis of NLRP3, caspase-1, IL-1β and IL-18 mRNA expression in GCs. (G-K) \nWestern blot analysis and quantification of NLRP3, caspase-1, IL-1β and IL-18 protein levels. *P < 0.05; **P < 0.01, n = 3\n \n\nPage 11 of 13\nCui et al. Journal of Ovarian Research           (2025) 18:216 \ntreating POF and similar conditions. However, several \nchallenges and questions remain. The precise molecular \nmechanisms through which HuMSCs-Exos exert their \ntherapeutic effects need further elucidation. While our \nstudy shows improvements in ovarian function, including \nincreased follicle counts, restored hormonal balance, and \nreduced pyroptotic activity, it is important to note that \nexosome treatment was administered for only a period \nof seven days. The observed improvements were evident \ntwo weeks after the completion of treatment, suggest -\ning that MSC-derived exosomes may exert short-term, \nlong-lasting effects. However, the sustainability of these \nbenefits over a longer period remains unclear. Given the \ntransient nature of the treatment regimen, we believe \nthat future studies should aim to investigate the long-\nterm effects of exosome therapy. Specifically, it would \nbe essential to assess whether the observed therapeutic \nbenefits are sustained for months or if the positive effects \ndiminish after the exosome treatment ends. Furthermore, \nit would be valuable to explore whether repeated treat -\nments or maintenance therapies could further enhance \nand prolong the beneficial outcomes of exosome-based \ninterventions for ovarian repair. We acknowledge that \nthis aspect represents a key limitation of the current \nstudy and believe that further research in this area would \nbe a worthwhile pursuit.\nIn conclusion, our study provides compelling evidence \nfor the therapeutic efficacy of HuMSCs-Exos in counter -\nacting NLRP3-mediated pyroptosis and restoring ovarian \nfunction in a CTX-induced POF model. These findings \nhighlight the potential of MSC-EV-based therapies as a \nnovel, promising approach for treating POF and under -\nscore the need for further research to translate these \nfindings into clinical practice.\nAbbreviations\nPOF  Premature ovarian failure\nMSCs  Mesenchymal stem cells\nTunel  TdT-mediated dUTP nick-end labeling\nHuMSCs  Human umbilical cord mesenchymal stem cell-derived exosomes\nNLRP3  NOD-like receptor family, pyrin domain containing 3\nROS  Reactive oxygen species (ROS)\nGCs  Granulosa cells\nFSH  Follicle-Stimulating Hormone\nE2  Estradiol\nLH  Luteinizing Hormone\nIL-1  Interleukin-1 beta\nIL-18  Interleukin-18\nSupplementary Information\nThe online version contains supplementary material available at  h t t p s :   /  / d o  i .  o r  \ng  /  1 0  . 1 1   8 6  / s 1 3  0 4 8 -  0 2 5 - 0  1 7 8 5 - 1.\nSupplementary Material 1\nFig. 8 Schematic overview of HuMSCs-Exos therapeutic action in CTX induced POF\n \n\nPage 12 of 13\nCui et al. Journal of Ovarian Research           (2025) 18:216 \nAcknowledgements\nNot applicable.\nAuthor contributions\nXiangrong Cui and Xuan Jing chose the subject and gave guidance for every \nstep. Xia Huang, Tingting Xue, Huihui Li, Xinyu Zhu, Shu Wang searched \nthe literature and wrote the article. All authors read and approved the final \nmanuscript.\nFunding\nThis study was supported by National Natural Science Foundation of \nChina (grant no. 82000722 and 82000302), Natural Science Foundation of \nShanxi (grant no. 201901D211519 and 201901D211546), Research Project \nSupported by Shanxi Scholarship Council of China (grant no. HGKY2019092), \nChina Postdoctoral Science Foundation (grant no. 2020 M670703), Initial \nScientifc Research Fund of PhD in Shanxi Provincial People’s Hospital \n(grant no. b201635), Fund Program for the Scientific Activities of Selected \nReturned Overseas Professionals in Shanxi Province (grant no. 20200033 and \n20220050), Key Research and Development Projects of Shanxi Province (grant \nno.188821) and Medical and Technological Innovation Team of Shanxi (grant \nno.2020TD19).\nData availability\nNo datasets were generated or analysed during the current study.\nDeclarations\nEthics approval and consent to participate\nThis review study was based on published work and therefore did not require \napproved by an institutional committee.\nConsent for publication\nNot applicable.\nCompeting interests\nThe authors declare no competing interests.\nClinical trial number\nNot applicable.\nReceived: 4 September 2024 / Accepted: 11 August 2025\nReferences\n1. Wang L, Mei Q, Xie Q, Li H, Su P , Zhang L, et al. A comparative study of mes-\nenchymal stem cells transplantation approach to antagonize age-associated \novarian hypofunction with consideration of safety and efficiency. J Adv Res. \n2022;38:245–59.\n2. Chen W, Xu X, Wang L, Bai G, Xiang W. Low expression of Mfn2 is associated \nwith mitochondrial damage and apoptosis of ovarian tissues in the prema-\nture ovarian failure model. PLoS ONE. 2015;10:e0136421.\n3. Qin X, Zhao Y, Zhang T, Yin C, Qiao J, Guo W, et al. TrkB agonist antibody ame-\nliorates fertility deficits in aged and cyclophosphamide-induced premature \novarian failure model mice. Nat Commun. 2022;13:914.\n4. Qin Y, Zhao H, Xu J, Shi Y, Li Z, Qiao J, et al. Association of 8q22.3 locus in Chi-\nnese Han with idiopathic premature ovarian failure (POF). Hum Mol Genet. \n2012;21:430–6.\n5. Cao L, He X, Ren J, Wen C, Guo T, Yang F, et al. Novel compound heterozy-\ngous variants in FANCI cause premature ovarian insufficiency. Hum Genet. \n2024;143:357–69.\n6. Wang X, Wang L, Xiang W. Mechanisms of ovarian aging in women: a review. \nJ Ovarian Res. 2023;16:67.\n7. Cui X, Jing X. Stem cell-based therapeutic potential in female ovarian aging \nand infertility. J Ovarian Res. 2024;17:171.\n8. Xu H, Yi Q, Yang C, Wang Y, Tian J, Zhu J. Histone modifications interact with \nDNA methylation at the GATA4 promoter during differentiation of mesenchy-\nmal stem cells into cardiomyocyte-like cells. Cell Prolif. 2016;49:315–29.\n9. Zhang Y, Zhu J, Xu H, Yi Q, Yan L, Ye L, et al. Time-Dependent internalization \nof S100B by mesenchymal stem cells via the pathways of Clathrin- and lipid \nRaft-Mediated endocytosis. Front Cell Dev Biol. 2021;9:674995.\n10. Zheng S, Zhang K, Zhang Y, He J, Ouyang Y, Lang R, et al. Human umbilical \ncord mesenchymal stem cells inhibit pyroptosis of renal tubular epithelial \ncells through miR-342-3p/Caspase1 signaling pathway in diabetic nephropa-\nthy. Stem Cells Int. 2023;2023:5584894.\n11. Cui X, Bi X, Zhang X, Zhang Z, Yan Q, Wang Y, et al. MiR-9-enriched mesenchy-\nmal stem cells derived exosomes prevent cystitis-induced bladder pain via \nsuppressing TLR4/NLRP3 pathway in interstitial cystitis mice. Immun Inflamm \nDis. 2024;12:e1140.\n12. Farhan SH, Jasim SA, Bansal P , Kaur H, Abed Jawad M, Qasim MT et al. \nExosomal Non-coding RNA derived from mesenchymal stem cells (MSCs) \nin autoimmune diseases progression and therapy; an updated review. Cell \nBiochem Biophys. 2024.\n13. Wang Y, Jing L, Lei X, Ma Z, Li B, Shi Y, et al. Umbilical cord mesenchymal stem \ncell-derived apoptotic extracellular vesicles ameliorate cutaneous wound \nhealing in type 2 diabetic mice via macrophage pyroptosis Inhibition. Stem \nCell Res Ther. 2023;14:257.\n14. Akhlaghpasand M, Tavanaei R, Hosseinpoor M, Yazdani KO, Soleimani A, \nZoshk MY, et al. Safety and potential effects of intrathecal injection of \nallogeneic human umbilical cord mesenchymal stem cell-derived exosomes \nin complete subacute spinal cord injury: a first-in-human, single-arm, open-\nlabel, phase I clinical trial. Stem Cell Res Ther. 2024;15:264.\n15. Zidan A, Elnady M, Khalifa BN. Donepezil protects against cyclophospha-\nmide-induced premature ovarian failure in mice: A focus on Proinflammatory \ncytokines and NLRP3/TLR-4/NF-kappaB interplay. Toxicol Appl Pharmacol. \n2024;488:116989.\n16. Wang X, Yuan P , Zeng M, Sun M, Wang X, Zheng X, et al. Allantoin derived \nfrom Dioscorea opposita thunb ameliorates Cyclophosphamide-Induced \npremature ovarian failure in female rats by attenuating apoptosis, autophagy \nand pyroptosis. Cureus. 2023;15:e50351.\n17. Khallaf WAI, Sharata EE, Attya ME, Abo-Youssef AM, Hemeida RAM. LCZ696 \n(sacubitril/valsartan) mitigates cyclophosphamide-induced premature ovar-\nian failure in rats; the role of TLR4/NF-kappaB/NLRP3/Caspase-1 signaling \npathway. Life Sci. 2023;326:121789.\n18. Zhang CR, Zhu WN, Tao W, Lin WQ, Cheng CC, Deng H, et al. Moxibus-\ntion against Cyclophosphamide-Induced premature ovarian failure in rats \nthrough inhibiting NLRP3-/Caspase-1-/GSDMD-Dependent pyroptosis. Evid \nBased Complement Alternat Med. 2021;2021:8874757.\n19. Myers M, Britt KL, Wreford NG, Ebling FJ, Kerr JB. Methods for quantifying fol-\nlicular numbers within the mouse ovary. Reproduction. 2004;127:569–80.\n20. Kishk EA, Mohammed Ali MH. Effect of a gonadotropin-releasing hormone \nanalogue on cyclophosphamide-induced ovarian toxicity in adult mice. Arch \nGynecol Obstet. 2013;287:1023–9.\n21. Khedr NF. Protective effect of Mirtazapine and hesperidin on cyclophospha-\nmide-induced oxidative damage and infertility in rat ovaries. Exp Biol Med \n(Maywood). 2015;240:1682–9.\n22. Elkady MA, Shalaby S, Fathi F, El-Mandouh S. Effects of Quercetin and Rosuv-\nastatin each alone or in combination on cyclophosphamide-induced prema-\nture ovarian failure in female albino mice. Hum Exp Toxicol. 2019;38:1283–95.\n23. Said RS, Mantawy EM, El-Demerdash E. Mechanistic perspective of protective \neffects of Resveratrol against cisplatin-induced ovarian injury in rats: empha-\nsis on anti-inflammatory and anti-apoptotic effects. Naunyn Schmiedebergs \nArch Pharmacol. 2019;392:1225–38.\n24. Cora MC, Kooistra L, Travlos G. Vaginal cytology of the laboratory rat and \nmouse: review and criteria for the staging of the estrous cycle using stained \nvaginal smears. Toxicol Pathol. 2015;43:776–93.\n25. Ma W, Zhao X, Wang Q, Wu X, Yang T, Chen Y, et al. SCM-198 ameliorates the \nquality of postovulatory and maternally aged oocytes by reducing oxidative \nstress. J Ovarian Res. 2024;17:178.\n26. Dipali SS, Gowett MQ, Kamat P , Converse A, Zaniker EJ, Fennell A et al. Self-\norganizing ovarian somatic organoids preserve cellular heterogeneity and \nreveal cellular contributions to ovarian aging. BioRxiv. 2024.\n27. Loid M, Obukhova D, Kask K, Apostolov A, Meltsov A, Tserpelis D, et al. Aging \npromotes accumulation of senescent and multiciliated cells in human endo-\nmetrial epithelium. Hum Reprod Open. 2024;2024:hoae048.\n28. Yang L, Lai X, Jin S, Wang H, Lin F, Jin X, et al. Exploring the anti-ovarian aging \nmechanism of he’s Yangchao formula: insights from multi-omics analysis in \nnaturally aged mice. Phytomedicine. 2024;134:155961.\n\nPage 13 of 13\nCui et al. Journal of Ovarian Research           (2025) 18:216 \n29. Xiong Y, Si Y, Quan R, Huo X, Chen J, Xu J, et al. hUMSCs restore ovarian func-\ntion in POI mice by regulating GSK3beta-mediated mitochondrial dynamic \nimbalances in Theca cells. Sci Rep. 2024;14:19008.\n30. Feng Y, Bao X, Zhao J, Kang L, Sun X, Xu B. MSC-Derived exosomes mitigate \nmyocardial ischemia/reperfusion injury by reducing neutrophil infiltra-\ntion and the formation of neutrophil extracellular traps. Int J Nanomed. \n2024;19:2071–90.\n31. Wang Q, Guo W, Niu L, Zhou Y, Wang Z, Chen J, et al. 3D-hUMSCs exosomes \nameliorate vitiligo by simultaneously potentiating Treg Cells-Mediated \nimmunosuppression and suppressing oxidative Stress-Induced melanocyte \ndamage. Adv Sci (Weinh). 2024;11:e2404064.\n32. Wang C, Jiang C, Yang Y, Xi C, Yin Y, Wu H, et al. Therapeutic potential of HUC-\nMSC-exos primed with IFN-gamma against LPS-induced acute lung injury. \nIran J Basic Med Sci. 2024;27:375–82.\n33. Xu T, Chen T, Fang H, Shen X, Shen X, Tang Z, et al. Human umbilical cord \nmesenchymal stem cells repair endothelial injury and dysfunction by regu-\nlating NLRP3 to inhibit endothelial cell pyroptosis in Kawasaki disease. Inflam-\nmation. 2024;47:483–502.\n34. Xu B, Guo W, He X, Fu Z, Chen H, Li J, et al. Repair effect of human umbilical \ncord mesenchymal stem cell-derived small extracellular vesicles on ovarian \ninjury induced by cisplatin. Environ Toxicol. 2024;39:4184–95.\n35. Lin L, Huang L, Huang S, Chen W, Huang H, Chi L, et al. MSC-Derived extracel-\nlular vesicles alleviate NLRP3/GSDMD-Mediated neuroinflammation in mouse \nmodel of sporadic alzheimer’s disease. Mol Neurobiol. 2024;61:5494–509.\n36. Jiang X, Yang J, Lin Y, Liu F, Tao J, Zhang W, et al. Extracellular vesicles derived \nfrom human ESC-MSCs target macrophage and promote anti-inflammation \nprocess, angiogenesis, and functional recovery in ACS-induced severe skel-\netal muscle injury. Stem Cell Res Ther. 2023;14:331.\n37. Yan D, Shi Y, Nan C, Jin Q, Zhuo Y, Huo H, et al. Exosomes derived from human \numbilical cord mesenchymal stem cells pretreated by monosialotetera-\nhexosyl ganglioside alleviate intracerebral hemorrhage by down-regulating \nautophagy. Exp Cell Res. 2024;436:113960.\n38. Park HS, Lee BC, Chae DH, Yu A, Park JH, Heo J, et al. Cigarette smoke impairs \nthe hematopoietic supportive property of mesenchymal stem cells via the \nproduction of reactive oxygen species and NLRP3 activation. Stem Cell Res \nTher. 2024;15:145.\n39. Ma Y, She X, Liu Y, Qin X. MSC-derived Exosomal miR-140-3p improves \ncognitive dysfunction in sepsis-associated encephalopathy by HMGB1 and \nS-lactoylglutathione metabolism. Commun Biol. 2024;7:562.\n40. Miler M, Zivanovic J, Kovacevic S, Vidovic N, Djordjevic A, Filipovic B et al. \nCitrus Flavanone effects on the Nrf2-Keap1/GSK3/NF-kappaB/NLRP3 regula-\ntion and Corticotroph-Stress hormone loop in the old pituitary. Int J Mol Sci. \n2024;25.\n41. Yang Q, Chen Q, Li S, Luo J. Mesenchymal stem cells ameliorate inflammation \nand pyroptosis in diabetic cardiomyopathy via the miRNA-223-3p/NLRP3 \npathway. Diabetol Metab Syndr. 2024;16:146.\n42. Yang X, Wang X, Xia J, Jia J, Zhang S, Wang W, et al. Small extracellular \nvesicles-derived from 3d cultured human nasal mucosal mesenchymal stem \ncells during differentiation to dopaminergic progenitors promote neural \ndamage repair via miR-494-3p after manganese exposed mice. Ecotoxicol \nEnviron Saf. 2024;280:116569.\n43. Peng S, Liu X, Chang L, Liu B, Zhang M, Mao Y et al. Exosomes derived from \nrejuvenated stem cells inactivate NLRP3 inflammasome and pyroptosis of \nnucleus pulposus cells via the transfer of antioxidants. Tissue Eng Regen Med. \n2024.\n44. Carrillo-Galvez AB, Zurita F, Guerra-Valverde JA, Aguilar-Gonzalez A, Abril-\nGarcia D, Padial-Molina M, et al. NLRP3 and AIM2 inflammasomes expression \nis modified by LPS and titanium ions increasing the release of active IL-1beta \nin alveolar bone-derived MSCs. Stem Cells Transl Med. 2024;13:826–41.\n45. Xu S, Zhang Y, Zheng Z, Sun J, Wei Y, Ding G. Mesenchymal stem cells and \ntheir extracellular vesicles in bone and joint diseases: targeting the NLRP3 \ninflammasome. Hum Cell. 2024;37:1276–89.\nPublisher’s note\nSpringer Nature remains neutral with regard to jurisdictional claims in \npublished maps and institutional affiliations.","source_license":"CC0","license_restricted":false}