PPARγ induces the paroxysm of endometriosis by regulating the transcription of MAT2A gene.

article OA: green CC0 ⤵ 2 in-corpus citations
AI-generated summary by claude@2026-06, 2026-06-07

This study found that PPARγ up-regulation, achieved through gene silencing or rosiglitazone treatment, inhibited MAT2A transcription and reduced endometriosis cell viability, invasion, and migration, impacting endometriosis progression.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

AI-generated deep summary by claude@2026-06, 2026-06-07 · read from full text

The study examined how PPARγ affects endometriosis progression by regulating transcription of MAT2A, comparing eutopic and ectopic endometrial tissues from 35 endometriosis patients with normal endometrium from 35 controls using immunohistochemistry, qRT-PCR, and Western blot. They isolated primary ESC and NSC cells, manipulated PPARγ expression (overexpression in ESC, silencing in NSC), and treated cells with the PPARγ agonist rosiglitazone (RSG), then assessed proliferation, apoptosis-related morphology, migration, invasion, and MAT2A promoter binding using dual-luciferase reporter assays. MAT2A was up-regulated and PPARγ down-regulated in both eutopic and ectopic tissues, and increasing PPARγ activity (or adding RSG) reduced cell viability, migration, invasion, and MAT2A expression while increasing apoptotic ultrastructural changes; conversely, silencing PPARγ increased viability, migration, invasion, and MAT2A expression. The paper’s limitation is that most mechanistic and functional evidence is generated in vitro using primary cell models and does not evaluate in vivo or clinical outcome correlations, beyond tissue expression patterns. This paper is centrally about endometriosis — it proposes that the PPARγ–MAT2A transcriptional axis drives endometriosis “paroxysm” by inhibiting MAT2A and altering ESC/NSC cell behavior.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

OBJECTIVE: To investigate the molecular mechanism of PPARγ impacting the paroxysm of endometriosis. METHODS: Immunohistochemistry, qRT-PCR and Western Blot were used to determine the expression level of PPARγ and MAT2A in Eu, Ec and normal endometrial tissue (control). ESC and NSC were separately isolated. PPARγ was silenced in NSC and was up-regulated in ESC. Rosiglitazone (RSG) were used to incubate with ESC. Proliferation, apoptosis, invasion, and ultrastructure of cells were evaluated in vitro. The combination between PPARγ and the promoters of MAT2A was detected by dual-luciferase reporter assay. RESULTS: MAT2A was up-regulated and PPARγ was down-regulated in Eu and Ec. The cell viability and the ability of migration and invasion declined greatly after up-regulating the expression of PPARγ or treating with RSG in ESC. Meanwhile, the expression level of MAT2A was significantly inhibited. Plenty of vacuoles and classical morphological changes of apoptotic cells were observed in the ESC with PPARγ over-expressed. The cell viability and the ability of migration and invasion of NSC with PPARγ silenced were promoted greatly. Meanwhile, the expression level of MAT2A was significantly up-regulated. CONCLUSION: The paroxysm and development of endometriosis were impacted by over-expressing PPARγ or introducing of RSG by inhibiting the transcription of MAT2A.
Full text 35,132 characters · extracted from oa-html · 9 sections · click to expand

Abstract

Objective: To investigate the molecular mechanism of PPARγ impacting the paroxysm of endometriosis. Methods: Immunohistochemistry, qRT-PCR and Western Blot were used to determine the expression level of PPARγ and MAT2A in Eu, Ec and normal endometrial tissue (control). ESC and NSC were separately isolated. PPARγ was silenced in NSC and was up-regulated in ESC. Rosiglitazone (RSG) were used to incubate with ESC. Proliferation, apoptosis, invasion, and ultrastructure of cells were evaluated in vitro. The combination between PPARγ and the promoters of MAT2A was detected by dual-luciferase reporter assay. Results: MAT2A was up-regulated and PPARγ was down-regulated in Eu and Ec. The cell viability and the ability of migration and invasion declined greatly after up-regulating the expression of PPARγ or treating with RSG in ESC. Meanwhile, the expression level of MAT2A was significantly inhibited. Plenty of vacuoles and classical morphological changes of apoptotic cells were observed in the ESC with PPARγ over-expressed. The cell viability and the ability of migration and invasion of NSC with PPARγ silenced were promoted greatly. Meanwhile, the expression level of MAT2A was significantly up-regulated. Conclusion: The paroxysm and development of endometriosis were impacted by over-expressing PPARγ or introducing of RSG by inhibiting the transcription of MAT2A.

Keywords

PPARγ, MAT2A, endometriosis, paroxysm

Introduction

Endometriosis is an estrogen-dependent gynaecological disorder that affects 6-10% of women of reproductive age group. It is characterized histologically by the presence of endometrial tissue at sites outside of the uterine cavity, primarily on the pelvic peritoneum and ovaries, resulting in severe pelvic pain, pain during intercourse, and infertility [1]. Up to now, the etiology and pathogenesis of endometriosis are not clear. There is growing evidence that eutopic endometrium from women with endometriosis has endogenous abnormalities, which permits endometrial tissue to attach, survive, invade, and results in the occurrence and development of endometriosis [2,3]. As a dedifferentiated gene that regulate the cell growth, methionine adenosyl-transferase 2A (MAT2A) is an important target for mitogenic active cytokines, such as hepatocyte growth factor and leptin, to induce cell proliferation [4,5]. High level of MAT2A was reported to induce cell proliferation, inhibit apoptosis and involved in the paroxysm and development of multiple types of malignant tumors, such as liver cancer, colon cancer, bladder cancer and prostate cancer [6-9]. Peroxidosome proliferators activate receptors (PPARγ) is a pleiotropic nuclear hormone receptor that can combine with particular DNA reaction components to compete with other transcription factors to influence particular gene with indirect, negative feedback and positive feedback regulations [10]. It is reported that PPARγ could exert important regulation function on cell cycle and apoptosis. And it is also a therapeutic target for the treatment of proliferative cardiovascular disease and cancer [11-13]. Rosiglitazone (RSG), an agonist of PPARγ, was reported to inhibit endometriosis [14] and improve the symptoms of endometriosis [15]. PPARγ is involved in multiple physiological and pathological process, including fat metabolism, glucose metabolism, cell proliferation and differentiation, tumorigenesis, inflammation and immune response. In current years, PPARγ is being focused in the field of gynecological disease by researchers. It is reported that PPARγ was expressed on endometrium and the activation of PPARγ may inhibit the growth of ectopic endometrium [16]. We got the hypothesis that PPARγ may change the biological character of endometrium, such as cell proliferation, apoptosis and invasion, by regulating the activation of transcriptional factor MAT2A. In present study, the pathogenesis of endometriosis was deeply claimed and new endometriosis diagnostic markers with higher specificity and sensitivity are investigated. The aim is to find more specified genetic target for future diagnosis and treatment of endometriosis.

Materials and methods

The collection of tissue samples The clinical samples were all collected from gynaecology and obstetrics department of the first affiliated hospital of Nanchang University. The samples of eutopic endometrium (Eu) and ectopic endometrium (Ec) were collected from 35 endometriosis patients after panhysterectomy. The samples of normal endometrium group (control) were collected from 35 women without endometriosis. The menstruation of all the patients are normal and there were no other malignant diseases, estrogen-dependent diseases, immune related diseases, surgical diseases, and inflammatory diseases on these patients. They have not received the treatments of gonadotropin-releasing hormone (GnRH) analogue, hormone or anti-inflammatory drugs within 6 months before the surgery. The endometrium was scraped immediately after the surgery, stored in the sterile medium containing 100 U/mL penicillin and streptomycin and transferred to the laboratory quickly for cell culture. The collection of human endometria got the authorization of all the patients and their family members. And the experiments were authorized by the ethical committee of the first affiliated hospital of Nanchang University. Immunohistochemistry The endometrium was separated out and put into the plate filled with pre-cool normal saline. The tissues were embedded in paraffin, sectioned, and incubated with Caspase-3 and VEGF antibody (Bioss, 1:1000). After incubation at 4°C overnight and washed over by PBS buffer, the slides were incubated with goat anti-rabbit antibody at 37°C for 30 min. After washed over by PBS buffer, the slides were dyed with DAB agent for 5-10 min and re-dyed with hematoxylin for 3 min. The pictures were taken on the slides under inverted microscope (Olympus). The separation of primary cells from eutopic endometrium tissue and normal tissues in endometrium The endometrium tissues were washed over by PBS for 3 times to remove the bloodiness and cut into 1 mm3 or smaller tissue blocks by eye scissors under sterile condition. 3 times volume of endometrium tissues buffer (0.1% type I collagenase and 0.25% trypsin containing EDTA) was added into the tissue. The mixture was transferred to the centrifuge tube after percussion for a while and digested for 20 min in the 37°C incubator. The supernatant was removed to stop the digestion and repeat the above operations for 3 times. DMEM/F12 medium containing 10% FBS was used to stop the digestion of the last collected tissues. The mixture was centrifuged at 1000 r/min for 5 min to remove the supernatant. The cells were re-suspended using DMEM/F12 medium containing 10% FBS and planted to the plate. The cells were incubated at 37°C in the incubator containing 5% CO2. The determination of the concentration of RSG The endometrium cells were incubated with 0, 1 μmol/L, 5 μmol/L, 10 μmol/L, 20 μmol/L and 40 μmol/L RSG for 48 h. The cell viability was detected by CCK8 assay. The detection of dual luciferin 13 groups of plasmids were used to perform the study. 293T cells were planted in the 6-well plate and transfected with (1) PPARγ over-expressed plasmids (Thermo). (2) Vector (Thermo) with the sequence of wild PPREs1 (Genscript). (3) Vector with the sequence of mutant PPREs1. (4) Vector with the sequence of wild PPREs2 (Genscript). (5) Vector with the sequence of mutant PPREs2. (6) Vector with the sequence of wild PPREs3 (Genscript). (7) Vector with the sequence of mutant PPREs3. (8) Vector with the sequence of wild PPREs4 (Genscript). (9) Vector with the sequence of mutant PPREs4. (10) Vector with the sequence of wild PPREs5 (Genscript). (11) Vector with the sequence of mutant PPREs5. (12) Vector with the total length of sequence of wild PPREs (Genscript). (13) Vector with the total length of sequence of mutant PPREs. 25 μL/well Opti-MEM (Thermo) was added into EP tubes. One tube was added with 0.75 μL/well lipofectamine 3000 (Lip 3000, Thermo) and another tube was added with 1 μL/well P3000 (Thermo). 1.2 μg/well plasmids (pRL-SV40, Thermo) was added into the diluted Lip 3000 except for the control group. 293T cells were mixed with the diluted Lip 3000 according to above divided groups and placed under room temperature for 15 min. 50 μL/well suspended cells were added into the wells of plate and collected 48 later. Experimental group 9 groups were divided in present study. (1) ESC; (2) ESC with PPARγ over-expressed (PPARγ); (3) ESC with scrambled plasmids (Vector); (4) ESC incubated with 10 μmol/L RSG (Solarbio R8470) (RSG); (5) ESC with PPARγ over-expressed incubated with 10 μmol/L RSG (PPARγ+RSG); (6) ESC with scrambled plasmids incubated with 10 μmol/L RSG (Vector+RSG); (7) NSC; (8) NSC with PPARγ silenced (sh PPARγ); (9) NSC with scrambled plasmids (Vector). The endometrium cells were planted in the 6-well plate diluted to 8×104 cells/well and incubated until all cells were adhere to the subface of wells and the density of cells reached 70%. 0.5 mL/well medium with no FBS were exchanged to incubate the endometrium cells. 2 sterile EP tubes were added with 125 μL/tube Opti-MEM. One tube was added with 5 μL Lip 3000 and another one was added with 2.5 μg plasmids and 5 μL P3000. The EP tubes were mixed individually and incubated under room temperature for 5 min. The solutions of the two tubes were mixed together and incubated under room temperature for 15 min. The mixture was divided into two equal duplicates and dropped into the wells accordingly. The cells were put back to the incubator and 0.5 mL medium containing 20% FBS was added into the wells 4 h post the transfection. 10 μmol/L RSG was added into the wells 48 h post the transfection according to above groups and incubated for 48 h. CCK8 assay for accessing proliferation of cells The cell density was settled as 6×103 cells/well. 10 μL of CCK-8 solution was added into each well of the plate using a repeating pipettor. The plate was incubated for 1-4 h and the absorbance at 450 nm was measured by a benchmark microplate reader (Bio-Rad, CA). Three independent assays were performed. The survival fraction was calculated according to the equation: inhibition rate = (ODcontrol - ODdrugs)/ODcontrol. Cell migration assay Matrigel (BD) was coated uniformly on the surface of the transwell bottom after being diluted 1:2 with serum-free medium and cells were seeded in 24-well culture plates and grown to 90% confluence. Subsequently, the transwell chamber and medium was discarded after 24 h incubating and migrated cells were stained with 0.1% crystal violet for 10 min after being fixed with ethanol for 30 min. The picture was taken by inverted microscope (OLYMPUS). Three independent assays were performed. Cell invasion assay Matrigel was coated uniformly on the surface of the transwell bottom after being diluted 1:3 with serum-free medium and cells were seeded in 24-well culture plates and grown to 90% confluence. The transwell chamber and medium were discarded after 24 h incubating and cells were stained with 0.1% crystal violet for 10 min after being fixed with ethanol for 30 min. The picture was taken by inverted microscope (OLYMPUS). Three independent assays were performed. Transmission electron microscope Endometrium cells in logarithmic growth phase were seeded in 24-well plates at a density of 1×105 cells/well, followed by treated with TM (50 μg/mL) for 48 h. After washed with cold PBS for 3 times, cells were digested with trypsin and collected by centrifugation to remove the supernatant. Finally, cells were fixed with 3% glutaraldehyde and 1% citric acid, gradually dehydrated by acetone and embedded with dipropylene dicarboxylate. The solid was cut into ultrathin sections. Ultrastructural changes of endometrium cells were observed and photographed under transmission electron microscopy. Real-time RT-PCR Total RNA of the cells was collected from the tissues using a RNA Extraction Kit (Takara) in terms of the instructions of the manufacture. RNA extracted was quantified with a NanoDrop spectrophotometer (NanoDrop Technologies). A specific RT primer was used to reverse-transcribe the complementary DNA. SYBR Premix Ex TaqTM (Takara) with an Applied Bio-Rad CFX96 Sequence Detection system (Applied Biosystems) was used in the real-time PCR procedure. The expression level of PPARγ and MAT2A was determined by the threshold cycle (Ct), and relative expression levels were calculated by the 2-ΔΔCt method after normalization with reference to the expression of U6 small nuclear RNA. The expression level of GAPDH in the tissue was taken as negative control. Three independent assays were performed. The information of the primers were shown in Table 1. Table 1. | Primer ID | Sequences | Length of the primer (bp) | Length of the product (bp) | Annealing temperature (°C) | |---|---|---|---|---| | PPARγ F | CCCAGGTTTGCTGAATGTG | 18 | 197 | 57.8 | | PPARγ R | TGTCTGTCTCCGTCTTCTTGAT | 20 | || | MAT2A F | TTGTGCCTGCGAAATACCT | 19 | 102 | 57 | | MAT2A R | CCCCAACCGCCATAAGT | 17 | || | GAPDH F | CAATGACCCCTTCATTGACC | 20 | 106 | 57.2 | | GAPDH R | GAGAAGCTTCCCGTTCTCAG | 20 | Western blot assay Nuclear and Cytoplasmic Protein Extraction Kit (Beyotime) was used to isolate the proteins from the cells. Approximately 35 μg of protein was separated on 12% SDS-polyacrylamide gel (SDS-PAGE). The gel was transferred to polyvinylidene difluoride (PVDF) membrane (Millipore). The membrane was blocked with 5% nonfat dry milk in TBST (Tris buffered saline/0.1% Tween-20, pH 7.4) for 1 h at room temperature and incubated overnight with primary rabbit anti-human antibodies to PPARγ (Abcam, 1:1000) and MAT2A (Abcam, 1:1000). A horseradish peroxidase-conjugated antibody against rabbit IgG (Abcam, 1:5000) was used as a secondary antibody. Blots were incubated with the ECL reagents (Beyotime, Jiangsu Province, China) and exposed to Tanon 5200-multi to detect protein expression. Three independent assays were performed. Statistical analysis

Results

are presented as mean ± SEM of at least three independent experiments. Each experiment was conducted in triplicate. Statistical significance among multiple groups was analyzed using Prism 7 software by one-way ANOVA followed by post-hoc Dunnett’s test, while Student’s t-test was applied for statistical analysis of two classes of data. P<0.05 was considered significant.

Result

The relative expression level of PPARγ and MAT2A in Eu, Ec and control tissue To evaluate the expressional difference of PPARγ and MAT2A in endometriosis, the clinical Eu, Ec and normal tissues were collected for detection. As shown in Figure 1A and 1B, MAT2A was up-regulated and PPARγ was down-regulated in Eu and Ec, compared with control (*P<0.05 vs control). No significant difference on expression of MAT2A and PPARγ was observed between Eu and Ec. The expressional difference was verified by the results of immunohistochemistry, which were shown in Figure 1C. The determination of the concentration for RSG To screen the optimal concentration of RSG to be incubated with endothelial cells, the cell viability of endothelial cells was evaluated following incubated with 0, 1, 5, 10, 20 and 40 μmol/L RSG. As shown in Figure S1, the cell viability of endometrium cells incubated with 10 μmol/L RSG was significantly lower than control (*P<0.05 vs 0 μmol/L), with no obvious difference for other four concentrations. Therefore, 10 μmol/L RSG was used for the subsequent experiments. The evaluation of the transfection of PPARγ over-expressed vector and PPARγ silenced vector A PPARγ over-expressed vector and a PPARγ silenced vector were transfected into the endothelial cells to achieve a PPARγ over-expressed and a PPARγ knock-down endothelial cells, respectively. As shown in Figure S2A, PPARγ was expressed as extremely higher level in the cells from PPARγ group than that from control group (*P<0.05 vs ESC), which indicated that the PPARγ over-expressed endometrium cell model was successfully established. As shown in Figure S2B, PPARγ in the cells from sh-PPARγ group was greatly down-regulated (*P<0.05 vs NSC), which indicated that the PPARγ silenced endometrium cell model was also successfully established. The combination of PPARγ with the promoter of MAT2A detected by dual luciferin To explore the interaction between PPARγ and the promoter of MAT2A, 6 sequences from the PPREs, including a total sequence and 5 partial sequences, were utilized to conduct the dual luciferin reporter assay. As shown in Figure 2, the fluorescence intensity of PPREs, PPREs1, PPREs4 and PPREs5 mutant group increased greatly, compared with that of wild type group, respectively (*P<0.05 vs wild type). The results indicated that PPARγ may have the ability of combining PPREs total sequence, PPREs1, PPREs4 and PPREs5 sequence of the promoter of MAT2A. The proliferation ability of endometrium cells from each group Figure 3A showed that the cell viability of endometrium cells from PPARγ, RSG, PPARγ+RSG and vector+RSG group was significantly lower than that from ESC group, respectively (*P<0.05 vs ESC). As show in Figure 3B, the cell viability of endometrium cells from shPPARγ group was increased greatly, compared with that from NSC group (*P<0.05 vs NSC). These results indicated that PPARγ may inhibit the proliferation of endometrium cells. The migration and invasion ability of endometrium cells from each group As shown in Figure 4A and 4B, the numbers of cells that migrate or invade over the transwell declined greatly from PPARγ, RSG, PPARγ+RSG and vector+RSG group, compared with that from ESC group (*P<0.05 vs ESC). Figure 4C and 4D showed that the numbers of cells that migrate or invade over the transwell from sh-PPARγ group were significantly higher than that from NSC group (*P<0.05 vs NSC). The results implied that PPARγ may inhibit migration and invasion ability of endometrium cells. The cellular structure of endometrium cells in each group TEM was used to detect the cellular microstructure of endothelial cells. As shown in Figure 5A and 5B, the cellular structure of endometrium cells from NSC, vector, and sh-PPARγ group was relatively integrated. The cytomembrane, structure of endoplasmic reticulum and mitochondria of endometrium cells from PPARγ and RSG group was integrated, with chromatin agglutination and a small number of vacuoles in the cytoplasm. Large amounts of vacuoles occur in the cytoplasm of endometrium cells from PPARγ+RSG group, with typical morphological changes of apoptotic cells. The expression level of PPARγ and MAT2A in endometrium cells from each group Figure 6A showed the mRNA and protein expression levels of PPARγ and MATA2A in the endometrium cells. In sh-PPARγ group, the expression of PPARγ declined and the expression of MAT2A was increased greatly, compared with NSC group (*P<0.05 vs NSC). As shown in Figure 6B, the expression level of MAT2A in the endometrium cells from PPARγ, RSG, PPARγ+RSG and Vector+RSG group was significantly lower than that from ESC group (*P<0.05 vs ESC). On the contrary, PPARγ in the endometrium cells from above group was greatly up-regulated (*P<0.05 vs ESC).

Discussion

Although endometriosis is a nonmalignant disease, it has the same biological characteristics as tumor, such as easy to relapse and migrate. And no matter for tumor or endometriosis, migration or invasion was a complicated progress regulated by multiple factors, with cell proliferation, angiogenesis, cell adhesion, apoptosis, cell migration and other biological progress involved. Abnormity tends to occur on the biomolecules within the ectopic endometrium from endometriosis patient, including the activation of oncogene [17,18], the excessive secretion of estrogen, the excessive expression of cytokines, prostaglandins, metalloproteinases and angiogenic factors [19]. In present study, endometrium cells were isolated from the endometriosis patients in our department. The agonists of PPARγ were reported to be potential inhibitors of cell proliferation [20] and could induce apoptosis [21]. They also could exert anti-angiogenesis effect by reducing the expression level of VEGF [22]. It is reported that the formulation of ectopic endometrium vascular was inhibited and the ectopic lesions was narrowed when RSG, an agonist of PPARγ, was used to treat endometriosis patient [23-25]. In present study, optimal concentration of RSG was picked out based on the impact of RSG on cell proliferation. It is reported that the mRNA and protein expression level of MAT2A in the endometrium from endometriosis patients was more than 3 times that from control [26], which indicated that the abnormal expression of MAT2A was closely related with the paroxysm of endometriosis. Prachi [27] reported that the expression level of MAT2A increased greatly when T cells was activated or deteriorated, which would result in the activation of cell proliferation and induce apoptosis [28]. It is reported that in T cells, the activity of methionine adenosyltransferase (MAT) II was inhibited and the expression of apoptosis related factor ligands (FasL) was induced by silencing the expression of MAT2A, which would lead to the up-regulation of caspase-3 and induce apoptosis [29]. Komal Ramani [30] reported that cis-acting element (PPREs) was involved in the promoter of MAT2A in the hematopoietic stem cells (HSCs) of rats and could interact with the trans-acting factor of PPARγ to regulate the inactive or active of cells. RSG was reported to inhibit the expression of MAT2A and the activity of MAT2A’s promoter, in which way, the activity of MAT2A and the combination with its promoter was inhibited. Also RSG could induce the combination of PPARγ with MAT2A PPREs to prevent its transcriptional activity [31]. Present study indicated that the promoters of MAT2A (PPREs1, PPREs4 and PPREs5), could combine with PPARγ. In the PPARγ over-expressed or RSG incubated endometrium cells, PPARγ was up-regulated and MAT2A was down-regulated greatly. These results indicated that there were negative correlation between the expression level of PPARγ and MAT2A. The activation of PPARγ was involved in multiple physiological and pathological process. Current researches indicated that the activation of PPARγ could exert anti-gynecologic malignant tumor activity, which may be related to its apoptotic inducing ability [32]. The activation of PPARγ was also reported to be effective in the protection of nervous system [33], which was related to its activity of anti-inflammatory and antioxidant stress response [34,35]. In present study, PPARγ was highly expressed in endometrium cells by transfecting the vector over-expressed with PPARγ. It is reported that in multiple types of tumor cells, after PPARγ was activated, the proliferation of tumor cells was inhibited, which resulted in the differentiation and apoptosis of tumor cells [36-39]. Present study indicated that the proliferation ability of endometrium cells declined greatly after over-expressed with PPARγ or incubated with RSG, along with the decrease of migration and invasion ability. In addition, classical morphological changes of apoptotic cells were observed. On the contrary, the ability of proliferation, migration and invasion was improved by silencing the expression of PPARγ in normal endometrium cells. These results indicated that the expression of PPARγ has great impact on the paroxysm of endometriosis. Taken together, over-expressed with PPARγ or incubated with RSG in ESC could decline the ability of proliferation, migration, and invasion of cells by decreasing the transcriptional activity of MAT2A gene. In addition, the in vitro characteristic of ESC could be achieved by silencing the expression of PPARγ in NSC.

Acknowledgements

This work was supported by grants from the National Natural Science Foundation of China (No. 81560247), Science and Technology Plan of Health Commission of Jiangxi Province (No. 20185124). Disclosure of conflict of interest None. Supporting Information

References

- 1.Bulun SE. Endometriosis. N Engl J Med. 2009;360:268–279. doi: 10.1056/NEJMra0804690. [DOI] [PubMed] [Google Scholar] - 2.Giudice LC, Kao LC. Endometriosis. Lancet. 2004;364:1789–1799. doi: 10.1016/S0140-6736(04)17403-5. [DOI] [PubMed] [Google Scholar] - 3.Ulukus M, Cakmak H, Arici A. The role of endometrium in endometriosis. J Soc Gynecol Investig. 2006;13:467–476. doi: 10.1016/j.jsgi.2006.07.005. [DOI] [PubMed] [Google Scholar] - 4.Yang H, Magilnick N, Noureddin M, Mato JM, Lu SC. Effect of hepatocyte growth factor on methionine adenosyltransferase genes and growth is cell density-dependent in HepG2 cells. J Cell Physiol. 2007;210:766–773. doi: 10.1002/jcp.20891. [DOI] [PubMed] [Google Scholar] - 5.Ramani K, Yang H, Xia M, Ara AI, Mato JM, Lu SC. Leptin’s mitogenic effect in human liver cancer cells requires induction of both methionine adenosyltransferase 2A and 2beta. Hepatology. 2008;47:521–531. doi: 10.1002/hep.22064. [DOI] [PMC free article] [PubMed] [Google Scholar] - 6.Cai J, Mao Z, Hwang JJ, Lu SC. Differential expression of methionine adenosyltransferase genes influences the rate of growth of human hepatocellular carcinoma cells. Cancer Res. 1998;58:1444–1450. [PubMed] [Google Scholar] - 7.Coppin JF, Qu W, Waalkes MP. Interplay between cellular methyl metabolism and adaptive efflux during oncogenic transformation from chronic arsenic exposure in human cells. J Biol Chem. 2008;283:19342–19350. doi: 10.1074/jbc.M802942200. [DOI] [PMC free article] [PubMed] [Google Scholar] - 8.Ma C, Yoshioka M, Boivin A, Belleau P, Gan L, Takase Y, Labrie F, St-Amand J. Prostate-specific genes and their regulation by dihydrotestosterone. Prostate. 2008;68:241–254. doi: 10.1002/pros.20712. [DOI] [PubMed] [Google Scholar] - 9.Lu SC, Mato JM. Role of methionine adenosyltransferase and S-adenosylmethionine in alcohol-associated liver cancer. Alcohol. 2005;35:227–234. doi: 10.1016/j.alcohol.2005.03.011. [DOI] [PubMed] [Google Scholar] - 10.Semple RK, Chatterjee VK, O’Rahilly S. PPAR gamma and human metabolic disease. J Clin Invest. 2006;116:581–589. doi: 10.1172/JCI28003. [DOI] [PMC free article] [PubMed] [Google Scholar] - 11.Ogawa D, Nomiyama T, Nakamachi T, Heywood EB, Stone JF, Berger JP, Law RE, Bruemmer D. Activation of peroxisome proliferator-activated receptor gamma suppresses telomerase activity in vascular smooth muscle cells. Circ Res. 2006;98:e50–59. doi: 10.1161/01.RES.0000218271.93076.c3. [DOI] [PubMed] [Google Scholar] - 12.Natarajan KR. Chemical inactivation of aflatoxins in peanut protein ingredients. J Environ Pathol Toxicol Oncol. 1992;11:217–227. [PubMed] [Google Scholar] - 13.Kubota T, Koshizuka K, Williamson EA, Asou H, Said JW, Holden S, Miyoshi I, Koeffler HP. Ligand for peroxisome proliferator-activated receptor gamma (troglitazone) has potent antitumor effect against human prostate cancer both in vitro and in vivo. Cancer Res. 1998;58:3344–3352. [PubMed] [Google Scholar] - 14.Demirturk F, Aytan H, Caliskan AC, Aytan P, Koseoglu DR. Effect of peroxisome proliferator-activated receptor-gamma agonist rosiglitazone on the induction of endometriosis in an experimental rat model. J Soc Gynecol Investig. 2006;13:58–62. doi: 10.1016/j.jsgi.2005.10.002. [DOI] [PubMed] [Google Scholar] - 15.Liu D, Zeng BX, Zhang SH, Wang YL, Zeng L, Geng ZL, Zhang SF. Rosiglitazone, a peroxisome proliferator-activated receptor-gamma agonist, reduces acute lung injury in endotoxemic rats. Crit Care Med. 2005;33:2309–2316. doi: 10.1097/01.ccm.0000183161.81503.7d. [DOI] [PubMed] [Google Scholar] - 16.Lebovic DI, Kavoussi SK, Lee J, Banu SK, Arosh JA. PPARgamma activation inhibits growth and survival of human endometriotic cells by suppressing estrogen biosynthesis and PGE2 signaling. Endocrinology. 2013;154:4803–4813. doi: 10.1210/en.2013-1168. [DOI] [PMC free article] [PubMed] [Google Scholar] - 17.Harada T, Taniguchi F, Izawa M, Ohama Y, Takenaka Y, Tagashira Y, Ikeda A, Watanabe A, Iwabe T, Terakawa N. Apoptosis and endometriosis. Front Biosci. 2007;12:3140–3151. doi: 10.2741/2302. [DOI] [PubMed] [Google Scholar] - 18.Dmowski WP, Ding J, Shen J, Rana N, Fernandez BB, Braun DP. Apoptosis in endometrial glandular and stromal cells in women with and without endometriosis. Hum Reprod. 2001;16:1802–1808. doi: 10.1093/humrep/16.9.1802. [DOI] [PubMed] [Google Scholar] - 19.Taylor RN, Lebovic DI, Mueller MD. Angiogenic factors in endometriosis. Ann N Y Acad Sci. 2002;955:89–100. doi: 10.1111/j.1749-6632.2002.tb02769.x. [DOI] [PubMed] [Google Scholar] - 20.Szychowski KA, Leja ML, Kaminskyy DV, Kryshchyshyn AP, Binduga UE, Pinyazhko OR, Lesyk RB, Tobiasz J, Gminski J. Anticancer properties of 4-thiazolidinone derivatives depend on peroxisome proliferator-activated receptor gamma (PPARgamma) Eur J Med Chem. 2017;141:162–168. doi: 10.1016/j.ejmech.2017.09.071. [DOI] [PubMed] [Google Scholar] - 21.Zhang Z, Yuan H, Zhao H, Qi B, Li F, An L. PPARgamma activation ameliorates postoperative cognitive decline probably through suppressing hippocampal neuroinflammation in aged mice. Int Immunopharmacol. 2017;43:53–61. doi: 10.1016/j.intimp.2016.12.003. [DOI] [PubMed] [Google Scholar] - 22.Yao F, Yu Y, Feng L, Li J, Zhang M, Lan X, Yan X, Liu Y, Guan F, Zhang M, Chen L. Adipogenic miR-27a in adipose tissue upregulates macrophage activation via inhibiting PPARgamma of insulin resistance induced by high-fat diet-associated obesity. Exp Cell Res. 2017;355:105–112. doi: 10.1016/j.yexcr.2017.03.060. [DOI] [PubMed] [Google Scholar] - 23.Wang XK, Sun T, Li YJ, Wang YH, Li YJ, Yang LD, Feng D, Zhao MG, Wu YM. A novel thiazolidinediones ATZD2 rescues memory deficits in a rat model of type 2 diabetes through antioxidant and antiinflammation. Oncotarget. 2017;8:107409–107422. doi: 10.18632/oncotarget.22467. [DOI] [PMC free article] [PubMed] [Google Scholar] - 24.Wu G, Jiao Y, Wu J, Ren S, Wang L, Tang Z, Zhou H. Rosiglitazone infusion therapy following minimally invasive surgery for intracranial hemorrhage evacuation decreased perihematomal glutamate content and blood-brain barrier permeability in rabbits. World Neurosurg. 2018;111:e40–e46. doi: 10.1016/j.wneu.2017.11.145. [DOI] [PubMed] [Google Scholar] - 25.Wei L, Mao J, Lu J, Gao J, Zhu D, Tian L, Chen Z, Jia L, Wang L, Fu R. Rosiglitazone inhibits angiotensin II-induced proliferation of glomerular mesangial cells via the galphaq/plcbeta4/TRPC signaling pathway. Cell Physiol Biochem. 2017;44:2228–2242. doi: 10.1159/000486056. [DOI] [PubMed] [Google Scholar] - 26.Chen Q, Zhang C, Chen Y, Lou J, Wang D. Identification of endometriosis-related genes by representational difference analysis of cDNA. Aust N Z J Obstet Gynaecol. 2012;52:140–145. doi: 10.1111/j.1479-828X.2011.01405.x. [DOI] [PubMed] [Google Scholar] - 27.Hote PT, Sahoo R, Jani TS, Ghare SS, Chen T, Joshi-Barve S, McClain CJ, Barve SS. Ethanol inhibits methionine adenosyltransferase II activity and S-adenosylmethionine biosynthesis and enhances caspase-3-dependent cell death in T lymphocytes: relevance to alcohol-induced immunosuppression. J Nutr Biochem. 2008;19:384–391. doi: 10.1016/j.jnutbio.2007.05.010. [DOI] [PMC free article] [PubMed] [Google Scholar] - 28.Maldonado LY, Arsene D, Mato JM, Lu SC. Methionine adenosyltransferases in cancers: mechanisms of dysregulation and implications for therapy. Exp Biol Med (Maywood) 2018;243:107–117. doi: 10.1177/1535370217740860. [DOI] [PMC free article] [PubMed] [Google Scholar] - 29.Jani TS, Gobejishvili L, Hote PT, Barve AS, Joshi-Barve S, Kharebava G, Suttles J, Chen T, McClain CJ, Barve S. Inhibition of methionine adenosyltransferase II induces FasL expression, Fas-DISC formation and caspase-8-dependent apoptotic death in T leukemic cells. Cell Res. 2009;19:358–369. doi: 10.1038/cr.2008.314. [DOI] [PubMed] [Google Scholar] - 30.Ramani K, Tomasi ML. Transcriptional regulation of methionine adenosyltransferase 2A by peroxisome proliferator-activated receptors in rat hepatic stellate cells. Hepatology. 2012;55:1942–1953. doi: 10.1002/hep.25594. [DOI] [PMC free article] [PubMed] [Google Scholar] - 31.Miyahara T, Schrum L, Rippe R, Xiong S, Yee HF Jr, Motomura K, Anania FA, Willson TM, Tsukamoto H. Peroxisome proliferator-activated receptors and hepatic stellate cell activation. J Biol Chem. 2000;275:35715–35722. doi: 10.1074/jbc.M006577200. [DOI] [PubMed] [Google Scholar] - 32.Kim S, Lee JJ, Heo DS. PPARgamma ligands induce growth inhibition and apoptosis through p63 and p73 in human ovarian cancer cells. Biochem Biophys Res Commun. 2011;406:389–395. doi: 10.1016/j.bbrc.2011.02.052. [DOI] [PubMed] [Google Scholar] - 33.Lee CH, Park OK, Yoo KY, Byun K, Lee B, Choi JH, Hwang IK, Kim YM, Won MH. The role of peroxisome proliferator-activated receptor gamma, and effects of its agonist, rosiglitazone, on transient cerebral ischemic damage. J Neurol Sci. 2011;300:120–129. doi: 10.1016/j.jns.2010.09.005. [DOI] [PubMed] [Google Scholar] - 34.Zuhayra M, Zhao Y, von Forstner C, Henze E, Gohlke P, Culman J, Lutzen U. Activation of cerebral peroxisome proliferator-activated receptors gamma (PPARgamma) reduces neuronal damage in the substantia nigra after transient focal cerebral ischaemia in the rat. Neuropathol Appl Neurobiol. 2011;37:738–752. doi: 10.1111/j.1365-2990.2011.01169.x. [DOI] [PubMed] [Google Scholar] - 35.Kaundal RK, Sharma SS. Ameliorative effects of GW1929, a nonthiazolidinedione PPARgamma agonist, on inflammation and apoptosis in focal cerebral ischemic-reperfusion injury. Curr Neurovasc Res. 2011;8:236–245. doi: 10.2174/156720211796558078. [DOI] [PubMed] [Google Scholar] - 36.Tylichova Z, Strakova N, Vondracek J, Vaculova AH, Kozubik A, Hofmanova J. Activation of autophagy and PPARgamma protect colon cancer cells against apoptosis induced by interactive effects of butyrate and DHA in a cell type-dependent manner: the role of cell differentiation. J Nutr Biochem. 2017;39:145–155. doi: 10.1016/j.jnutbio.2016.09.006. [DOI] [PubMed] [Google Scholar] - 37.Duggan C, Baumgartner RN, Baumgartner KB, Bernstein L, George S, Ballard R, Neuhouser ML, McTiernan A. Genetic variation in TNFalpha, PPARgamma, and IRS-1 genes, and their association with breast-cancer survival in the HEAL cohort. Breast Cancer Res Treat. 2018;168:567–576. doi: 10.1007/s10549-017-4621-x. [DOI] [PMC free article] [PubMed] [Google Scholar] - 38.Cheng Y, Jia B, Wang Y, Wan S. miR-133b acts as a tumor suppressor and negatively regulates ATP citrate lyase via PPARgamma in gastric cancer. Oncol Rep. 2017;38:3220–3226. doi: 10.3892/or.2017.5944. [DOI] [PubMed] [Google Scholar] - 39.Assumpção JAF, Magalhães KG, Corrêa JR. The role of ppargamma and autophagy in ros production, lipid droplets biogenesis and its involvement with colorectal cancer cells modulation. Cancer Cell Int. 2017;17:82. doi: 10.1186/s12935-017-0451-5. [DOI] [PMC free article] [PubMed] [Google Scholar] Associated Data This section collects any data citations, data availability statements, or supplementary materials included in this article.

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: oa-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Condition tags

endometriosis

Citation neighborhood

Papers in the corpus that this work cites (lower rings, blue) and that cite this one (upper rings, green). Dot size scales with the paper's in-corpus citation count — bigger dot = more influential within the endo/adeno field. Click a dot to open that paper. [ expand to 2 hops ] — adds papers reached through this work's immediate citers/citees. Heavier; up to 60 extra dots.

References (37)

Cited by (2)

Source provenance

europepmc
last seen: 2026-07-28T06:14:09.330459+00:00
openalex
last seen: 2026-05-11T03:55:50.355527+00:00
pubmed
last seen: 2026-05-13T22:24:43.494969+00:00
License: CC0 · commercial use OK