Up-regulated WNT5A in PCOS affects steroidogenesis, proliferation and apoptosis of granulosa cells through the PI3K/AKT pathway.

Thirty participants were enrolled in this study (15 PCOS patients and 15 controls). The main clinical features of the PCOS patients and the control group are shown in Table  2 . There was no significant difference in age, body mass index (BMI), basal follicle-stimulating hormone (FSH), estrogen (E 2 ) and progesterone (P) levels between PCOS and control groups. However, compared to the control group, The levels of luteinizing hormone (LH) ( P  < 0.01), anti-Müllerian hormone (AMH) ( P  < 0.0001), antral follicle count (AFC) ( P  < 0.0001) and testosterone (T) ( P  < 0.01) were higher in PCOS patients. Table 2 Clinical and biochemical characteristics of PCOS and control women Clinical parameters Control ( n  = 15) PCOS ( n  = 15) P -Value Age (years) 25.73 ± 2.58 27.17 ± 2.70 0.891 BMI (kg/m2) 19.08 ± 1.95 21.58 ± 3.09 0.168 FSH (IU/L) 5.69 ± 1.33 5.40 ± 1.51 0.199 LH (IU/L) 5.24 ± 2.80 11.87 ± 6.74 0.0019** AMH (ng/mL) 2.46 ± 1.48 9.80 ± 5.15 0.00003**** AFC (n) 11.09 ± 4.53 26.17 ± 10.39 0.00002**** T (ng/mL) 0.28 ± 0.12 0.49 ± 0.20 0.0037** E 2 (ng/mL) 39.91 ± 28.51 41.14 ± 18.56 0.945 P (ng/mL) 0.31 ± 0.22 0.25 ± 0.11 0.975 Abbreviations: BMI: body mass index; FSH: follicle-stimulating hormone; LH: luteinizing hormone; AMH: anti-Müllerian hormone; AFC: antral follicle count; T: testosterone; E 2 : estrogen; P: progesteron; values are expressed as the means ± SDs. * P  < 0.05, ** P  < 0.01, *** P  < 0.001, **** P  < 0.0001 Clinical and biochemical characteristics of PCOS and control women Abbreviations: BMI: body mass index; FSH: follicle-stimulating hormone; LH: luteinizing hormone; AMH: anti-Müllerian hormone; AFC: antral follicle count; T: testosterone; E 2 : estrogen; P: progesteron; values are expressed as the means ± SDs. * P  < 0.05, ** P  < 0.01, *** P  < 0.001, **** P  < 0.0001 To determine the expression of WNT5A in the ovaries of patients with PCOS, we collected follicular fluid and GCs from 15 patients with PCOS and 15 control patients. We found that WNT5A mRNA levels were significantly elevated in PCOS GCs compared with those in control GCs ( P  < 0.001, Fig.  1 A). ELISA assay revealed that the level of WNT5A in the follicular fluid of PCOS patients was higher than that in the follicular fluid of control patients ( P  < 0.01, Fig.  1 B). We verified the expression of WNT5A, which is localized in the cytoplasm, in KGN cells via an immunofluorescence assay (Fig.  1 D). In addition, qRT-PCR revealed that the mRNA expression of CYP19A1 was lower in the GCs of the PCOS group than that in those of the control group ( P  < 0.01, Fig.  1 C). Our previous findings indicated that the levels of inflammatory factors were elevated in the follicular fluid of PCOS patients [ 22 ]. To verify the relationship between WNT5A and inflammation, we stimulated KGN cells with 1 µg/mL LPS for 24 h. Western blot analysis revealed that LPS stimulation significantly upregulated WNT5A expression ( P  < 0.01, Fig.  1 E-F). Our results confirmed that increased WNT5A and decreased steroidogenesis gene expression in the ovaries of PCOS patients may be related to inflammation. Fig. 1 WNT5A was increased in the follicular fluid and GCs of PCOS patients. ( A ) WNT5A mRNA levels in the GCs of control and PCOS patients. ( B ) ELISA assay was used to determine the level of WNT5A in the follicular fluid of control and PCOS patients. ( C ) CYP19A1 mRNA levels in the GCs of control and PCOS patients. ( D ) Immunofluorescence staining was used to detect the expression of WNT5A in KGN cells. The expression of WNT5A in the cytoplasm is indicated by red fluorescence, and the nucleus is labelled with blue fluorescent DAPI. Scale bar: 100 μm. ( E ) The expression of WNT5A in KGN cells after LPS stimulation was detected by Western blot. ( F ) Graph showing the statistical analysis of the Western blot results shown in Fig. 1E. The values are expressed as the means ± SEMs ( n  = 3). * P  < 0.05, ** P  < 0.01, *** P  < 0.001, **** P  < 0.0001 WNT5A was increased in the follicular fluid and GCs of PCOS patients. ( A ) WNT5A mRNA levels in the GCs of control and PCOS patients. ( B ) ELISA assay was used to determine the level of WNT5A in the follicular fluid of control and PCOS patients. ( C ) CYP19A1 mRNA levels in the GCs of control and PCOS patients. ( D ) Immunofluorescence staining was used to detect the expression of WNT5A in KGN cells. The expression of WNT5A in the cytoplasm is indicated by red fluorescence, and the nucleus is labelled with blue fluorescent DAPI. Scale bar: 100 μm. ( E ) The expression of WNT5A in KGN cells after LPS stimulation was detected by Western blot. ( F ) Graph showing the statistical analysis of the Western blot results shown in Fig. 1E. The values are expressed as the means ± SEMs ( n  = 3). * P  < 0.05, ** P  < 0.01, *** P  < 0.001, **** P  < 0.0001 To further investigate the role of Wnt5a in PCOS, we established a PCOS mouse model. The schematic diagram of the animal model experiment is shown in Fig.  2 A. The estrous cycle of DHEA-treated mice was disrupted, as shown by vaginal smear examination on 14 consecutive days (Fig.  2 B). HE staining revealed enlarged cystic follicles and a reduced corpus luteum (CLS) in DHEA-treated mice (Fig.  2 C). The body weights and serum steroid levels of the mice after 21 days of DHEA exposure are shown in Fig.  2 D. Compared with those in the control group, the mice in the DHEA group had increased body weights ( P  < 0.01) and elevated serum androgen levels ( P  < 0.001). We propose that DHEA successfully induced the PCOS mouse model. Subsequently, ovarian tissues from control and DHEA-treated mice were collected, and the expression of Wnt5a and Cyp19a1 was examined. Follicle stimulating hormone receptor (FSHR) immunofluorescence staining is a specific stain for ovarian GCs [ 24 ]. We used this method to verify the accuracy of GC positioning. The results revealed that FSHR (green) positive staining was localized in GC cell membranes (Fig.  2 E). The distribution and intensity of Wnt5a and Cyp19a1 in the ovaries were analysed by immunofluorescence. The results revealed that the expression of Wnt5a in the ovarian GCs of DHEA-induced PCOS mice was significantly higher than that in the controls, whereas the expression of Cyp19a1 was decreased ( P  < 0.05 respectively, Fig.  2 F). Fig. 2 Increased expression of Wnt5a in the GCs of DHEA-treated PCOS mice. ( A ) Illustration of the animal model experiment. ( B ) Representative patterns of the estrous cycle in control and DHEA-treated mice. ( C ) Histology of control and DHEA-treated mouse ovaries. ( D ) Statistics of the body weights and serum steroid levels in control and DHEA-treated mice (** P  < 0.01, *** P  < 0.001, ns: not significant). The values are expressed as the means ± SEMs ( n  = 5). ( E ) Identification of GCs in ovarian sections of mouse ovaries via immunofluorescence assays. ( F ) Wnt5a and Cyp19a1 levels in mouse ovaries were detected via immunofluorescence staining. Scale bar: 100 μm. (* P  < 0.05) Increased expression of Wnt5a in the GCs of DHEA-treated PCOS mice. ( A ) Illustration of the animal model experiment. ( B ) Representative patterns of the estrous cycle in control and DHEA-treated mice. ( C ) Histology of control and DHEA-treated mouse ovaries. ( D ) Statistics of the body weights and serum steroid levels in control and DHEA-treated mice (** P  < 0.01, *** P  < 0.001, ns: not significant). The values are expressed as the means ± SEMs ( n  = 5). ( E ) Identification of GCs in ovarian sections of mouse ovaries via immunofluorescence assays. ( F ) Wnt5a and Cyp19a1 levels in mouse ovaries were detected via immunofluorescence staining. Scale bar: 100 μm. (* P  < 0.05) To mimic aberrant expression of WNT5A in PCOS GCs, we used lentivirus expression vector to stably overexpress WNT5A in KGN cells. Western blot and qPCR results verified the efficiency of WNT5A overexpression (Fig.  3 A-B). Western blot was used to detect the protein expression of key enzymes involved in steroidogenesis. The results revealed that the protein expression levels of the CYP11A1, CYP19A1, STAR and FSH receptor (FSHR), LH receptor (LHR) proteins were decreased in KGN cells overexpressing WNT5A (NC vs. OE-WNT5A CYP11A1: p  < 0.05; CYP19A1: p  < 0.01; STAR: p  < 0.01; FSHR: p  < 0.001; LHR: p  < 0.05) (Fig.  3 C). The secretion of estradiol (E 2 ) and progesterone (PROG) by KGN cells was significantly decreased (Fig.  3 E). Subsequently, siRNA interference fragments were used to suppress the abnormal expression of WNT5A in KGN cells. Decreased expression of WNT5A increased the protein expression levels of the CYP11A1, CYP19A1, STAR, FSHR and LHR proteins in KGN cells (control vs. si-WNT5A CYP11A1: p  < 0.01; CYP19A1: p  < 0.01; STAR: p  < 0.05; FSHR: p  < 0.05; LHR: p  < 0.05) (Fig.  3 D). We also performed an independent WNT5A rescue assay in KGN cells to further validate its effect on proteins related to steroid hormone synthesis. Specifically, KGN cells stably overexpressing WNT5A were transfected with siRNAs, and Western blot results revealed that the protein expression levels of CYP11A1, CYP19A1, STAR, FSHR and LHR could returned to normal after 48 h of culture (Fig.  3 F). Therefore, we propose that WNT5A can affect the secretion of steroid hormones and the activity of key enzymes in steroidogenesis. Fig. 3 WNT5A inhibited the activity of key enzymes involved in steroidogenesis and the secretion of steroid hormones. ( A ) Western blot analysis of WNT5A expression in stable WNT5A-overexpressing KGN cells. ( B ) qPCR analysis of WNT5A expression in stable WNT5A-overexpressing KGN cells. ( C ) The expression levels of the steroidogenesis-related genes STAR, CYP11A1, CYP19A1, FSHR and LHR in KGN cells after overexpressing WNT5A were detected via Western blot. ( D ) The expression levels of the steroidogenesis-related proteins STAR, CYP11A1, CYP19A1, FSHR and LHR in KGN cells transfected with WNT5A siRNA were detected via Western blot. ( E ) ELISA was used to detect estradiol and progesterone levels in the culture filtrate of KGN cells overexpressing WNT5A. ( F ) The expression levels of the steroidogenesis-related genes STAR, CYP11A1, CYP19A1, FSHR and LHR in WNT5A-overexpressing KGN cells transfected with WNT5A siRNA were detected via Western blot. The values are expressed as the means ± SEMs ( n  = 3). ns: not significant, * P  < 0.05, ** P  < 0.01, *** P  < 0.001, **** P  < 0.0001 WNT5A inhibited the activity of key enzymes involved in steroidogenesis and the secretion of steroid hormones. ( A ) Western blot analysis of WNT5A expression in stable WNT5A-overexpressing KGN cells. ( B ) qPCR analysis of WNT5A expression in stable WNT5A-overexpressing KGN cells. ( C ) The expression levels of the steroidogenesis-related genes STAR, CYP11A1, CYP19A1, FSHR and LHR in KGN cells after overexpressing WNT5A were detected via Western blot. ( D ) The expression levels of the steroidogenesis-related proteins STAR, CYP11A1, CYP19A1, FSHR and LHR in KGN cells transfected with WNT5A siRNA were detected via Western blot. ( E ) ELISA was used to detect estradiol and progesterone levels in the culture filtrate of KGN cells overexpressing WNT5A. ( F ) The expression levels of the steroidogenesis-related genes STAR, CYP11A1, CYP19A1, FSHR and LHR in WNT5A-overexpressing KGN cells transfected with WNT5A siRNA were detected via Western blot. The values are expressed as the means ± SEMs ( n  = 3). ns: not significant, * P  < 0.05, ** P  < 0.01, *** P  < 0.001, **** P  < 0.0001 Polycystic ovary syndrome is associated with abnormal follicle formation [ 25 ]. GCs are crucial for follicle development [ 26 , 27 ]. Therefore, we investigated whether WNT5A is involved in the proliferation and apoptosis of KGN cells. The number of TUNEL-positive cells increased significantly in rh-WNT5A treatment KGN cells ( P  < 0.01) (Fig.  4 A.F). The effect of rh-WNT5A on apoptosis of KGN cells was detected by flow cytometry and similar results were obtained. Recombinant human WNT5A treatment significantly increased the proportion of apoptotic KGN cell compared with the control group (Control vs. rh-WNT5A: 8.12%±2.01 vs. 15.81%±3.12, P  < 0.01) (Fig.  4 C.H). Western blot analysis verified that rh-WNT5A group has a higher level of BAX and cleaved caspeas-3 expression (BAX: P  < 0.05; cleaved caspsae-3: P  < 0.05) and lower BCL-2 expression ( P  < 0.05) than the control group (Fig.  4 D.I). Then, EdU assay was subsequently used to inspect the proliferation of KGN cells treated with recombinant WNT5A protein. The results showed that the proportion of EdU positive cells decreased significantly after rh-WNT5A treatment ( P  < 0.001) (Fig.  4 B.G). In addition, we employed CCK8 assay to measure cell counts at different time points.We observed a significant reduction in cell counts in the rh-WNT5A group compared to the control group at both 12 and 24 h (12 h: P  < 0.01; 24 h: P  < 0.05) (Figure EI). The cell cycle distribution of KGN cells after rh-WNT5A stimulation was detected by the flow cytometry. The results showed that rh-WNT5A group exhibited S-phase arrest compared with controls (Fig.  4 J). These results provide further evidence for the role of WNT5A in promoting KGN cell apoptosis, inhibiting KGN cell proliferation and regulating cell cycle. Fig. 4 WNT5A affected the proliferation and apoptosis of KGN cells. ( A, F ) Representative micrographs and ratios of TUNEL-positive KGN cells. Scale bar: 100 μm. ( B, G ) Representative micrographs and ratios of EdU-positive KGN cells. Scale bar: 50 μm. ( C , H ) Annexin V-FITC/ PI staining and flow cytometric analysis. ( D ) The expression levels of BAX, BCL-2, caspase3 and cleaved-caspase3 in KGN cells after rh-WNT5A treatment was detected by Western blot. ( E ) CCK-8 proliferation assay of KGN treated with 200 ng/mL rh-WNT5A. ( I ) Graph showing the statistical analysis of the Western blot results in Fig. 4D. ( J ) Cell cycle distribution of KGN in G1, S, and G2/M phases as determined by flow cytometry following rh-WNT5A treatment. The values are expressed as the means ± SEMs ( n  = 3). * P  < 0.05, ** P  < 0.01, *** p  < 0.001, **** p  < 0.0001, ns: not significant WNT5A affected the proliferation and apoptosis of KGN cells. ( A, F ) Representative micrographs and ratios of TUNEL-positive KGN cells. Scale bar: 100 μm. ( B, G ) Representative micrographs and ratios of EdU-positive KGN cells. Scale bar: 50 μm. ( C , H ) Annexin V-FITC/ PI staining and flow cytometric analysis. ( D ) The expression levels of BAX, BCL-2, caspase3 and cleaved-caspase3 in KGN cells after rh-WNT5A treatment was detected by Western blot. ( E ) CCK-8 proliferation assay of KGN treated with 200 ng/mL rh-WNT5A. ( I ) Graph showing the statistical analysis of the Western blot results in Fig. 4D. ( J ) Cell cycle distribution of KGN in G1, S, and G2/M phases as determined by flow cytometry following rh-WNT5A treatment. The values are expressed as the means ± SEMs ( n  = 3). * P  < 0.05, ** P  < 0.01, *** p  < 0.001, **** p  < 0.0001, ns: not significant Previous studies have shown that abnormal WNT5A signalling is associated with activation of the PI3K/AKT pathway [ 20 , 28 ]. To further investigate the potential molecular mechanism underlying the regulatory effect of WNT5A on steroidogenesis in GCs, we examined the expression of AKT and p-AKT in KGN cells overexpressing WNT5A. Western blot analysis revealed that WNT5A can upregulate the expression of p-AKT, indicating its ability to activate the PI3K/AKT signalling pathway (Fig. 5 A-B). After treatment of cells with a PI3K/AKT pathway inhibitor (LY-294002), western blot analysis showed that LY-294002 reversed the effects of overexpression of WNT5A on the expression of CYP11A1, CYP19A1, STAR, FSHR and LHR in KGN cells (Fig. 5 C-D). These results indicated that inhibition of PI3K/AKT pathway could reverse the inhibitory effect of WNT5A on steroidogenesis. Therefore, these findings suggest that WNT5A may modulate steroid hormone synthesis through the PI3K/AKT signalling pathway. Fig. 5 WNT5A affected the steroidogenesis genes by activating the PI3K/AKT pathway. ( A ) The expression levels of AKT and p-AKT in KGN cells after overexpression of WNT5A was detected by Western blot. ( B ) Graph showing the statistical analysis of Western blot results in Fig. 5A. Values are expressed as the mean ± SEM ( n  = 3). * P  < 0.05. ( C ) The expression levels of steroidogenesis-related proteins STAR, CYP11A1, CYP19A1, FSHR and LHR in KGN cell after adding PI3K/AKT pathway inhibitor (LY-294002) was detected by Western blot. ( D ) Graph showing the statistical analysis of Western blot results in Fig. 5C. The values are expressed as the means ± SEMs ( n  = 3). * P  < 0.05, ** P  < 0.01, ns: not significant WNT5A affected the steroidogenesis genes by activating the PI3K/AKT pathway. ( A ) The expression levels of AKT and p-AKT in KGN cells after overexpression of WNT5A was detected by Western blot. ( B ) Graph showing the statistical analysis of Western blot results in Fig. 5A. Values are expressed as the mean ± SEM ( n  = 3). * P  < 0.05. ( C ) The expression levels of steroidogenesis-related proteins STAR, CYP11A1, CYP19A1, FSHR and LHR in KGN cell after adding PI3K/AKT pathway inhibitor (LY-294002) was detected by Western blot. ( D ) Graph showing the statistical analysis of Western blot results in Fig. 5C. The values are expressed as the means ± SEMs ( n  = 3). * P  < 0.05, ** P  < 0.01, ns: not significant

This study was approved by the Ethics Committee of the First Hospital of Chongqing Medical University (Ethics No. 2023-95). Patients who underwent IVF/ICSI-ET at the Reproductive Medicine Centre of the First Affiliated Hospital of Chongqing Medical University between October 2022 and August 2023 were enrolled in the study, and informed consent was obtained from all participants. Thirty follicular fluid and granulosa cell samples were obtained from 15 patients with PCOS and 15 patients with other causes of infertility (controls). All patients with PCOS were diagnosed according to the Rotterdam criteria proposed by the European Society for Human Reproductive Medicine (ESHRE) and the American Society for Reproductive Medicine (ASRM) in 2003, such as: (1) sporadic ovulation or anovulation; (2) hyperandrogenism and hyperandrogenemia; (3) polycystic ovarian morphology (PCOM), with ultrasound evidence of more than 12 follicles 2–9 mm in diameter in one or both ovaries or an ovarian volume of more than 10 mL; any two of the three diagnostic criteria are met. Other causes of hyperandrogenism and congenital adrenocortical hyperplasia, Cushing’s syndrome, and androgen-secreting tumours were excluded. All women with gynecological or other systemic diseases (e.g. diabetes mellitus, premature ovarian failure, endometriosis, thyroid dysfunction and other hyperandrogenic manifestations) and obesity were excluded from this study [ 22 ]. Basic clinical information of the participants was collected before collecting samples of follicular fluid and ovarian GCs from the participants. The human ovarian granulosa cell line KGN was purchased from the American Typical Culture Collection (ATCC, USA) and cultured in DMEM/F12 medium containing 10% fetal bovine blood and 1% penicillin-streptomycin (Gibco, USA). All the cells were grown under standard culture conditions (37 °C and 5% CO 2 humidified air). Different treatments for KGN cells: Control: KGN cells without any treatment. LPS treatment: 1 µg/mL LPS (Sigma-Aldrich, USA) was given for 24 h after the KGN cell density reached 60–70%. WNT5A treatment: The cells were treated with 200 ng/mL rh-WNT5A (R&D Systems, Minneapolis, MN) for 24 h after the KGN cell density reached 60–70%. Lentiviral treatment: Lentiviruses overexpressing the WNT5A plasmid were purchased from Gemma Biotechnology Co (Shanghai, China). In the pre-experiment, the MOI for lentivirus infection of KGN cells was determined to be 10. The lentivirus was transfected when the KGN cells reached 60%-70% confluence. The original culture medium was discarded and lentivirus-containing culture medium was added to the culture wells. The culture medium was replaced after 24 h. The cells were collected after 48 h. Subsequently, the cells were cultured in medium supplemented with 2 µg/mL puromycin (Beyotime, Shanghai, China) for 2 weeks to obtain stably transfected cell lines. siRNA treatment: The cells were inoculated into 6-well plates at a density of 1.5 × 105 cells/mL and transfected when the cell density reached 70%. Liposomal Lipofectamine™ 2000 Transfection Reagent (Thermo Fisher Scientific, USA) was used according to the manufacturer’s instructions. Different volumes of siRNA plasmid and transfection reagent were diluted with 250 µL of serum-reduced medium, and a concentration gradient was set up. After 6 h of transfection, the medium was changed to DMEM/F12 medium containing 10% serum and 1% penicillin-streptomycin, and the mixture was incubated at 37℃ with 5% CO 2 for 48 h. The siRNA sequences with high interference efficiency were detected via qRT-PCR and Western blot for subsequent experiments. OE-WNT5A/ siWNT5A group: OE-WNT5A cells were cultured for 24 h, followed by culture of siWNT5A cells for 48 h. Control: KGN cells without any treatment. LPS treatment: 1 µg/mL LPS (Sigma-Aldrich, USA) was given for 24 h after the KGN cell density reached 60–70%. WNT5A treatment: The cells were treated with 200 ng/mL rh-WNT5A (R&D Systems, Minneapolis, MN) for 24 h after the KGN cell density reached 60–70%. Lentiviral treatment: Lentiviruses overexpressing the WNT5A plasmid were purchased from Gemma Biotechnology Co (Shanghai, China). In the pre-experiment, the MOI for lentivirus infection of KGN cells was determined to be 10. The lentivirus was transfected when the KGN cells reached 60%-70% confluence. The original culture medium was discarded and lentivirus-containing culture medium was added to the culture wells. The culture medium was replaced after 24 h. The cells were collected after 48 h. Subsequently, the cells were cultured in medium supplemented with 2 µg/mL puromycin (Beyotime, Shanghai, China) for 2 weeks to obtain stably transfected cell lines. siRNA treatment: The cells were inoculated into 6-well plates at a density of 1.5 × 105 cells/mL and transfected when the cell density reached 70%. Liposomal Lipofectamine™ 2000 Transfection Reagent (Thermo Fisher Scientific, USA) was used according to the manufacturer’s instructions. Different volumes of siRNA plasmid and transfection reagent were diluted with 250 µL of serum-reduced medium, and a concentration gradient was set up. After 6 h of transfection, the medium was changed to DMEM/F12 medium containing 10% serum and 1% penicillin-streptomycin, and the mixture was incubated at 37℃ with 5% CO 2 for 48 h. The siRNA sequences with high interference efficiency were detected via qRT-PCR and Western blot for subsequent experiments. OE-WNT5A/ siWNT5A group: OE-WNT5A cells were cultured for 24 h, followed by culture of siWNT5A cells for 48 h. Ten female wild-type C57BL/6J mice (3 weeks old) provided by Beijing Vital River Laboratory Animal Technology Co., Ltd., were housed at a controlled temperature with a 12 h light/dark cycle. The design of this research animal experiment was reviewed and approved by the Animal Ethics Committee of Chongqing Medical University (Ethics No. IACUC-CQMU-2024-10122), and the experimental process was carried out in strict accordance with the requirements of the regulations on the management of experimental animals. On the 21st day after birth, the mice with similar body weights were randomly divided into 2 groups (5 mice/group): the control group was injected subcutaneously with 0.1 mL of corn oil every day for 21 consecutive days; and the treatment group was injected subcutaneously with 0.1 mL of a DHEA solution (concentration of 60 mg/kg, solvent corn oil) every day for 21 consecutive days. The body weights of the mice were measured and recorded every 2 days. After the 9th day of treatment, the mice were identified as having an estrous cycle by means of vaginal smears. The motility cycle of the mice was monitored via light microscopic observation of the three main cell types, leukocytes, keratinized cells and epithelial cells, in the vaginal smears. If vaginal smears were observed to consistently show clumps of nucleated keratinized cells similar to those in the estrous phase, the PCOS model could be considered successfully constructed. After successful modelling, the mice were euthanized via inhalation, and anaesthetic and ovarian specimens were collected. The entire observation period lasted 21 consecutive days. The flowchart of this experiment is shown in Fig.  2 A. Follicular fluid and blood were collected from humans and mice, which were allowed to stand on ice for 2 h and then centrifuged at 4000 rpm for 5 min at 4 °C to collect the supernatant for ELISA assay. The cells overexpressing WNT5A were cultured in 6 cm dishes for a period of time, after which the culture medium was collected for ELISA. The absorbance at 450 nm was measured via an enzyme marker (Switzerland, Sunrise, F 50) following the manufacturer’s instructions and the concentration of the sample (pg/mL) was calculated from the standard curve. The tissue and cell sections were fixed in 4% paraformaldehyde for 15 min and then permeabilized with 0.3% Triton X-100 for 4 min, followed by 0.5% Triton X-100 for 10 min. Following permeabilization, the sections were blocked with 5% BSA in phosphate-buffered saline (PBS) for 1 h at room temperature. The sections were then incubated overnight at 4 °C with the following primary antibodies: anti-WNT5A (1:200, Proteintech) and anti-CYP19A1 (1:200, Proteintech). The secondary Alexa Fluor 594-conjugated antibodies were purchased from Proteintech and used at a 1:1,000 dilution. The slides were washed and incubated with an anti-fluorescence quenching sealer (containing DAPI) for 10 min. Slides of the tissue and cell samples were photographed via an Olympus fluorescence microscope and the ratio of positive cells was calculated via ImageJ software. Total RNA was extracted from GCs and KNG cells via TRIzol reagent (Accurate Biotechnology, Changsha, China). The cells were mixed with TRIzol for 5 min for cell lysis. Then, 0.2 mL of chloroform was added to each 1 mL of TRIzol, the mixture was shaken vigorously for 15 s and left at room temperature for 5 min. The mixture was centrifuged at 4 °C x 12,000 g for 15 min and the upper phase (colorless water phase) was transferred to another Ep tube. An equal volume of isopropyl alcohol was added, the mixture was mixed well, and the mixture was incubated at room temperature for 10 min. The mixture was subsequently centrifuged at 4 °C x 12,000 g for 10 min, after which the supernatant was discarded. Add 1 mL 75% ethanol, and the mixture was centrifuged at 4 °C x 7500 g for 5 min. The supernatant was discarded, the precipitate was dried, and 10 µL of diethyl pyrocarbonate water (DEPC) was added to reinsert the RNA. cDNA was synthesized via the Evo M-MLV RT Mix Kit with gDNA Clean for qPCR (Accurate Biotechnology, Changsha, China), and qPCR was performed via SYBR Premix Ex Taq (Accurate Biotechnology, Changsha, China) and LightCycler™ 96 instrument (Roche, Switzerland). Amplify according to the following steps: (1) 95 °C for 10 min; (2) 95 °C for 10 s; (3) Anneal primers at their optimal temperature for 30 s; (4) 72 °C for 10 s; (5) Repeat steps two to four 39 times; (6) The temperature was increased from 65 °C to 95 °C every 5 s. GAPDH, WNT5A and CYP19A1 fragments were amplified via primers for GAPDH, WNT5A and CYP19A1 (Accurate Biotechnology, Changsha, China). The primer sequences are shown in Table  1 . Table 1 Primer sequences Forward Reverse Product size GAPDH (human) GCACCGTCAAGGCTGAGAAC TGGTGAAGACGCCAGTGGA 138 bp WNT5A (human) CTTGAGCACGACGAAGCAAC GACAAAGGGGTGAGGCAGAA 109 bp CYP19A1 (human) CCTTGTTCGTATGGTCACAGTCT CGTGTTAGAGGTGTCCAGCAT 136 bp Primer sequences Proteins from different groups of KGN cells were isolated via homogenization in RIPA lysis containing protease and phosphatase inhibitors (Selleck Chemicals, USA). After the total protein concentration was determined via a BCA protein assay kit (Beyotime, Shanghai, China), the proteins were added to the SDS-PAGE gel wells, electrophoretically separated from the proteins, transferred to a PVDF membrane (Millipore Sigma, USA), incubated with 5% skim milk powder for 2 h at room temperature, and incubated with anti-WNT5A (1:1000), anti-CYP11A1 (1:1000), anti-CYP19A1 (1:1000), anti-FSHR (1:1000), anti-LHR (1:1000), anti-STAR (1:1000), anti-AKT (1:1000), anti-P-AKT (1:1000), anti-BAX (1:1000), anti-BCL2 (1:1000), anti-caspase 3 (1:1000), anti-cleaved caspase 3 (1:1000), anti-β-actin (1:1000) and anti-GAPDH (1:1000) incubated overnight. After being washed at least three times with TBS (Beyotime, Shanghai, China), the cells were incubated with horseradish peroxidase-labelled rabbit anti-mouse IgG or goat anti-rabbit IgG (Zhongshan Jinqiao, 1;5000) antibodies for 1 h at room temperature. Protein blots were detected via an enhanced chemiluminescence kit (Millipore Sigma, USA) and quantitatively analysed using Image. Cell cycle analysis was performed via flow cytometry. KGN cells subjected to different treatments were digested with EDTA-free trypsin, washed with DPBS and then collected. The cells were rinsed with precooled PBS and fixed in 70% alcohol at 4 °C overnight. The cells were subsequently stained with propidium iodide (PI) solution for 30 min at room temperature in the dark. Apoptosis was assessed via an Annexin V-FITC/PI Apoptosis Detection Kit (Vazyme, Nanjing, China). KGN cells subjected to different treatments were digested with EDTA-free trypsin, washed with DPBS and then collected. 100 µL of 1 × binding buffer was added to suspend the cells, which were then mixed with 5 µL of Annexin V-FITC and 5 µL of PI. The reaction was performed for 10 min at room temperature under light-avoidance conditions. Then, 400 µL of 1 × binding buffer was added to each sample and mixed. The samples were then analysed via FACScan flow cytometry (BD Biosciences, San Jose, CA, USA). According to the manufacturer’s instructions, cell proliferation was detected via the EdU cell proliferation method. Differently treated KGN cells were inoculated into 24-well plates and incubated overnight in incubators. The cells were labelled by adding 500 µL of EdU (10 µM) reagent (Beyotime, Shanghai, China) per well for 2 h of incubation. The cells were fixed in 4% paraformaldehyde solution for 15 min, permeabilized with 0.3% Triton X-100 for 15 min, and washed with PBS containing 3% BSA. The cells were then incubated with Click reaction reagent for 30 min at room temperature in a dark environment. The cell nuclei were counterstained with 1×Hoechst 33,342 reagent. The staining results were observed via an Olympus fluorescence microscope, and the percentage of positive cells was calculated via ImageJ software. TUNEL staining was performed with a one-step TUNEL apoptosis detection kit (Beyotime, Shanghai, China). KGN cells in the control group and treatment group were inoculated into 24-well plates, fixed with 4% paraformaldehyde, stained with PBS containing 0.3% Triton X-100 in PBS, and then incubated with fluorescein-labelled TdTase for 60 min at 37 °C in a humid, dark chamber. All the slides were washed, and the cell nuclei were stained with DAPI. Slides of cell samples were photographed with an Olympus fluorescence microscope, and the percentage of positive cells was calculated via ImageJ software. Cell proliferation was assessed via a CCK-8 assay (Beyotime, Shanghai, China) according to the manufacturer’s protocol. The cells were inoculated into 96-well plates at a density of 1500 cells per well and incubated under standard conditions. The cells were divided into control group and rh-WNT5A group, and cultured with 200 µg/mL rh-WNT5A medium after cell adhesion. At 0 h, 12 h and 24 h time points, 10 µL of CCK-8 solution was added to each well away from light, and the mixture was incubated at 37℃ for 1 h. Absorbance at 450 nm was measured via an enzyme-labeler to assess cell proliferation. Each experiment was conducted in triplicate, with 6 duplicate wells in each group to ensure reproducibility. To ensure adequate statistical power in our study design, a priori sample size estimation was performed using G*Power 3.1. The calculation assumed a moderate effect size (Cohen’s *d* = 0.5) with a significance level (α) of 0.05 and 80% power (1-β = 0.80). This analysis determined a minimum requirement of 15 participants per group. Our final cohort of 15 PCOS patients and 15 controls therefore satisfies statistical prerequisites for preliminary effect assessment. In the animal experiments, 5 mice were used as the sample size for each group. This sample size selection was based on the commonly adopted standard in the field when conducting preliminary exploratory studies using PCOS animal models [ 23 ]. This approach adheres to the ethical principle of reduction under the 3R framework. We tested the data for normality by the Shapiro-Wilk test to confirm that the data conformed to a normal distribution, and then analysed the data within the mouse group using the independent samples t-test (Student’s t-test) to ensure statistical validity. All data were statistically analysed via SPSS 19.0 (IBM, Armonk, NY, USA) and GraphPad Prism 9.0 (GraphPad Software, San Diego, CA). Normality was assessed for all datasets using the Shapiro-Wilk test. Normally distributed data were presented as mean ± standard deviation (SD). Differences between two groups were compared using the independent samples t test (Student’s t test). All statistical tests were two-tailed, and p  < 0.05 was considered statistically significant. One-way ANOVA was used for comparisons of data from multiple groups. Each assay was performed in triplicate. Two-by-two comparisons were made using Tukey’s post hoc test for cases where the data met normal distribution.

As a proinflammatory factor, WNT5A has been implied related to PCOS. In this study, we identified that WNT5A expressions were increased in follicular fluid and GCs of PCOS patients, and in the ovary of PCOS murine model. We found that overexpression of WNT5A could inhibit proliferation, promote apoptosis and suppress the expression of genes related to steroidogenesis in KGN cells. WNT5A activated the PI3K/AKT pathway, and inhibition of which reversed the effect of WNT5A on the steroidogenesis genes in KGN cells. The present study suggests aberrant WNT5A in PCOS may inhibit steroid hormone secretion of ovarian GCs through the PI3K/AKT pathway. The ovaries have endocrine and ovulatory functions [ 29 ]. Steroid hormones secreted by GCs support the development and maturation of oocytes [ 30 ]. An inflammatory response occurs in the ovaries under normal physiological conditions. Local immune effector cells macrophages and lymphocytes in ovarian tissue can secrete a variety of inflammatory factors. Excessive inflammation can promote the development of PCOS by affecting steroid hormone production and ovarian GCs apoptosis [ 31 , 32 ]. Current research suggests that inflammation is also involved in ovulation [ 33 ]. Moderate inflammatory stimulation contributes to normal follicle development and ovulation. However, excessive inflammatory stimulation can disrupt normal follicle dynamics, leading to ovulation disorders [ 34 ]. Therefore, chronic low-grade inflammation plays an irreplaceable role in the progression of PCOS. Our research has revealed an interesting link between inflammation and the expression of WNT5A. Specifically, we found that inflammatory conditions can increase the level of WNT5A. In our earlier studies, we discovered that inflammation hinders the expression of key genes involved in steroid hormone production. Overexpression of WNT5A also results in the same inhibitory effect. Our findings highlight the intricate interplay between inflammation and hormonal regulation in the ovaries, which could be crucial for understanding the mechanisms underlying PCOS. The synthesis of steroid hormones is a complex process that requires the involvement of several enzymes. STAR, CYP11A1 and CYP19A1 are key enzymes involved in it. STAR mediates the internalization of cholesterol from the cytoplasm to the mitochondria, which is the initial step in steroidogenesis. Cholesterol is converted to pregnenolone by CYP11A1, and through a series of biological processes, testosterone and oestrone are converted to estradiol in the ovary by CYP19A1 or 17β-HSD [ 35 – 37 ]. In this study, we demonstrated the effect of WNT5A on steroid hormone synthesis in GCs via the transfection of WNT5A siRNA and lentivirus overexpressing WNT5A. We found that overexpression of WNT5A inhibited the expression of STAR, CYP11A1, CYP19A1, FSHR and LHR at the protein level. Moreover, overexpression of WNT5A significantly reduced the levels of estrogen and progesterone secreted by GCs. Atefeh Abedini et al. observed that Wnt5a treatment can down-regulate mRNA expression of FSHR, LHR and CYP19A1 [ 38 ]. These findings are consistent with our results from the perspective of mRNA. In addition, we found that knocking down WNT5A expression upregulated the expression of key enzymes involved in steroidogenesis. Our study confirmed that overactivated WNT5A in PCOS is associated with abnormal steroidogenesis, which may be one of the causes of endocrine abnormalities in PCOS patients. The development of follicles depends on cellular communication between oocytes and GCs [ 39 ]. The apoptosis of GCs leads to imbalanced intercellular regulation in the follicle, resulting in oocyte apoptosis, and ultimately follicular atresia [ 40 – 42 ]. The effects of WNT5A on cell proliferation and apoptosis depend on different cell types. Studies have shown that WNT5A promotes the apoptosis of JAR cells, but has anti-apoptotic effects on vascular smooth muscle cells. WNT5A inhibits JAR cell proliferation but promotes colorectal cancer cells and pancreatic cancer cell proliferation [ 43 – 46 ]. The function of WNT5A and the involved mechanism of this in ovarian granulosa cell development remain unclear. Our results showed that WNT5A can down-regulate the expression of anti-apoptotic protein BCL2 and up-regulate the expression of apoptotic protein BAX and cleaved caspase-3, demonstrating that WNT5A can promote the apoptosis of KGN cells. Flow cytometry and a significantly higher proportion TUNEL-positive cells also confirmed these findings. Moreover, the results of the EdU and CCK8 assays confirmed that WNT5A inhibited the proliferation of KGN cells. The proportion of KGN cells in S phase increased and the proportion of G2/M cells decreased after WNT5A stimulation, indicating that WNT5A has an effect on the cell cycle control. The accumulation of KGN cells in the S phase caused by WNT5A may hinder the DNA replication process. We previously found that inflammatory stimulation can inhibit granulosa cell proliferation and promote apoptosis [ 21 ]. Additionally, inflammatory stimulation promoted WNT5A protein expression in granulosa cells. These results suggest that the role of WNT5A in regulating granulosa cell proliferation and apoptosis may be activated by inflammatory stimulation. However, Atefeh Abedini et al. reported that in cattle primary granulosa cells, 125 ng/mL Wnt5a did not affect the cell cycle or apoptosis [ 47 ]. This may be due to the different concentrations of exogenous WNT5A used. In addition, we used KGN cells, a human granulosa-like tumor cell line, as the research target, the biological behavior of which is not exactly the same as that of primary granulosa cells. WNT5A may also contribute to diverse results in different species of granulosa cells. Recent studies have shown that PI3K/AKT pathway plays important roles in the pathogenesis of PCOS, such as insulin resistance, adipocyte differentiation syndrome, and follicular growth [ 48 ]. The PI3K/AKT pathway is associated with androgen production and involved in hormone production [ 49 ]. It also plays a role in follicular development, with its activation leading to follicular immaturity and the production of many small follicles [ 50 ]. It has been shown that inducing Wnt5a expression will upregulate the expression of inflammation-related genes, while the PI3K/AKT pathway can mediate the increased expression of inflammatory factors in uterus of PCOS rats [ 51 ]. In this study, we found that overexpression of WNT5A can activate the PI3K/AKT signaling pathway. The addition of LY-294,002 blocked the inhibitory effect of WNT5A on the key enzyme of steroid metabolism. Taken together, this study suggests that WNT5A can regulate steroidogenesis through the PI3K/AKT pathway. Admittedly, there are several limitations in our study. Because of the ethical challenges of collecting human ovarian granulocyte cells, we used a human granulosa-like tumor cell line (KGN) for in vitro experiments. KGN cells exhibit the typical features of normal GCs and have become valuable tools for investigating the functions and regulatory mechanisms associated with these cells [ 24 ]. However, there are significant disparities between in vivo and in vitro culture environments, so the data shown in this study need to be confirmed using an in vivo model. In addition, we simulated the pathologic state of overactivated WNT5A in PCOS by transfecting KGN cells with lentivirus, which was confined to the cellular level. The data shown in this study, if confirmed in transgenic mice, would provide additional evidence. We also realized that although our sample size met the requirements of the initial study, it was still relatively small. In future research, we plan to expand the sample size to increase the reliability and universality of the research results.

In conclusion, the present study mainly discussed the effects of WNT5A on the proliferation and apoptosis of ovarian GCs and demonstrated that WNT5A can regulate the expression of key enzymes involved in steroidogenesis in ovarian GCs by activating the PI3K/AKT signalling pathway, which may be related to PCOS. This research provides not only a new perspective for exploring the pathogenesis of PCOS but also a foundation for future targeted treatment strategies for this complicated disease.

Polycystic ovarian syndrome (PCOS), an endocrine disorder syndrome characterized by persistent anovulation, insulin resistance (IR) and hyperandrogenism, is one of the most common reproductive endocrine disorders in reproductive-aged women [ 1 ]. Depending on the different criteria, PCOS affects approximately 4–21% of adolescent and reproductive-aged women [ 2 ]. At present, the actual pathogenesis of PCOS is unclear. Recent studies have shown that PCOS patients are commonly in a state of chronic inflammation, and the levels of several proinflammatory factors such as CRP, TNF-α, IL-6 and IL-18 are significantly elevated in PCOS patients [ 3 ]. Under physiological conditions, appropriate inflammatory stimulation in the ovary may promote normal follicular development and ovulatio [ 4 , 5 ]. However, excessive inflammatory stimulation may lead to microenvironmental changes in the follicular fluid, which act on granulosa cells (GCs) and follicular membrane cells, induce apoptosis, affect cell proliferation, cause mitochondrial dysfunction, and ultimately lead to ovulatory disorders in PCOS patients [ 6 , 7 ]. A long-term state of chronic inflammation can also induce IR and stimulate the production of androgens [ 8 , 9 ], which may in turn promote ovarian inflammation, inhibit follicle-stimulating hormone (FSH)-induced expression of the GCs aromatase, and cause disorders of estrogen and progesterone production, leading to follicular dysplasia in PCOS patients [ 10 , 11 , 12 ]. The regulatory effects of FSH on aromatase and subsequent estradiol (E2) production are dependent on the transcriptional cofactor β-catenin, which is a key regulator of the Wnt signalling pathway [ 13 ]. The WNT signalling cascades play important roles in the regulation of a variety of developmental and biological processes [ 14 ]. Previous studies have shown a dual role of WNT signalling in the regulation of inflammatory responses via the anti-inflammatory classical WNT/β-catenin signalling pathway and the proinflammatory nonclassical Wnt signalling pathway [ 15 ]. WNT5A can mediate a variety of cellular and extracellular functions by activating classical and nonclassical Wnt signalling pathways through binding to its receptor, FZD1-8 [ 16 ]. Increased expression of WNT5A has been associated with certain inflammatory states, including obesity, rheumatoid arthritis, psoriasis vulgaris, sepsis, and endothelial inflammation, suggesting that WNT5A could be considered a proinflammatory marker [ 17 – 19 ]. WNT5A was found to activate inflammation and oxidative stress in PCOS [ 20 ]. Our previous studies confirmed that inflammatory stimulation inhibits proliferation, promotes apoptosis and suppresses the expression of steroidogenesis genes in GCs [ 21 ]. However, acts as a proinflammatory factor, whether WNT5A affects the function of ovarian GCs, especially steroidogenesis, and contributes to the development of PCOS remains to be illuminated. The aim of our study was to confirm the expression of WNT5A both in the follicular fluid and GCs of PCOS patients and to investigate the effects of WNT5A on the proliferation, apoptosis and steroidogenesis of ovarian GCs.

Below is the link to the electronic supplementary material. Supplementary Material 1 Supplementary Material 1