Inhibition of TRPM3 by primidone provides a potential therapeutic method for adenomyosis management

In: Research Square · 2023 · doi:10.21203/rs.3.rs-3217639/v1 · W4385697241
preprint OA: green CC0
AI-generated summary by claude@2026-06, 2026-06-06

TRP channel expression is altered in adenomyosis, and primidone treatment reduced myometrial infiltration and pain in a mouse model.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

AI-generated deep summary by claude@2026-06, 2026-06-06 · read from full text

This paper profiled transient receptor potential (TRP) channel expression in adenomyosis by analyzing eutopic endometrium from adenomyosis patients (n=20 for mRNA analysis) and assessing TRPA1, TRPV1, and TRPM3 protein levels by immunohistochemistry in adenomyosis patients (n=50) and tamoxifen-induced adenomyosis mice (n=6). It found that mRNA expression of 15 TRPs was significantly increased in the proliferative phase of adenomyotic endometrium, and that TRPV1, TRPM3, and TRPA1 staining correlated with dysmenorrhea severity, menses amount, and uterine size; in the tamoxifen-induced mouse model, primidone significantly reduced myometrial infiltration depth and improved analgesia. Primidone treatment altered 47 differentially expressed genes, which were predicted to be enriched in cell cycle and cell division pathways. The study is a preprint and not peer reviewed. This paper is centrally about endometriosis and/or adenomyosis — it focuses on adenomyosis management via primidone-mediated inhibition of TRPM3.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Abstract Purpose To test the expression profile of transient receptor potential channels (TRPs) in adenomyosis patients and evaluate the effects of primidone on tamoxifen-induced adenomyosis mice. Methods Eutopic endometrium from adenomyosis patients (n = 20) was collected and subjected to mRNA analysis of TRP channels. TRPA1, TRPV1 and TRPM3 in adenomyosis patients (n = 50) and tamoxifen-induced adenomyosis mice (n = 6) were examined by immunohistochemistry. From 10 weeks after birth, primidone (2 mg/kg/d) and atosiban (1 mg/kg/d) were given separately to adenomyotic mice by intraperitoneal injection for 3 weeks. The hotplate test was conducted once a week beginning at 10 weeks, and then uterine samples were harvested for HE staining and RNA-seq at 13 weeks. Results The mRNA expression of 15 TRPs was significantly increased in the proliferative phase of the adenomyotic endometrium. TRPV1, TRPM3 or TRPA1 staining levels were positively correlated with dysmenorrhea severity, menses amount and uterine size. In tamoxifen-induced adenomyosis mice, primidone had a significant effect on both the depth of myometrial infiltration and analgesia. Forty-seven DEGs were identified after primidone treatment, and bioinformatics analysis predicted that they were enriched in the cell cycle and cell division. Conclusion The expression profile of TRP channels varies significantly in adenomyosis patients, and primidone may provide a potential therapeutic method for adenomyosis management.
Full text 139,919 characters · extracted from preprint-html · click to expand
Inhibition of TRPM3 by primidone provides a potential therapeutic method for adenomyosis management | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Inhibition of TRPM3 by primidone provides a potential therapeutic method for adenomyosis management Zhixing Jin, Yaoming Peng, He Zhang, Xiaoping He, Yi Zhang, Xin Pan, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3217639/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Purpose To test the expression profile of transient receptor potential channels (TRPs) in adenomyosis patients and evaluate the effects of primidone on tamoxifen-induced adenomyosis mice. Methods Eutopic endometrium from adenomyosis patients (n = 20) was collected and subjected to mRNA analysis of TRP channels. TRPA1, TRPV1 and TRPM3 in adenomyosis patients (n = 50) and tamoxifen-induced adenomyosis mice (n = 6) were examined by immunohistochemistry. From 10 weeks after birth, primidone (2 mg/kg/d) and atosiban (1 mg/kg/d) were given separately to adenomyotic mice by intraperitoneal injection for 3 weeks. The hotplate test was conducted once a week beginning at 10 weeks, and then uterine samples were harvested for HE staining and RNA-seq at 13 weeks. Results The mRNA expression of 15 TRPs was significantly increased in the proliferative phase of the adenomyotic endometrium. TRPV1, TRPM3 or TRPA1 staining levels were positively correlated with dysmenorrhea severity, menses amount and uterine size. In tamoxifen-induced adenomyosis mice, primidone had a significant effect on both the depth of myometrial infiltration and analgesia. Forty-seven DEGs were identified after primidone treatment, and bioinformatics analysis predicted that they were enriched in the cell cycle and cell division. Conclusion The expression profile of TRP channels varies significantly in adenomyosis patients, and primidone may provide a potential therapeutic method for adenomyosis management. Adenomyosis TRPs Primidone Pelvic pain TRPM3 Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Adenomyosis (ADE) is an often-overlooked heterogeneous gynecologic condition with a range of symptoms, such as progressive dysmenorrhea, menorrhagia and infertility, which affect the quality of life of 20 to 35% of women of reproductive age and consume substantial health care resources [ 1 , 2 ]. Due to the unknown mechanisms, no drug is currently available for adenomyosis, and there are no specific guidelines to follow for the best management. Among all complaints from women with adenomyosis, dysmenorrhea and other types of pain, including cyclic or acyclic lower abdominal pain, cyclic dysuria and dyspareunia, are at the top of the list and are the most debilitating [ 3 ]. However, the current therapeutic methods (surgical and/or hormonal therapies) often do not lead to sufficient pain control, and late diagnosis and high recurrence rates mean that women affected by this disease can suffer for decades before receiving proper treatment [ 4 ]. Although nonsteroidal anti-inflammatory drugs (NSAIDs) can alleviate menstrual pain, it has been reported that approximately 18% of women with dysmenorrhea are unresponsive to them, leaving them and their physicians to pursue less well-studied strategies [ 5 ]. One attractive approach is to target the very beginning of the pain pathway, focusing on nociceptive receptors [ 6 ]. Transient receptor potential (TRP) channels are the central receptors in the transduction of nociceptive stimuli by altering membrane potential or intracellular calcium concentration. In mammals, the TRP superfamily includes TRP vanilloid (TRPV), TRP ankyrin (TRPA), TRP melastatin (TRPM), and TRP canonical (TRPC) channels, which can be activated by a variety of stimuli and are widely distributed throughout the entire body [ 7 ]. In normal endometrial biopsies, TRP channel expression has been shown to fluctuate during the menstrual cycle regulated by the female hormones estradiol and progesterone [ 8 ], among which TRPV1, TRPM3 and TRPA1 are of particular interest [ 9 ]. Nonetheless, inhibiting pain by overwhelming TRPV1 and TRPA1 was largely halted because of hyperthermia, which could put patients at risk for scalding injuries by elevating the heat pain threshold [ 10 ]. In this respect, TRPM3 is hitting the headlines as the latest TRP member to tackle. However, current knowledge about the distribution of TRP channels in adenomyosis is rare. In pursuit of finding members of the TRP superfamily involved in adenomyosis, RNA and protein expression studies were performed on endometrial biopsies of adenomyosis patients during the different phases of the menstrual cycle and their correlation with the severity of dysmenorrhea was revealed. In addition, the TRPM3 antagonist primidone and the antagonist of the oxytocin receptor atosiban were used for the first time in a tamoxifen-induced adenomyosis mouse model, which may provide a potential therapeutic method for adenomyosis management. Materials and Methods Ethics statement This study complied with the tenets of the Helsinki Declaration and the National Guidelines for Animal Use in Research (China). All experiments were performed under the guidelines of the National Research Council Guide for the Care and Use of Laboratory Animals and approved by the Medical Ethics Committee of the First Affiliated Hospital of Soochow University (Suzhou, China) and the Institutional Ethics Review Board of the Shanghai Obstetrics and Gynecology Hospital (Shanghai, China). All tissue samples were obtained after written, full and informed consent was obtained from the enrolled subjects. Patients and human tissue collection In total, 50 human endometrial samples from adenomyosis patients were collected at the Obstetrics and Gynecology Hospital of Fudan University (Shanghai, China) and the First Affiliated Hospital of Soochow University (Suzhou, China) from June 2021 to June 2022. Their diagnoses were made by transvaginal ultrasound before surgery and histologically confirmed postoperatively. For controls, endometrial tissue samples were collected from 21 women who had undergone hysterectomy because of cervical intraepithelial neoplasia (CIN)-III, cervical carcinoma in situ and stage IA1 cervical cancer but were free of endometriosis, adenomyosis and uterine fibroids. All the recruited women in both the adenomyosis and control groups had not received any hormonal or anti-platelet treatment for at least 3 months prior to tissue collection. Two wedges of tissue from the lumen to the muscular myometrial layer that included superficial and basal endometrium as well as myometrium were taken from the detached uterus. One was immediately fixed in 10% buffered formalin at room temperature for 48 h and then embedded in paraffin for hematoxylin and eosin (HE) or immunohistochemical staining, and the other was placed in liquid nitrogen for RNA extraction. Information on uterine size, severity of dysmenorrhea, amount of menses, cycle length, reproductive history and age was also recorded. Real-time polymerase chain reaction (RT‒PCR) Total RNA was isolated from endometrial tissues using a DNA/RNA/Protein isolation kit (Tiangen, China), and 1 µg of the purified total RNA was reverse transcribed into cDNA with a PrimeScript RT Master Mix kit (Takara, Japan) following the manufacturer’s protocol. RT‒PCR was performed with the CFX96 Real-time PCR Detection system (Biorad, USA) using the TB Green Premix Ex Taq II kit (Takara, Japan). The primers used in the experiment are shown in Table 1 . The relative expression of each gene was calculated using the delta–delta Ct method, with GAPDH as the endogenous control. Table 1 Primer sequences. Gene Species Sense primer Antisense primer TRPV1 Human GTGCCGTTTCATGTTTGTCTA AGTCATTCTTCCCGTCTTCAA TRPV2 Human ATCTGCTCATCCCCAAGTTCT GCTTCTTCAGGGTAGGCTGAT TRPV3 Human TTCTATTTGCCTAACCTGCCA AATTCCATCCAGACCCACAG TRPV4 Human CCGTCTCCTTCTACATCAACG GGTAGTAGGCGGTGAGAGTGA TRPV5 Human GATCAGAATCCTCTGCGAGTG TTTCTCAGATGGATGCTCCTG TRPV6 Human TTCCTGGAACTTGCTCTCATT GCGTTCATGCTACTCCTCTTT TRPM1 Human GCATAAAGAGCAGTTTGCAGA TCCATCCCATTTCTGTCAGTA TRPM2 Human CTTCTGGTTTGGTGTCAACAG GGCAGATTTAATGTCTTGGGT TRPM3 Human TCCTCTTACACCTGATGACCA GCTTTGATGAGCCCTTTCC TRPM4 Human CACTGTCCTCTGCATCGACT GCTGTTTGTTGACCGTGAAG TRPM5 Human TTGCTGCCCTAGTGAACCA TGTCCTCCCAAGAGAAATGCT TRPM6 Human GAGACCATGCTGGGATAGATT GTATCTGTTGGGCTTTTCGTT TRPM7 Human CCTCAGTTGCGAAAGAGTCAT GGTAGGGCTGTGCTGTCTTAAT TRPM8 Human AGGCAACCTCTAGCGATTACC CACAAAGATGCTCATCCCAAT TRPC1 Human CGTTACCTCCACCTTTCAACAT CTGTTTTGCCGTTTGACCTT TRPC3 Human GCCGAGACTCAGAAGAGGTAGA TTAATGGCAAGTTTGACACGAC TRPC4 Human CCAGACACAGTCACCCACGAAG TTCCCCCACCCAGAGCACTAC TRPC5 Human AGACATCTCCAGCTTTCGGTA CCACTGCCATCATTATTATCGT TRPC6 Human TGATCGCTCCACAAGCCTATCT CCGCACCACTGGGATGTTAC TRPC7 Human CTGGCAGACCTGATTCAACAA GTAGAAGTCACAGACGCCGATG TRPA1 Human AGGGAGCCACTGAGATTGTT ATGACATCCATCGGTTGTGT CHIL1 Mouse TTACAGGATTGAGGGACCATAC AAAGGGAAGTGGGACGATTA COL9A2 Mouse TGAGGCTTCTGGTGGTCCTTAC TCTCCCCCAAAAGATACCCAAT PSMC3IP Mouse TGGAGGTGGGAACAGAGCGT ACACTATGGCTTTGTGCTCCGTC NEIL3 Mouse GGAGAGGATTGCTTTACGGACT TTAGCCGAGGGTCTGTTTATGAG SPC24 Mouse GGAGCCAGAGCCTTGACCT CAATGAACGCACTCACATACAGA GAPDH Human GGGAAGGTGAAGGTCGGAGT GGGGTCATTGATGGCAACA GAPDH Mouse ACCCAGAAGACTGTGGATGG CACATTGGGGGTAGGAACAC Immunohistochemistry (IHC) IHC staining was performed as previously described. The primary antibodies used included TRPV1 (1:200; Alomone, Israel), TRPA1 (1:200; Alomone, Israel), TRPM3 (1:200; Alomone, Israel) and α-SMA (1:200; Abcam, USA). Quantification of immunoreactivity was performed with Image Pro-Plus 6.0 software (Media Cybernetics Inc., USA), as described previously[ 11 ]. Preparation of drugs and animals Administering tamoxifen orally to Institute of Cancer Research (ICR) newborn mice is a classic method to establish an experimental adenomyosis model. Tamoxifen was purchased from MedChemExpress Company (HY-13757A, New Jersey, USA). A total of six 19-day pregnant ICR mice weighing 40–50 g were purchased from the Laboratory Animal Center of the Shanghai Institutes of Biological Sciences (Shanghai, China). Each dam and her pups were housed in the same cage under controlled conditions (12:12 light/dark cycle, 70–80% humidity, 22–24°C) and had access to chow and fresh water ad libitum. We obtained 24 female neonatal mice from 6 pregnant ICR mice, while all the male neonatal progeny were sacrificed by cervical dislocation. The female neonates were randomly divided into four groups: i) control (n = 6); ii) ADE model (n = 6); iii) primidone (n = 6; Sigma, USA); and iv) atosiban (n = 6; Sigma, USA). From Day 1 to Day 5 after birth, female neonatal mice in the ADE group and drug treatment groups received 1 mg/kg tamoxifen suspended in a peanut oil/lecithin/condensed milk mixture (2:0.2:3, by volume) at a dose volume of 5 µl/g body weight, while the control neonatal mice were fed similarly with the same amount of solvent without tamoxifen. All mice were weaned and separated from the dams upon reaching 3 weeks of age, at which point the dams were sacrificed by cervical dislocation. From 10 weeks after birth, mice in the drug treatment groups were administered by intraperitoneal injection with either primidone (2 mg/kg/d) or atosiban (1 mg/kg/d) for 3 weeks, while the mice in the control and ADE groups were administered similarly with corresponding quantities of the vehicle. All mice were subjected to a hotplate test once a week for 3 weeks beginning at 10 weeks. Uterine samples from the mice in the four aforementioned groups were harvested at 13 weeks of age after the last hotplate test. All mice had a normal estrus cycle. Hotplate test procedure As described previously [ 12 ], a commercially available Hot Plate Analgesia Meter (BME-480; Chinese Academy of Medical Sciences, China) was used for the hotplate test. The surface of the plate was heated to and maintained at a constant temperature of 50.0 ± 0.1℃ as measured using a built-in digital thermometer. A plastic cylinder 20 cm in diameter and 18 cm in height was placed on the hotplate. All mice were allowed to acclimatize under a controlled environment at 22–24℃ with 70–80% humidity in the testing room for 10 min prior to test commencement. The latency response to thermal stimuli was defined as the time (sec) elapsed from the moment the mouse was placed inside the cylinder to the moment it licked its hind paws. Each mouse was tested once per session. The latency was calculated as the mean between two readings recorded between 24 h intervals. Animal specimen collection After treatment for 3 weeks, all mice were anesthetized, and the uteri were then excised, where half of the samples were immediately fixed in 4% paraformaldehyde at room temperature for 48 h and all remaining uterine tissue samples were placed immediately in liquid nitrogen for subsequent mRNA array. RNA sequencing (RNA-seq) and data analysis RNA-seq and analysis were conducted by OE Biotech Co. (Shanghai, China). Briefly, after collecting uterus tissues from mice in different groups, total RNA was extracted and quantified by a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, USA). RNA integrity was assessed using the Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA), and RNA samples with RIN > 7.0 were subjected to further processing. Then, the libraries were constructed using the TruSeq Stranded mRNA LT Sample Prep Kit (Illumina, USA) and subsequently sequenced on an Illumina NovaSeq 6000 platform. High-quality reads were mapped to the mouse reference genome using HISAT2 ( https://ccb.jhu.edu/software/hisat2/index.shtml ). Gene expression levels were estimated as fragments per kilobase of transcript per million mapped reads. Differentially expressed genes (DEGs) between the two groups were identified using the DESeq R package (R Foundation for Statistical Computing; http://www.r-project.org/ ). The threshold was set as false discovery rate-adjusted P value 2 or fold change < 0.5. DEGs that were increased/decreased in adenomyosis mice and then decreased/increased after primidone treatment were identified. Hierarchical cluster analysis of these DEGs was performed to demonstrate the expression pattern of genes in different groups. Based on the hypergeometric distribution, GO and KEGG pathway enrichment analyses of these selected DEGs were further performed to screen the significantly enriched terms using R. The raw RNA-seq data were deposited in the Gene Expression Omnibus database (available: https://www.ncbi.nlm.nih.gov/geo ; accession number GSE227384). Statistical analysis Statistical differences were analyzed using Statistical Package for the Social Sciences (SPSS) software (22.0) (Chicago, USA). Two-tailed unpaired Student’s t test, one-way ANOVA followed by Tukey's multiple comparisons test, Kruskal–Wallis test followed by Dunn’s multiple comparison, and Pearson’s and Spearman’s correlation analysis were used for further analyses. P values of 0.05 were considered statistically significant. Results mRNA expression profile of TRP channels in eutopic endometrial biopsies from patients with and without adenomyosis throughout the menstrual cycle. The characteristics of the recruited patients with adenomyosis and the control subjects are listed in Table 2 . As shown in the table, the patients in different groups were comparable in age, live births, miscarriages and cycle length. However, patients with adenomyosis had significantly larger uterine sizes, heavier menses and more severe dysmenorrhea. Table 2 Characteristics of recruited patients with and without adenomyosis for mRNA expression profile of TRP channels in endometrial biospies. Variable name Control Proliferative phase n = 6 Control Secretory phase n = 6 Adenomyosis Proliferative phase n = 13 Adenomyosis Secretory phase n = 7 p-value Age (years) Median (range) Mean (± S.D.) 38(36–47) 40.0 ± 4.8 41(31–51) 40.5 ± 8.0 47(36–54) 45.9 ± 4.7 46(38–54) 46.0 ± 5.5 0.09 Live births Median (range) 1(1–2) 1.5(1–2) 1(1–2) 1(1–2) 0.32 Miscarriages Median (range) 1.5(1–3) 1.5(1–4) 1(0–5) 2(0–2) 0.75 Cycle length (days) Median (range) 27(25–30) 30(30–30) 30(26–33) 28(23–30) 0.06 Amount of menses Light & Moderate Heavy 5(83.3%) 1(16.7%) 6(100%) 0(0%) 7(53.8%) 6(46.2%) 0(0%) 7(100%) < 0.0001 Severity of dysmenorrhea None Mild Moderate Severe 4(66.7%) 2(33.3%) 0(0%) 0(0%) 4(66.7%) 2(33.3%) 0(0%) 0(0%) 2(15.4%) 1(7.7%) 6(46.2%) 4(30.7%) 0(0%) 1(14.2%) 3(42.9%) 3(42.9%) < 0.0001 Uterine size (in cm3) Mean (± S.D.) 117.0 ± 30.12 152.7 ± 56.82 531.0 ± 312.6 521.1 ± 324.6 0.0029 Using RT‒PCR analysis, the expression profile of TRP channels in endometrial biopsies of control (proliferation phase n = 6; secretory phase n = 6) and adenomyosis (proliferation phase n = 13; secretory phase n = 7) patients harvested at different times during menstruation was investigated (Fig. 1 A). Compared with the proliferation phase of the control endometrium, the mRNA expression of TRPM1, TRPM3, TRPM4, TRPM6, TRPM7, TRPM8, TRPC1, TRPC3, TRPC4, TRPC5, TRPC6, TRPV4, TRPV5, and TRPA1 was significantly increased during the secretory phase (Fig. 1 B-D). Moreover, we compared the endometrium of the proliferation phase in controls with the same phase in adenomyosis and found that except for TRPV4, TRPC7, TRPM2, TRPM4, TRPM5, and TRPM8, the mRNA expression of the other 15 TRP channels was significantly elevated in adenomyosis. No significant difference was found when comparing the secretory phase of the control endometrium with the adenomyosis endometrium. Taken together, these results illustrate a distinct TRP channel expression pattern between control and adenomyosis endometria. The expression of TRPV1, TRPM3 and TRPA1 in the endometrium of adenomyosis patients by IHC The characteristics of the recruited patients with adenomyosis (proliferation phase n = 29; secretory phase n = 21) and the control subjects (proliferation phase n = 14; secretory phase n = 7) are listed in Table 3 . Immunohistochemistry analysis was carried out to determine the expression of TRPV1, TRPM3 and TRPA1 at the protein level. We found that TRPV1 and TRPA1 staining was mainly seen in endometrial epithelial cells in both control and adenomyosis tissues and mostly localized in the cytomembrane. TRPM3 staining was observed in both epithelial and stromal cells and was localized in the cytoplasm and cytomembrane (Fig. 2 A). Table 3 Characteristics of recruited patients with and without adenomyosis for the expression of TRPV1, TRPM3 and TRPA1 in endometrium at protein level. Variable name Control Proliferative phase n = 14 Control Secretory phase n = 7 Adenomyosis Proliferative phase n = 29 Adenomyosis Secretory phase n = 21 p-value Age (years) Median (range) Mean (± S.D.) 41.5(36–52) 42.4 ± 5.5 42(39–51) 44.6 ± 5.1 47(37–52) 45.6 ± 4.9 45(34–53) 44.3 ± 4.8 0.21 Live births Median (range) 1(0–3) 1(1–2) 1(0–3) 1(0–2) 0.71 Miscarriages Median (range) 2(1–4) 2(1–4) 1(0–5) 1(0–3) 0.12 Cycle length (days) Median (range) 28(25–30) 30(28–30) 30(23–40) 30(23–35) 0.13 Amount of menses Light & Moderate Heavy 13(92.9%) 1(7.1%) 7(1000%) 0(0%) 14(48.3%) 15(51.7%) 7(33.4%) 14(66.6%) < 0.0001 Dysmenorrhea severity None Mild Moderate Severe 12(85.7%) 2(14.3%) 0(0%) 0(0%) 5(71.4%) 2(28.6%) 0(0%) 0(0%) 4(13.8%) 4(13.8%) 13(44.8%) 8(27.6%) 1(4.8%) 2(9.5%) 5(23.8%) 13(61.9%) < 0.0001 Uterine size (in cm3) Mean (± S.D.) 108.6 ± 34.85 173.7 ± 76.10 650.1 ± 560.6 628.9 ± 288.8 0.0001 In the control endometrium, the staining levels of TRPM3, TRPV1 and TRPA1 displayed no significant difference at different times during menstruation. Consistent with previous results at the mRNA level, TRPM3 and TRPA1 were highly expressed in the endometrium of the proliferation phase in adenomyosis patients compared with the same phase of the control endometrium (Fig. 2 B-C). Moreover, impressively increased expression of TRPV1 was exhibited in the secretory phase of the adenomyotic endometrium compared with that of the same phase of the control endometrium; however, no obvious changes were observed in the endometrium in the proliferation phase (Fig. 2 D). The severity of dysmenorrhea correlated positively with TRPV1, TRPM3 or TRPA1 staining levels Since dysmenorrhea is one of the major complaints in women with adenomyosis, we attempted to examine whether TRPV1, TRPM3 and TRPA1 are associated with the severity of dysmenorrhea in women with adenomyosis using immunohistochemistry. We found that TRPV1, TRPM3 and TRPA1 staining levels were significantly correlated with the severity of dysmenorrhea (Spearman’s r = 0.3234/P = 0.0141, r = 0.5688/P<0.0001 and r = 0.3657/P = 0.0044, respectively; Fig. 3 A-C). Amount of menses and determination of TRPV1, TRPM3 or TRPA1 immunoreactivity We next examined the relationship, if any, between TRPV1, TRPM3 or TRPA1 immunoreactivity and the amount of menses. Since there was only one woman who reported light menses, we divided all cases into two groups: women who reported light or moderate menses and those who reported heavy menses. We found that higher TRPV1, TRPM3 or TRPA1 staining in the eutopic endometrium was easier to observe in women with heavy menses (Spearman’s r = 0.3117/P = 0.018, r = 0.3158/P = 0.0158, r = 0.3846/P = 0.0026, respectively; Fig. 3 D-F). This suggests that TRPV1, TRPM3 or TRPA1 overexpression in eutopic endometrium is associated with, and possibly responsible for, heavy menstrual bleeding in women with adenomyosis. Uterus size and TRPV1, TRPM3 or TRPA1 immunoreactivity As an enlarged uterus is one of three major presentations of adenomyosis after abnormal uterine bleeding and dysmenorrhea, we also examined the relationship between uterus size and TRPV1, TRPM3 or TRPA1 immunoreactivity. We found that larger uterus sizes were easily observed in those with higher expression of TRPV1, TRPM3 or TRPA1 in the endometrium (Pearson’s r = 0.3182/P = 0.0190, r = 0.3001/P = 0.0246 and r = 0.3914/P = 0.0029, respectively; Fig. 3 G-I). TRPV1, TRPM3 and TRPA1 expression was upregulated in tamoxifen-induced mice To determine whether mouse endometrial epithelial cells or stromal cells have a transient receptor potential (TRP) channel expression profile similar to that found in the human endometrium, tamoxifen was used to induce adenomyosis in newborn ICR mice. Mice in each group were killed at Day 5, Day 10, Day 15, Day 25 and Day 42 separately for the calculation of the rate of adenomyosis formation by HE staining. The complete absence of any ectopic endometrium in the myometrium was considered successful establishment of the adenomyosis mouse model. At Day 42, all mice in the adenomyosis model group showed endometrial invasion into the myometrium, while no ectopic endometrium was observed in the myometrium of the control group (Fig. 4 A). Compared with mice in the control group, the expression of TRPV1, TRPM3 and TRPA1 was significantly increased, and its expression position was similar to those in human samples (Fig. 4 B-C). The effect of primidone and atosiban on hot plate response latency following adenomyosis establishment. The hotplate test is a commonly used method for measuring nociception and evaluating response thresholds to thermal stimuli in rodents. In the present study, all mice were subjected to hot plate testing once a week from 10 weeks after birth. At 13 weeks, mice in different groups were sacrificed after being weighed and subjected to the hotplate test (Fig. 5 A). We found that there was no significant difference in body weight among the groups (Fig. 5 B). The hot plate response latency in mice from the ADE group was significantly decreased compared with that in mice from the control group. After 2 weeks of treatment with primidone and 3 weeks of treatment with atosiban, a significantly prolonged response latency was observed in both treatment groups compared with the ADE group, and primidone exhibited a better analgesic effect than atosiban (Fig. 5 C). The depth of myometrial infiltration was significantly decreased after primidone treatment. The depth of myometrial infiltration of the ectopic endometrium was evaluated following the criteria described by Bird [ 13 ]. As demonstrated in Fig. 5 D-E, compared with the control group, mice in the ADE group exhibited significantly increased infiltration. After treatment with primidone for 3 weeks, mice demonstrated significantly reduced myometrial infiltration compared with untreated mice in the ADE group. Although mice treated with atosiban displayed less myometrial infiltration than those in the ADE group, the difference was not significant (P > 0.05). Transcriptomic analysis of the uterus following primidone treatment in the mouse adenomyosis model To identify the potential signaling pathway that primidone is involved in in addition to analgesia, high-throughput RNA-seq was performed in mice in the control, ADE model and primidone treatment groups (n = 3). Compared with the control group, 517 genes were at least twofold differentially expressed in the tamoxifen-induced adenomyosis group: 271 were downregulated and 246 were upregulated. There were 133 DEGs, including 45 upregulated genes and 88 downregulated genes, in the primidone treatment group compared to the ADE model group. Overall, 27 genes were upregulated in the ADE model group and then downregulated after primidone treatment, while 20 genes were downregulated in the ADE model group and then upregulated after primidone treatment. Hierarchical clustering analysis showed systematic variation in the expression of mRNAs among these three groups (Fig. 6 A). Significantly enriched GO terms from the three groups were mostly related to the cell cycle and cell division (Fig. 6 B). GO terms related to chromosomes and the regulation of cytokinesis were also enriched. KEGG pathway enrichment analysis was also performed to determine the potential biological roles of the DEGs. The top 20 pathways with more than 2 DEGs were screened out, including “Cell cycle”, “Cellular senescence”, “Pathways in cancer”, and “PI3K-Akt signaling pathway”. Notably, the number of differentially expressed genes associated with “Cell cycle” was the largest (Fig. 6 C). Finally, we analyzed the expression of 5 genes by RT‒PCR based on fold changes in expression shown in RNA-Seq and prospective therapeutic value to verify our previous data. These were CHIL1, COL9A2, PSMC3IP, NEIL3 and SPC24. The expression ratios of these genes determined by RT‒PCR were consistent with those from RNA-seq analysis (Fig. 6 D-H). Discussion Adenomyosis is the presence of endometrial glands and stroma within the myometrium, contributing to the most common cause of secondary dysmenorrhea [ 14 ]. However, despite its common occurrence, it is underdiagnosed and undertreated. It has been reported that the disease is diagnosed on average 10 years after the onset of symptoms, and nonspecific complaints may lead to consultations regarding various medical management [ 15 ]. Considering the significant effects of dysmenorrhea and other types of pain regarding women’s reproductive health, further investigation is needed. Pain can be divided into the following three categories: nociceptive pain, inflammatory pain and neuropathic pain [ 16 ]. Dysmenorrhea and cyclic lower abdominal pain caused by ADE can initially be understood as nociceptive inflammatory pain [ 17 ]. Interleukin-6, interleukin-8, TNF-α and PGE 2 , which are considered proinflammatory factors, have been reported to be significantly increased in women with ADE [ 18 ]. This form of pain could be well managed with NSAIDs by decreasing the levels of prostaglandins. However, a review of 51 different clinical trials found that 18% of women reported minimal or no relief of menstrual pain with NSAIDs [ 19 ], which means there should be other pathways involved in ADE-associated pain. In recent years, primary disorders of the uterine layers with hyperperistalsis have been found to play an important role in pain mediator release and subsequent pain fiber activation [ 20 ]. Increased frequency and magnitude of uterine contractions and neurotrophic factor secretion induced by the elevated expression of OTR has been reported to contribute to promoting hyperinnervation and central sensitization, leading to dysmenorrhea and other types of pain in ADE patients [ 21 ]. However, there is no research on OTR inhibitors in either ADE patients or ADE animal models. Exercise[ 22 ] and nutritional interventions [ 23 ], such as supplementation or increased intake of omega-3 fatty acids and vitamin B, may also provide some benefit, but the evidence is limited to small randomized controlled trials (RCTs). Overall, it seems that a great deal of work is still needed to unravel the mystery of adenomyosis-associated pain. TRP channels are transmembrane protein complexes, and steroids, including estrogen, progesterone and androgens, have been found to affect the physiology of the cells and regulate where TRP channels are expressed [ 24 ]. Regarding the roles of TRP channels in inflammatory pain, evidence suggests that inflammatory mediators can sensitize or alter the threshold of TRP channels, leading to pain behaviors [ 25 ]. Moreover, calcium is also a key player in a variety of important events, including fertilization, decidualization and implantation [ 26 ]. The functional expression of the calcium-conducting TRP channels TRPV2, TRPV4, TRPC6 and TRPM7 was described in human endometrial stromal cells, and pregnancy outcome in mice has been found to be perturbed by the deletion of TRPC6 channels [ 27 , 28 ], which renders them good candidates for intercellular signaling during processes such as decidualization and embryo implantation, in addition to pain control. In our research, we first verified the mRNA expression of different subtypes of TRPV, TRPA, TRPM and TRPC channels by collecting the eutopic endometrium of patients with and without adenomyosis. We found that except for TRPM2, TRPM5, TRPV1, TRPV2, TRPV3, TRPV6 and TRPC7, the expression of the other 14 TRP channels increased significantly in the secretory phase in women without adenomyosis, which may support their possible regulation by ovarian hormones that has been reported by other research and their possible role in fertility. Significantly elevated expression of TRP channels other than TRPV4, TRPC7, TRPM2, TRPM4, TRPM5, and TRPM8 has been found in adenomyosis during the proliferative phase, suggesting their possible involvement in adenomyosis. Then, we used IHC to test the protein expression levels of TRPV1, TRPM3 and TRPA1, the most popular proteins in pain research, and found that TRPM3 and TRPA1 were significantly increased in the proliferative phase of patients with adenomyosis, which was consistent with the results at the mRNA level. Impressively increased expression of TRPV1 was exhibited in the secretory phase of the adenomyotic endometrium compared with the same phase of the control endometrium, which may contribute to adenomyosis-related infertility. Furthermore, a close positive relationship between TRPV1, TRPM1 or TRPA1 and the severity of dysmenorrhea, amount of menses or uterus size was determined by Spearson and Pearson correlation analysis, suggesting their possible involvement not only in adenomyosis-associated pain but also in the pathogenesis of the disease. With the discovery of nociceptive TRP channels, there is tremendous interest expressed by pharmaceutical companies in TRP channels, and they hope to develop a new class of potent, safe analgesics. However, for the time being, the down side of TRP channels has been most prominent. Activation or inhibition of a TRP channel may be beneficial for pain relief while inducing unacceptable adverse effects at the same time. Indeed, the clinical development of TRPV1 antagonists was largely halted because of hyperthermia [ 29 ], and TRPA1-targeted drug development encountered pharmaceutical and pharmacokinetic complications [ 30 ]. Therefore, the spotlight has recently moved to TRPM3. Primidone and the flavone isosakuranetin have been reported as TRPM3 antagonists and are reassuringly devoid of serious side effects [ 31 , 32 ]. Therefore, in the following experiment, we verified the possible effects of primidone on tamoxifen-induced adenomyosis in newborn ICR mice and compared them with those of atosiban, an oxytocin receptor antagonist. The results showed that primidone exhibited a better analgesic effect than that of atosiban after 3 weeks of treatment. Surprisingly, we found that primidone could also significantly decrease the depth of myometrial infiltration, which suggested that multiple pathological mechanisms may contribute to the effectiveness of TRPM3 inhibition. To clarify other possible involved mechanisms, transcriptomic analysis of mouse uteri from the control, ADE model and primidone treatment groups was performed. We first screened out the DEGs that were at least twofold differentially expressed and were increased/decreased in adenomyosis mice and then decreased/increased after primidone treatment. Differential genes were found to be the most associated with “Cell cycle” and “Cell division” by GO term enrichment and KEGG enrichment analysis, which reveal that they may be one of the pathways involved in the effectiveness of TRPM3 inhibition. Finally, based on the fold changes in expression in RNA-Seq and prospective therapeutic value, we verified the expression ratios of CHIL1, COL9A2, PSMC3IP, NEIL3, and SPC24. These genes play an important role in multiple pathological mechanisms, including inflammation, tissue remodeling, injury, DNA repair and cell mitosis [ 33 – 35 ], which deserves further investigation. In addition, decreased PSMC3IP and SPC24 have also been reported to contribute to female infertility via meiotic failure [ 36 , 37 ], which might be further studied in the field of adenomyosis-related reproductive issues. Our study has two limitations. First, all ADE patients enrolled in our study were diffuse type, and whether our conclusion can be extended to focal ADE remains to be demonstrated. Second, the transcriptomic analysis is only a preliminary step that does not reveal the full mechanism of TRPM3 antagonists. Genes that are shortlisted by this analysis should be investigated in in vitro or in vivo models involving overexpression/knockdown studies, protein analyses and functional assays. We plan to carry out these experiments in our future research. Declarations Acknowledgements We are grateful to the women who participated in this study, OE Biotech Co. (Shanghai, China) for assisting in sequencing and/or bioinformatics analysis and Xishan Biotech Co. (Suzhou, China) for providing experimental platform. Ethics approval All experiments were performed under the guidelines of the National Research Council Guide for the Care and Use of Laboratory Animals and approved by the Medical Ethics Committee of the First Affiliated Hospital of Soochow University (Suzhou, China) and the Institutional Ethics Review Board of the Shanghai Obstetrics and Gynecology Hospital (Shanghai, China). Consent to participate All tissue samples were obtained after written, full and informed consent from recruited subjects. Consent for publication All authors have approved the final version of this manuscript and consent for its publication. Data availability The datasets used and/or analyzed during the present study are available from the corresponding author on reasonable request. The RNA-seq raw data was deposited in the Gene Expression Omnibus database (available: https://www.ncbi.nlm.nih.gov/geo; accession number GSE227384). Funding The present study was supported by funding from the National Natural Science Foundation of China (No. 82001523 and No.82101215), Gusu Health Talent Project (No. GSWS2021004) Competing interests All authors declare that they have no competing interests. Authors' contributions Z.X.J. designed the study, performed the human sample experiments, analyzed the data and drafted the manuscript. Y.M.P. performed the animal experiments and carried out initial data analysis. H.Z. and X.P.H. contributed to the experimental preparation and human sample collection. Y.Z. and X.P. was involved in patient recruitment and the data interpretation and discussion. M.L. contributed to the conception of the study and critically revised the manuscript. Q.Q.Y. supervised the research project and gave final approval. All authors reviewed the manuscript. References Chapron C, Vannuccini S, Santulli P, Abrão MS, Carmona F, Fraser IS, et al. Diagnosing adenomyosis: an integrated clinical and imaging approach. Hum Reprod Update. 2020;26(3):392–411. Upson K, Missmer SA. Epidemiology of Adenomyosis. Semin Reprod Med. 2020;38(2–03):89–107. Guo SW. Cracking the enigma of adenomyosis: an update on its pathogenesis and pathophysiology. Reproduction. 2022;164(5):R101-R121. Vannuccini S, Luisi S, Tosti C, Sorbi F, Petraglia F. Role of medical therapy in the management of uterine adenomyosis. Fertil Steril. 2018;109(3):398–405. Oladosu FA, Tu FF, Hellman KM. Nonsteroidal anti-inflammatory drug resistance in dysmenorrhea: epidemiology, causes, and treatment. Am J Obstet Gynecol. 2018;218(4):390–400. Takayama Y, Derouiche S, Maruyama K, Tominaga M. Emerging Perspectives on Pain Management by Modulation of TRP Channels and ANO1. Int J Mol Sci. 2019; 20(14):3411. Samanta A, Hughes T, Moiseenkova-Bell VY. Transient Receptor Potential (TRP) Channels. Subcell Biochem. 2018;87:141–165. Méndez-Reséndiz KA, Enciso-Pablo Ó, González-Ramírez R, Juárez-Contreras R, Rosenbaum T, Morales-Lázaro SL. Steroids and TRP Channels: A Close Relationship. Int J Mol Sci. 2020;21(11):3819. Duitama M, Moreno Y, Santander SP, Casas Z, Sutachan JJ, Torres YP, et al. TRP Channels as Molecular Targets to Relieve Cancer Pain. Biomolecules. 2021;12(1):1. Bamps D, Vriens J, de Hoon J, Voets T. TRP Channel Cooperation for Nociception: Therapeutic Opportunities. Annu Rev Pharmacol. 2021;61:655–677. Jin Z, Liu H, Xu C. Estrogen degrades Scribble in endometrial epithelial cells through E3 ubiquitin ligase HECW1 in the development of diffuse adenomyosis. Biol Reprod. 2020;102(2):376–387. Jin Z, Wu X, Liu H, Xu C. Celecoxib, a selective COX-2 inhibitor, markedly reduced the severity of tamoxifen-induced adenomyosis in a murine model. Exp Ther Med. 2020;19(5):3289–3299. Bird CC, McElin TW, Manalo-Estrella P. The elusive adenomyosis of the uterus-revisited. Am J Obstet Gynecol. 1972;112(5):583–593. McKenna KA, Fogleman CD. Dysmenorrhea. Am Fam Physician. 2021;104(2):164–170. Lazaridis A, Grammatis AL, Spencer S, Hirsch M. Nonsurgical management of adenomyosis: an overview of current evidence. Curr Opin Obstet Gyn. 2022;34(5):315–323. Patapoutian A, Tate S, Woolf CJ. Transient receptor potential channels: targeting pain at the source. Nat Rev Drug Discov. 2009;8(1):55–68. Gruber TM, Mechsner S. Pathogenesis of Endometriosis: The Origin of Pain and Subfertility. Cells-basel. 2021;10(6):1381. Carrarelli P, Yen CF, Funghi L, Arcuri F, Tosti C, Bifulco G, et al. Expression of Inflammatory and Neurogenic Mediators in Adenomyosis. Reprod Sci. 2017;24(3):369–375. Owen PR. Prostaglandin synthetase inhibitors in the treatment of primary dysmenorrhea. Outcome trials reviewed. Am J Obstet Gynecol. 1984;148(1):96–103. Agostinho L, Cruz R, Osório F, Alves J, Setúbal A, Guerra A. MRI for adenomyosis: a pictorial review. Insights Imagine. 2017;8(6):549–556. Zhang Y, Yu P, Sun F, Li TC, Cheng Jm, Duan H. Expression of oxytocin receptors in the uterine junctional zone in women with adenomyosis. Acta Obstet Gyn Scan. 2015;94(4):412–418. Azima S, Bakhshayesh HR, Kaviani M, Abbasnia K, Sayadi M. Comparison of the Effect of Massage Therapy and Isometric Exercises on Primary Dysmenorrhea: A Randomized Controlled Clinical Trial. J Pediatr Adol Gynec. 2015;28(6):486–491. Pattanittum P, Kunyanone N, Brown J, Sangkomkamhang US, Barnes J, Seyfoddin V. Dietary supplements for dysmenorrhoea. Cochrane Db Syst Rev. 2016;3(3):D2124. Uchida Y, Izumizaki M. Effect of menstrual cycle and female hormones on TRP and TREK channels in modifying thermosensitivity and physiological functions in women. J Therm Biol. 2021;100:103029. Julius D. TRP channels and pain. Annu Rev Cell Dev Bi. 2013;29:355–384. Qu M, Lu P, Bellve K, Lifshitz LM, ZhuGe R. Mode Switch of Ca (2+) Oscillation-Mediated Uterine Peristalsis and Associated Embryo Implantation Impairments in Mouse Adenomyosis. Front Physiol. 2021;12:744745. Hasna J, Abi NR, Sergent F, Alfaidy N, Bouron A. The Deletion of TRPC6 Channels Perturbs Iron and Zinc Homeostasis and Pregnancy Outcome in Mice. Cell Physiol Biochem. 2019;52(3):455–467. De Clercq K, Held K, Van Bree R, Meuleman C, Peeraer K, Tomassetti C, et al. Functional expression of transient receptor potential channels in human endometrial stromal cells during the luteal phase of the menstrual cycle. Hum Reprod. 2015;30(6):1421–1436. Souza MDAD, Nassini R, Geppetti P, De Logu F. TRPA1 as a therapeutic target for nociceptive pain. Expert Opin Ther Tar. 2020;24(10):997–1008. Koivisto AP, Belvisi MG, Gaudet R, Szallasi A. Advances in TRP channel drug discovery: from target validation to clinical studies. Nat Rev Drug Discov. 2022;21(1):41–59. Krügel U, Straub I, Beckmann H, Schaefer M. Primidone inhibits TRPM3 and attenuates thermal nociception in vivo. Pain. 2017;158(5):856–867. Straub I, Krügel U, Mohr F, Teichert J, Rizun O, Konrad M, et al. Flavanones that selectively inhibit TRPM3 attenuate thermal nociception in vivo. Mol Pharmacol. 2013;84(5):736–750. Lee CG, Da SC, Dela CC, Ahangari F, Ma B, Kang MJ, et al. Role of chitin and chitinase/chitinase-like proteins in inflammation, tissue remodeling, and injury. Annu Rev Physiol. 2011;73:479–501. Trefilova VV, Shnayder NA, Petrova MM, Kaskaeva DS, Tutynina OV, Petrov KV, et al. The Role of Polymorphisms in Collagen-Encoding Genes in Intervertebral Disc Degeneration. Biomolecules. 2021; 11(9):1279. Chen L, Huan X, Gao XD, Yu WH, Xiao GH, Li TF, et al. Biological Functions of the DNA Glycosylase NEIL3 and Its Role in Disease Progression Including Cancer. Cancers. 2022; 14(23):5722. Biswas L, Tyc K, El YW, Morgan K, Xing J, Schindler K. Meiosis interrupted: the genetics of female infertility via meiotic failure. Reproduction. 2021;161(2):R13-R35. Zhang T, Zhou Y, Wang HH, Meng TG, Guo L, Ma XS, et al. Spc24 is required for meiotic kinetochore-microtubule attachment and production of euploid eggs. Oncotarget. 2016;7(44):71987–71997. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3217639","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":223399151,"identity":"1fb50360-37bb-4e47-9473-dc906eb4b557","order_by":0,"name":"Zhixing Jin","email":"","orcid":"","institution":"The First Affiliated Hospital of Soochow University","correspondingAuthor":false,"prefix":"","firstName":"Zhixing","middleName":"","lastName":"Jin","suffix":""},{"id":223399152,"identity":"fd12a6ab-a772-41af-a51b-ac81d18de2f5","order_by":1,"name":"Yaoming Peng","email":"","orcid":"","institution":"Fudan University","correspondingAuthor":false,"prefix":"","firstName":"Yaoming","middleName":"","lastName":"Peng","suffix":""},{"id":223399153,"identity":"5cf7e7b2-03dc-4012-a745-75fc7a60936c","order_by":2,"name":"He Zhang","email":"","orcid":"","institution":"The First Affiliated Hospital of Soochow University","correspondingAuthor":false,"prefix":"","firstName":"He","middleName":"","lastName":"Zhang","suffix":""},{"id":223399154,"identity":"fcfdeca7-d1db-49df-ac63-96bdada05e4a","order_by":3,"name":"Xiaoping He","email":"","orcid":"","institution":"Fudan University","correspondingAuthor":false,"prefix":"","firstName":"Xiaoping","middleName":"","lastName":"He","suffix":""},{"id":223399155,"identity":"cdee8902-41bf-4394-8656-cd04c96831df","order_by":4,"name":"Yi Zhang","email":"","orcid":"","institution":"The First Affiliated Hospital of Soochow University","correspondingAuthor":false,"prefix":"","firstName":"Yi","middleName":"","lastName":"Zhang","suffix":""},{"id":223399156,"identity":"137d0170-a92b-43ac-941a-7fcf2776f9ee","order_by":5,"name":"Xin Pan","email":"","orcid":"","institution":"The First Affiliated Hospital of Soochow University","correspondingAuthor":false,"prefix":"","firstName":"Xin","middleName":"","lastName":"Pan","suffix":""},{"id":223399157,"identity":"c152d471-042e-46d6-b669-458174d0cdf8","order_by":6,"name":"Min Li","email":"","orcid":"","institution":"The First Affiliated Hospital of Soochow University","correspondingAuthor":false,"prefix":"","firstName":"Min","middleName":"","lastName":"Li","suffix":""},{"id":223399159,"identity":"ddef3f5c-c955-4d8b-971c-e9602958f9e1","order_by":7,"name":"Qianqian Yang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABCUlEQVRIiWNgGAWjYNACAyBmBuIPDAyMDUBagmgtjDOI1wIFzDzEaDE4fvbwizcFdnl8x5mfPbb5c1i2v4H54G0eBrs8nFrO5KVZzjFILpY8zGZunNt22HjGAbZkax6G5GKcWg7kmBnzGDAnbjjMYCad23A4seEAj5k0D8OBxAZcWs6/AWmpB2ph/yZt8edw4vwD/N/wa7mRY/yYx+AwUAvQcAY2IOMADxteLZI33pgxzjE4njjzME+ZZG9buvHGw2zGIN/h1MJ3Psf4w5s/1Yl9549vk/jxx1p23vHmhzfeVNjh1KJwgIFNggfEOgATYgY7GId6IJBvYGD+gKplFIyCUTAKRgEaAAChgFveF0YxfgAAAABJRU5ErkJggg==","orcid":"","institution":"The First Affiliated Hospital of Soochow University","correspondingAuthor":true,"prefix":"","firstName":"Qianqian","middleName":"","lastName":"Yang","suffix":""}],"badges":[],"createdAt":"2023-07-30 11:44:21","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3217639/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3217639/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":41183589,"identity":"3af3518f-bde0-4932-8026-8ce9b5e1f648","added_by":"auto","created_at":"2023-08-07 14:10:20","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":753377,"visible":true,"origin":"","legend":"\u003cp\u003emRNA expression levels of TRP channels in eutopic endometrium throughout the menstrual cycle. (A) The scheme of adenomyosis as indicated in a cartoon and also the menstrual cycle is displayed to show which days of the cycle are included for sample collection in the different cycle phases, which was created with BioRender.com. (B–D) mRNA levels of members of the TRPV(B), TRPC(C) and TRPM(D) subfamily respectively in the eutopic endometrium of subjects with or without ADE, relatively quantified to the geometric mean of housekeeping genes GAPDH, during the proliferation phase or secretory phase. Significant differences between the RNA expression during the different phases of the menstrual cycle were assessed with one-way ANOVA test followed by Tukey's multiple comparisons test. Symbols for statistical significance levels: *P \u0026lt; 0.05, **P \u0026lt; 0.01 and ***P \u0026lt; 0.001 respectively.\u003c/p\u003e","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3217639/v1/d0ee06543d5b3bf16d7df0b7.jpg"},{"id":41184429,"identity":"3363cee3-bebc-4510-8be8-d3002ebdcefc","added_by":"auto","created_at":"2023-08-07 14:18:20","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":3094500,"visible":true,"origin":"","legend":"\u003cp\u003eThe protein expression of TRPV1, TRPM3 and TRPA1 in eutopic endometrium of adenomyosis patients. (A) Representative immunostaining images of TRPV1, TRPM3 and TRPA1 in patients with or without ADE during different phases of menstruation. Scale bars, 50μm. (B-D) Quantitative analysis of TRPA1(B), TRPM3(C), TRPV1(D) in patients with or without adenomyosis throughout the menstrual cycle. Significant differences between the RNA expression during the different phases of the menstrual cycle were assessed with the Kruskal–Wallis test for non-parametric data followed by Dunn’s multiple comparison. Symbols for statistical significance levels: *P \u0026lt; 0.05 and **P \u0026lt; 0.01 respectively.\u003c/p\u003e","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3217639/v1/559f2f9ff5392d6140c7b3a1.jpg"},{"id":41183590,"identity":"3fc969c9-d700-4935-831c-659e6f8eb7ab","added_by":"auto","created_at":"2023-08-07 14:10:20","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1141327,"visible":true,"origin":"","legend":"\u003cp\u003eCorrelation between TRPs staining level and the severity of dysmenorrhea, amount of menses or uterus size. (A-C) The difference in TRPV1(A), TRPM3(B) or TRPA1(C) in women complaining different severity of dysmenorrhea. The Spearman’s correlation coefficient and its statistical significance level are shown. (D-E) Correlation between TRPV1(D), TRPM3(E) or TRPA1(F) staining level and amount of menses. The Spearman’s correlation coefficient and its statistical significance level are shown. (G-I) Scatter plot showing the relationship between uterine size (in mm3) and TRPV1(G), TRPM3(H) or TRPA1(I) expression level. Pearson’s correlation coefficient, along with its statistical significance level, is also shown. The dashed line represents the regression line.\u003c/p\u003e","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3217639/v1/9a52c8970d273c46966b953b.jpg"},{"id":41184790,"identity":"9cde568e-d9c2-4bbe-b852-a85810499220","added_by":"auto","created_at":"2023-08-07 14:26:20","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":3297355,"visible":true,"origin":"","legend":"\u003cp\u003eTRPV1, TRPM3 and TRPA1 expression in tamoxifen-induced adenomyosis mice. (A) Representative images of HE staining at 5, 10, 15, 25 and 42 days of age and α-SMA immunostaining in mice with (TAM) or without (CTL) induced adenomyosis. The arrows are used to demonstrate where the ectopic endometrium invaded into the myometrium. (B) Representative immunostaining images of TRPV1, TRPM3 and TRPA1 in mice of the TAM and CTL group at 42 days of age. Scale bars, 100μm (C) Quantitative analysis with the two-tailed unpaired Student’s t-test of TRPV1, TRPM3 and TRPA1 in mice of the TAM and CTL group at 42 days of age. Scale bars, 50μm. Symbols for statistical significance levels: *P \u0026lt; 0.05 and ***P \u0026lt; 0.001 respectively.\u003c/p\u003e","description":"","filename":"Figure4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3217639/v1/f7ec047c2f34fe80d6b47250.jpg"},{"id":41183594,"identity":"5d1ee25b-7b7d-482b-9782-c7f650d09f73","added_by":"auto","created_at":"2023-08-07 14:10:20","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":3948475,"visible":true,"origin":"","legend":"\u003cp\u003ePrimidone markedly prolonged the response latency and reduced myometrial infiltration in tamoxifen-induced adenomyosis mice. (A) Diagrammatic drawing of Mouse experimental timeline, which was created with BioRender.com. (B) The weight of mice in different treatment groups at 13 weeks of age. (C) Hotplate latency test of mice subjected to primidone or atosiban treatment at the indicated times. (D) Representative images of HE staining in mice at 13 weeks of age after primidone or atosiban treatment. The arrows are used to demonstrate where the ectopic endometrium invaded into the myometrium. Scale bars, 200μm. (E) Quantified grades of myometrial infiltration by the endometrium following treatment with primidone or atosiban at 13 weeks of age. Symbols for statistical significance levels: *P \u0026lt; 0.05, ** P \u0026lt; 0.01, ***P \u0026lt; 0.001 and **** P \u0026lt; 0.0001 respectively.\u003c/p\u003e","description":"","filename":"Figure5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3217639/v1/59d1d0642f7429716e76a152.jpg"},{"id":41183593,"identity":"6e80fc81-d826-40f6-84f7-31c97d08c7f3","added_by":"auto","created_at":"2023-08-07 14:10:20","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":927739,"visible":true,"origin":"","legend":"\u003cp\u003eAnalysis of transcriptome alternation in mice uterus from control, adenomyosis model (AMS) and primidone treatment (AMS_P) group. (A) Heat map of differentially expressed genes in uterus from different groups. (B) The top 20 pathways enriched in the cell cycle and cell division. (C) Functional analysis of the DEGs in mice uterus of different groups. (D-H) Verification of CHIL1, COL9A2, PSMC3IP, NEIL3 and SPC24 gene expression by RT-PCR in different groups. Symbols for statistical significance levels: *P \u0026lt; 0.05, ** P \u0026lt; 0.01 and ***P \u0026lt; 0.001 respectively.\u003c/p\u003e","description":"","filename":"Figure6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3217639/v1/3f2dfeb16fe3ebb08371ee46.jpg"},{"id":41312891,"identity":"2b8b6785-0213-494d-8c3e-c3dbb00f7524","added_by":"auto","created_at":"2023-08-09 15:07:34","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1108256,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3217639/v1/d17196c8-4258-4159-9438-4ea1579c4d8c.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Inhibition of TRPM3 by primidone provides a potential therapeutic method for adenomyosis management","fulltext":[{"header":"Introduction","content":"\u003cp\u003eAdenomyosis (ADE) is an often-overlooked heterogeneous gynecologic condition with a range of symptoms, such as progressive dysmenorrhea, menorrhagia and infertility, which affect the quality of life of 20 to 35% of women of reproductive age and consume substantial health care resources [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Due to the unknown mechanisms, no drug is currently available for adenomyosis, and there are no specific guidelines to follow for the best management.\u003c/p\u003e \u003cp\u003eAmong all complaints from women with adenomyosis, dysmenorrhea and other types of pain, including cyclic or acyclic lower abdominal pain, cyclic dysuria and dyspareunia, are at the top of the list and are the most debilitating [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. However, the current therapeutic methods (surgical and/or hormonal therapies) often do not lead to sufficient pain control, and late diagnosis and high recurrence rates mean that women affected by this disease can suffer for decades before receiving proper treatment [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Although nonsteroidal anti-inflammatory drugs (NSAIDs) can alleviate menstrual pain, it has been reported that approximately 18% of women with dysmenorrhea are unresponsive to them, leaving them and their physicians to pursue less well-studied strategies [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eOne attractive approach is to target the very beginning of the pain pathway, focusing on nociceptive receptors [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Transient receptor potential (TRP) channels are the central receptors in the transduction of nociceptive stimuli by altering membrane potential or intracellular calcium concentration. In mammals, the TRP superfamily includes TRP vanilloid (TRPV), TRP ankyrin (TRPA), TRP melastatin (TRPM), and TRP canonical (TRPC) channels, which can be activated by a variety of stimuli and are widely distributed throughout the entire body [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. In normal endometrial biopsies, TRP channel expression has been shown to fluctuate during the menstrual cycle regulated by the female hormones estradiol and progesterone [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e], among which TRPV1, TRPM3 and TRPA1 are of particular interest [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Nonetheless, inhibiting pain by overwhelming TRPV1 and TRPA1 was largely halted because of hyperthermia, which could put patients at risk for scalding injuries by elevating the heat pain threshold [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. In this respect, TRPM3 is hitting the headlines as the latest TRP member to tackle.\u003c/p\u003e \u003cp\u003eHowever, current knowledge about the distribution of TRP channels in adenomyosis is rare. In pursuit of finding members of the TRP superfamily involved in adenomyosis, RNA and protein expression studies were performed on endometrial biopsies of adenomyosis patients during the different phases of the menstrual cycle and their correlation with the severity of dysmenorrhea was revealed. In addition, the TRPM3 antagonist primidone and the antagonist of the oxytocin receptor atosiban were used for the first time in a tamoxifen-induced adenomyosis mouse model, which may provide a potential therapeutic method for adenomyosis management.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003eEthics statement\u003c/p\u003e \u003cp\u003eThis study complied with the tenets of the Helsinki Declaration and the National Guidelines for Animal Use in Research (China). All experiments were performed under the guidelines of the National Research Council Guide for the Care and Use of Laboratory Animals and approved by the Medical Ethics Committee of the First Affiliated Hospital of Soochow University (Suzhou, China) and the Institutional Ethics Review Board of the Shanghai Obstetrics and Gynecology Hospital (Shanghai, China). All tissue samples were obtained after written, full and informed consent was obtained from the enrolled subjects.\u003c/p\u003e \u003cp\u003ePatients and human tissue collection\u003c/p\u003e \u003cp\u003eIn total, 50 human endometrial samples from adenomyosis patients were collected at the Obstetrics and Gynecology Hospital of Fudan University (Shanghai, China) and the First Affiliated Hospital of Soochow University (Suzhou, China) from June 2021 to June 2022. Their diagnoses were made by transvaginal ultrasound before surgery and histologically confirmed postoperatively. For controls, endometrial tissue samples were collected from 21 women who had undergone hysterectomy because of cervical intraepithelial neoplasia (CIN)-III, cervical carcinoma in situ and stage IA1 cervical cancer but were free of endometriosis, adenomyosis and uterine fibroids. All the recruited women in both the adenomyosis and control groups had not received any hormonal or anti-platelet treatment for at least 3 months prior to tissue collection. Two wedges of tissue from the lumen to the muscular myometrial layer that included superficial and basal endometrium as well as myometrium were taken from the detached uterus. One was immediately fixed in 10% buffered formalin at room temperature for 48 h and then embedded in paraffin for hematoxylin and eosin (HE) or immunohistochemical staining, and the other was placed in liquid nitrogen for RNA extraction. Information on uterine size, severity of dysmenorrhea, amount of menses, cycle length, reproductive history and age was also recorded.\u003c/p\u003e \u003cp\u003eReal-time polymerase chain reaction (RT‒PCR)\u003c/p\u003e \u003cp\u003eTotal RNA was isolated from endometrial tissues using a DNA/RNA/Protein isolation kit (Tiangen, China), and 1 \u0026micro;g of the purified total RNA was reverse transcribed into cDNA with a PrimeScript RT Master Mix kit (Takara, Japan) following the manufacturer\u0026rsquo;s protocol. RT‒PCR was performed with the CFX96 Real-time PCR Detection system (Biorad, USA) using the TB Green Premix Ex Taq II kit (Takara, Japan). The primers used in the experiment are shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. The relative expression of each gene was calculated using the delta\u0026ndash;delta Ct method, with GAPDH as the endogenous control.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSpecies\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSense primer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAntisense primer\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTRPV1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHuman\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTGCCGTTTCATGTTTGTCTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAGTCATTCTTCCCGTCTTCAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTRPV2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHuman\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATCTGCTCATCCCCAAGTTCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGCTTCTTCAGGGTAGGCTGAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTRPV3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHuman\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTCTATTTGCCTAACCTGCCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAATTCCATCCAGACCCACAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTRPV4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHuman\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCGTCTCCTTCTACATCAACG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGGTAGTAGGCGGTGAGAGTGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTRPV5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHuman\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGATCAGAATCCTCTGCGAGTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTTTCTCAGATGGATGCTCCTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTRPV6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHuman\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTCCTGGAACTTGCTCTCATT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGCGTTCATGCTACTCCTCTTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTRPM1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHuman\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCATAAAGAGCAGTTTGCAGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTCCATCCCATTTCTGTCAGTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTRPM2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHuman\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTTCTGGTTTGGTGTCAACAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGGCAGATTTAATGTCTTGGGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTRPM3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHuman\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCCTCTTACACCTGATGACCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGCTTTGATGAGCCCTTTCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTRPM4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHuman\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCACTGTCCTCTGCATCGACT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGCTGTTTGTTGACCGTGAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTRPM5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHuman\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTGCTGCCCTAGTGAACCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTGTCCTCCCAAGAGAAATGCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTRPM6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHuman\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAGACCATGCTGGGATAGATT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGTATCTGTTGGGCTTTTCGTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTRPM7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHuman\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCTCAGTTGCGAAAGAGTCAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGGTAGGGCTGTGCTGTCTTAAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTRPM8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHuman\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGGCAACCTCTAGCGATTACC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCACAAAGATGCTCATCCCAAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTRPC1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHuman\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGTTACCTCCACCTTTCAACAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCTGTTTTGCCGTTTGACCTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTRPC3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHuman\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCCGAGACTCAGAAGAGGTAGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTTAATGGCAAGTTTGACACGAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTRPC4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHuman\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCAGACACAGTCACCCACGAAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTTCCCCCACCCAGAGCACTAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTRPC5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHuman\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGACATCTCCAGCTTTCGGTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCCACTGCCATCATTATTATCGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTRPC6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHuman\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGATCGCTCCACAAGCCTATCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCCGCACCACTGGGATGTTAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTRPC7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHuman\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTGGCAGACCTGATTCAACAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGTAGAAGTCACAGACGCCGATG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTRPA1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHuman\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGGGAGCCACTGAGATTGTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eATGACATCCATCGGTTGTGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCHIL1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTACAGGATTGAGGGACCATAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAAAGGGAAGTGGGACGATTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCOL9A2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGAGGCTTCTGGTGGTCCTTAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTCTCCCCCAAAAGATACCCAAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePSMC3IP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGGAGGTGGGAACAGAGCGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eACACTATGGCTTTGTGCTCCGTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNEIL3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGAGAGGATTGCTTTACGGACT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTTAGCCGAGGGTCTGTTTATGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSPC24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGAGCCAGAGCCTTGACCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCAATGAACGCACTCACATACAGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHuman\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGGAAGGTGAAGGTCGGAGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGGGGTCATTGATGGCAACA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACCCAGAAGACTGTGGATGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCACATTGGGGGTAGGAACAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eImmunohistochemistry (IHC)\u003c/p\u003e \u003cp\u003eIHC staining was performed as previously described. The primary antibodies used included TRPV1 (1:200; Alomone, Israel), TRPA1 (1:200; Alomone, Israel), TRPM3 (1:200; Alomone, Israel) and α-SMA (1:200; Abcam, USA). Quantification of immunoreactivity was performed with Image Pro-Plus 6.0 software (Media Cybernetics Inc., USA), as described previously[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e].\u003c/p\u003e \u003cp\u003ePreparation of drugs and animals\u003c/p\u003e \u003cp\u003eAdministering tamoxifen orally to Institute of Cancer Research (ICR) newborn mice is a classic method to establish an experimental adenomyosis model. Tamoxifen was purchased from MedChemExpress Company (HY-13757A, New Jersey, USA). A total of six 19-day pregnant ICR mice weighing 40\u0026ndash;50 g were purchased from the Laboratory Animal Center of the Shanghai Institutes of Biological Sciences (Shanghai, China). Each dam and her pups were housed in the same cage under controlled conditions (12:12 light/dark cycle, 70\u0026ndash;80% humidity, 22\u0026ndash;24\u0026deg;C) and had access to chow and fresh water ad libitum.\u003c/p\u003e \u003cp\u003eWe obtained 24 female neonatal mice from 6 pregnant ICR mice, while all the male neonatal progeny were sacrificed by cervical dislocation. The female neonates were randomly divided into four groups: i) control (n\u0026thinsp;=\u0026thinsp;6); ii) ADE model (n\u0026thinsp;=\u0026thinsp;6); iii) primidone (n\u0026thinsp;=\u0026thinsp;6; Sigma, USA); and iv) atosiban (n\u0026thinsp;=\u0026thinsp;6; Sigma, USA). From Day 1 to Day 5 after birth, female neonatal mice in the ADE group and drug treatment groups received 1 mg/kg tamoxifen suspended in a peanut oil/lecithin/condensed milk mixture (2:0.2:3, by volume) at a dose volume of 5 \u0026micro;l/g body weight, while the control neonatal mice were fed similarly with the same amount of solvent without tamoxifen. All mice were weaned and separated from the dams upon reaching 3 weeks of age, at which point the dams were sacrificed by cervical dislocation. From 10 weeks after birth, mice in the drug treatment groups were administered by intraperitoneal injection with either primidone (2 mg/kg/d) or atosiban (1 mg/kg/d) for 3 weeks, while the mice in the control and ADE groups were administered similarly with corresponding quantities of the vehicle. All mice were subjected to a hotplate test once a week for 3 weeks beginning at 10 weeks. Uterine samples from the mice in the four aforementioned groups were harvested at 13 weeks of age after the last hotplate test. All mice had a normal estrus cycle.\u003c/p\u003e \u003cp\u003eHotplate test procedure\u003c/p\u003e \u003cp\u003eAs described previously [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], a commercially available Hot Plate Analgesia Meter (BME-480; Chinese Academy of Medical Sciences, China) was used for the hotplate test. The surface of the plate was heated to and maintained at a constant temperature of 50.0\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1℃ as measured using a built-in digital thermometer. A plastic cylinder 20 cm in diameter and 18 cm in height was placed on the hotplate. All mice were allowed to acclimatize under a controlled environment at 22\u0026ndash;24℃ with 70\u0026ndash;80% humidity in the testing room for 10 min prior to test commencement. The latency response to thermal stimuli was defined as the time (sec) elapsed from the moment the mouse was placed inside the cylinder to the moment it licked its hind paws. Each mouse was tested once per session. The latency was calculated as the mean between two readings recorded between 24 h intervals.\u003c/p\u003e \u003cp\u003eAnimal specimen collection\u003c/p\u003e \u003cp\u003eAfter treatment for 3 weeks, all mice were anesthetized, and the uteri were then excised, where half of the samples were immediately fixed in 4% paraformaldehyde at room temperature for 48 h and all remaining uterine tissue samples were placed immediately in liquid nitrogen for subsequent mRNA array.\u003c/p\u003e \u003cp\u003eRNA sequencing (RNA-seq) and data analysis\u003c/p\u003e \u003cp\u003eRNA-seq and analysis were conducted by OE Biotech Co. (Shanghai, China). Briefly, after collecting uterus tissues from mice in different groups, total RNA was extracted and quantified by a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, USA). RNA integrity was assessed using the Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA), and RNA samples with RIN\u0026thinsp;\u0026gt;\u0026thinsp;7.0 were subjected to further processing.\u003c/p\u003e \u003cp\u003eThen, the libraries were constructed using the TruSeq Stranded mRNA LT Sample Prep Kit (Illumina, USA) and subsequently sequenced on an Illumina NovaSeq 6000 platform. High-quality reads were mapped to the mouse reference genome using HISAT2 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://ccb.jhu.edu/software/hisat2/index.shtml\u003c/span\u003e\u003cspan address=\"https://ccb.jhu.edu/software/hisat2/index.shtml\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Gene expression levels were estimated as fragments per kilobase of transcript per million mapped reads. Differentially expressed genes (DEGs) between the two groups were identified using the DESeq R package (R Foundation for Statistical Computing; \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.r-project.org/\u003c/span\u003e\u003cspan address=\"http://www.r-project.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The threshold was set as false discovery rate-adjusted P value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 and fold change\u0026thinsp;\u0026gt;\u0026thinsp;2 or fold change\u0026thinsp;\u0026lt;\u0026thinsp;0.5. DEGs that were increased/decreased in adenomyosis mice and then decreased/increased after primidone treatment were identified. Hierarchical cluster analysis of these DEGs was performed to demonstrate the expression pattern of genes in different groups. Based on the hypergeometric distribution, GO and KEGG pathway enrichment analyses of these selected DEGs were further performed to screen the significantly enriched terms using R. The raw RNA-seq data were deposited in the Gene Expression Omnibus database (available: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/geo\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov/geo\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e; accession number GSE227384).\u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eStatistical differences were analyzed using Statistical Package for the Social Sciences (SPSS) software (22.0) (Chicago, USA). Two-tailed unpaired Student\u0026rsquo;s t test, one-way ANOVA followed by Tukey's multiple comparisons test, Kruskal\u0026ndash;Wallis test followed by Dunn\u0026rsquo;s multiple comparison, and Pearson\u0026rsquo;s and Spearman\u0026rsquo;s correlation analysis were used for further analyses. P values of 0.05 were considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e \u003col\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003emRNA expression profile of TRP channels in eutopic endometrial biopsies from patients with and without adenomyosis throughout the menstrual cycle.\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003c/ol\u003e \u003c/p\u003e \u003cp\u003eThe characteristics of the recruited patients with adenomyosis and the control subjects are listed in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. As shown in the table, the patients in different groups were comparable in age, live births, miscarriages and cycle length. However, patients with adenomyosis had significantly larger uterine sizes, heavier menses and more severe dysmenorrhea.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eCharacteristics of recruited patients with and without adenomyosis for mRNA expression profile of TRP channels in endometrial biospies.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVariable name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eControl\u003c/p\u003e \u003cp\u003eProliferative phase\u003c/p\u003e \u003cp\u003en\u0026thinsp;=\u0026thinsp;6\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eControl\u003c/p\u003e \u003cp\u003eSecretory phase\u003c/p\u003e \u003cp\u003en\u0026thinsp;=\u0026thinsp;6\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAdenomyosis\u003c/p\u003e \u003cp\u003eProliferative phase\u003c/p\u003e \u003cp\u003en\u0026thinsp;=\u0026thinsp;13\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eAdenomyosis\u003c/p\u003e \u003cp\u003eSecretory phase\u003c/p\u003e \u003cp\u003en\u0026thinsp;=\u0026thinsp;7\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003ep-value\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAge (years)\u003c/p\u003e \u003cp\u003eMedian (range)\u003c/p\u003e \u003cp\u003eMean (\u0026plusmn;\u0026thinsp;S.D.)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e38(36\u0026ndash;47)\u003c/p\u003e \u003cp\u003e40.0\u0026thinsp;\u0026plusmn;\u0026thinsp;4.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e41(31\u0026ndash;51)\u003c/p\u003e \u003cp\u003e40.5\u0026thinsp;\u0026plusmn;\u0026thinsp;8.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e47(36\u0026ndash;54)\u003c/p\u003e \u003cp\u003e45.9\u0026thinsp;\u0026plusmn;\u0026thinsp;4.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e46(38\u0026ndash;54)\u003c/p\u003e \u003cp\u003e46.0\u0026thinsp;\u0026plusmn;\u0026thinsp;5.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.09\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLive births\u003c/p\u003e \u003cp\u003eMedian (range)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1(1\u0026ndash;2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.5(1\u0026ndash;2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1(1\u0026ndash;2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1(1\u0026ndash;2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.32\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMiscarriages\u003c/p\u003e \u003cp\u003eMedian (range)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.5(1\u0026ndash;3)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.5(1\u0026ndash;4)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1(0\u0026ndash;5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2(0\u0026ndash;2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.75\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCycle length (days)\u003c/p\u003e \u003cp\u003eMedian (range)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e27(25\u0026ndash;30)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e30(30\u0026ndash;30)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e30(26\u0026ndash;33)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e28(23\u0026ndash;30)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.06\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAmount of menses\u003c/p\u003e \u003cp\u003eLight \u0026amp; Moderate\u003c/p\u003e \u003cp\u003eHeavy\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5(83.3%)\u003c/p\u003e \u003cp\u003e1(16.7%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e6(100%)\u003c/p\u003e \u003cp\u003e0(0%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e7(53.8%)\u003c/p\u003e \u003cp\u003e6(46.2%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0(0%)\u003c/p\u003e \u003cp\u003e7(100%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;0.0001\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSeverity of dysmenorrhea\u003c/p\u003e \u003cp\u003eNone\u003c/p\u003e \u003cp\u003eMild\u003c/p\u003e \u003cp\u003eModerate\u003c/p\u003e \u003cp\u003eSevere\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4(66.7%)\u003c/p\u003e \u003cp\u003e2(33.3%)\u003c/p\u003e \u003cp\u003e0(0%)\u003c/p\u003e \u003cp\u003e0(0%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4(66.7%)\u003c/p\u003e \u003cp\u003e2(33.3%)\u003c/p\u003e \u003cp\u003e0(0%)\u003c/p\u003e \u003cp\u003e0(0%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2(15.4%)\u003c/p\u003e \u003cp\u003e1(7.7%)\u003c/p\u003e \u003cp\u003e6(46.2%)\u003c/p\u003e \u003cp\u003e4(30.7%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0(0%)\u003c/p\u003e \u003cp\u003e1(14.2%)\u003c/p\u003e \u003cp\u003e3(42.9%)\u003c/p\u003e \u003cp\u003e3(42.9%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;0.0001\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eUterine size (in cm3)\u003c/p\u003e \u003cp\u003eMean (\u0026plusmn;\u0026thinsp;S.D.)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e117.0\u0026thinsp;\u0026plusmn;\u0026thinsp;30.12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e152.7\u0026thinsp;\u0026plusmn;\u0026thinsp;56.82\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e531.0\u0026thinsp;\u0026plusmn;\u0026thinsp;312.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e521.1\u0026thinsp;\u0026plusmn;\u0026thinsp;324.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.0029\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eUsing RT‒PCR analysis, the expression profile of TRP channels in endometrial biopsies of control (proliferation phase n\u0026thinsp;=\u0026thinsp;6; secretory phase n\u0026thinsp;=\u0026thinsp;6) and adenomyosis (proliferation phase n\u0026thinsp;=\u0026thinsp;13; secretory phase n\u0026thinsp;=\u0026thinsp;7) patients harvested at different times during menstruation was investigated (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Compared with the proliferation phase of the control endometrium, the mRNA expression of TRPM1, TRPM3, TRPM4, TRPM6, TRPM7, TRPM8, TRPC1, TRPC3, TRPC4, TRPC5, TRPC6, TRPV4, TRPV5, and TRPA1 was significantly increased during the secretory phase (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB-D). Moreover, we compared the endometrium of the proliferation phase in controls with the same phase in adenomyosis and found that except for TRPV4, TRPC7, TRPM2, TRPM4, TRPM5, and TRPM8, the mRNA expression of the other 15 TRP channels was significantly elevated in adenomyosis. No significant difference was found when comparing the secretory phase of the control endometrium with the adenomyosis endometrium. Taken together, these results illustrate a distinct TRP channel expression pattern between control and adenomyosis endometria.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003col start=2\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003eThe expression of TRPV1, TRPM3 and TRPA1 in the endometrium of adenomyosis patients by IHC\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003c/ol\u003e \u003c/p\u003e \u003cp\u003eThe characteristics of the recruited patients with adenomyosis (proliferation phase n\u0026thinsp;=\u0026thinsp;29; secretory phase n\u0026thinsp;=\u0026thinsp;21) and the control subjects (proliferation phase n\u0026thinsp;=\u0026thinsp;14; secretory phase n\u0026thinsp;=\u0026thinsp;7) are listed in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. Immunohistochemistry analysis was carried out to determine the expression of TRPV1, TRPM3 and TRPA1 at the protein level. We found that TRPV1 and TRPA1 staining was mainly seen in endometrial epithelial cells in both control and adenomyosis tissues and mostly localized in the cytomembrane. TRPM3 staining was observed in both epithelial and stromal cells and was localized in the cytoplasm and cytomembrane (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eCharacteristics of recruited patients with and without adenomyosis for the expression of TRPV1, TRPM3 and TRPA1 in endometrium at protein level.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVariable name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eControl\u003c/p\u003e \u003cp\u003eProliferative phase\u003c/p\u003e \u003cp\u003en\u0026thinsp;=\u0026thinsp;14\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eControl\u003c/p\u003e \u003cp\u003eSecretory phase\u003c/p\u003e \u003cp\u003en\u0026thinsp;=\u0026thinsp;7\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAdenomyosis\u003c/p\u003e \u003cp\u003eProliferative phase\u003c/p\u003e \u003cp\u003en\u0026thinsp;=\u0026thinsp;29\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eAdenomyosis\u003c/p\u003e \u003cp\u003eSecretory phase\u003c/p\u003e \u003cp\u003en\u0026thinsp;=\u0026thinsp;21\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003ep-value\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAge (years)\u003c/p\u003e \u003cp\u003eMedian (range)\u003c/p\u003e \u003cp\u003eMean (\u0026plusmn;\u0026thinsp;S.D.)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e41.5(36\u0026ndash;52)\u003c/p\u003e \u003cp\u003e42.4\u0026thinsp;\u0026plusmn;\u0026thinsp;5.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e42(39\u0026ndash;51)\u003c/p\u003e \u003cp\u003e44.6\u0026thinsp;\u0026plusmn;\u0026thinsp;5.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e47(37\u0026ndash;52)\u003c/p\u003e \u003cp\u003e45.6\u0026thinsp;\u0026plusmn;\u0026thinsp;4.9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e45(34\u0026ndash;53)\u003c/p\u003e \u003cp\u003e44.3\u0026thinsp;\u0026plusmn;\u0026thinsp;4.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.21\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLive births\u003c/p\u003e \u003cp\u003eMedian (range)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1(0\u0026ndash;3)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1(1\u0026ndash;2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1(0\u0026ndash;3)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1(0\u0026ndash;2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.71\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMiscarriages\u003c/p\u003e \u003cp\u003eMedian (range)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2(1\u0026ndash;4)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2(1\u0026ndash;4)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1(0\u0026ndash;5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1(0\u0026ndash;3)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.12\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCycle length (days)\u003c/p\u003e \u003cp\u003eMedian (range)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e28(25\u0026ndash;30)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e30(28\u0026ndash;30)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e30(23\u0026ndash;40)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e30(23\u0026ndash;35)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.13\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAmount of menses\u003c/p\u003e \u003cp\u003eLight \u0026amp; Moderate\u003c/p\u003e \u003cp\u003eHeavy\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e13(92.9%)\u003c/p\u003e \u003cp\u003e1(7.1%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e7(1000%)\u003c/p\u003e \u003cp\u003e0(0%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e14(48.3%)\u003c/p\u003e \u003cp\u003e15(51.7%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e7(33.4%)\u003c/p\u003e \u003cp\u003e14(66.6%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;0.0001\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDysmenorrhea severity\u003c/p\u003e \u003cp\u003eNone\u003c/p\u003e \u003cp\u003eMild\u003c/p\u003e \u003cp\u003eModerate\u003c/p\u003e \u003cp\u003eSevere\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e12(85.7%)\u003c/p\u003e \u003cp\u003e2(14.3%)\u003c/p\u003e \u003cp\u003e0(0%)\u003c/p\u003e \u003cp\u003e0(0%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5(71.4%)\u003c/p\u003e \u003cp\u003e2(28.6%)\u003c/p\u003e \u003cp\u003e0(0%)\u003c/p\u003e \u003cp\u003e0(0%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4(13.8%)\u003c/p\u003e \u003cp\u003e4(13.8%)\u003c/p\u003e \u003cp\u003e13(44.8%)\u003c/p\u003e \u003cp\u003e8(27.6%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1(4.8%)\u003c/p\u003e \u003cp\u003e2(9.5%)\u003c/p\u003e \u003cp\u003e5(23.8%)\u003c/p\u003e \u003cp\u003e13(61.9%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;0.0001\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eUterine size (in cm3)\u003c/p\u003e \u003cp\u003eMean (\u0026plusmn;\u0026thinsp;S.D.)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e108.6\u0026thinsp;\u0026plusmn;\u0026thinsp;34.85\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e173.7\u0026thinsp;\u0026plusmn;\u0026thinsp;76.10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e650.1\u0026thinsp;\u0026plusmn;\u0026thinsp;560.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e628.9\u0026thinsp;\u0026plusmn;\u0026thinsp;288.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.0001\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn the control endometrium, the staining levels of TRPM3, TRPV1 and TRPA1 displayed no significant difference at different times during menstruation. Consistent with previous results at the mRNA level, TRPM3 and TRPA1 were highly expressed in the endometrium of the proliferation phase in adenomyosis patients compared with the same phase of the control endometrium (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB-C). Moreover, impressively increased expression of TRPV1 was exhibited in the secretory phase of the adenomyotic endometrium compared with that of the same phase of the control endometrium; however, no obvious changes were observed in the endometrium in the proliferation phase (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003e \u003col start=3\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003eThe severity of dysmenorrhea correlated positively with TRPV1, TRPM3 or TRPA1 staining levels\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003c/ol\u003e \u003c/p\u003e \u003cp\u003eSince dysmenorrhea is one of the major complaints in women with adenomyosis, we attempted to examine whether TRPV1, TRPM3 and TRPA1 are associated with the severity of dysmenorrhea in women with adenomyosis using immunohistochemistry. We found that TRPV1, TRPM3 and TRPA1 staining levels were significantly correlated with the severity of dysmenorrhea (Spearman\u0026rsquo;s r\u0026thinsp;=\u0026thinsp;0.3234/P\u0026thinsp;=\u0026thinsp;0.0141, r\u0026thinsp;=\u0026thinsp;0.5688/P<0.0001 and r\u0026thinsp;=\u0026thinsp;0.3657/P\u0026thinsp;=\u0026thinsp;0.0044, respectively; Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA-C).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003col start=4\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003eAmount of menses and determination of TRPV1, TRPM3 or TRPA1 immunoreactivity\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003c/ol\u003e \u003c/p\u003e \u003cp\u003eWe next examined the relationship, if any, between TRPV1, TRPM3 or TRPA1 immunoreactivity and the amount of menses. Since there was only one woman who reported light menses, we divided all cases into two groups: women who reported light or moderate menses and those who reported heavy menses. We found that higher TRPV1, TRPM3 or TRPA1 staining in the eutopic endometrium was easier to observe in women with heavy menses (Spearman\u0026rsquo;s r\u0026thinsp;=\u0026thinsp;0.3117/P\u0026thinsp;=\u0026thinsp;0.018, r\u0026thinsp;=\u0026thinsp;0.3158/P\u0026thinsp;=\u0026thinsp;0.0158, r\u0026thinsp;=\u0026thinsp;0.3846/P\u0026thinsp;=\u0026thinsp;0.0026, respectively; Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD-F). This suggests that TRPV1, TRPM3 or TRPA1 overexpression in eutopic endometrium is associated with, and possibly responsible for, heavy menstrual bleeding in women with adenomyosis.\u003c/p\u003e \u003cp\u003e \u003col start=5\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003eUterus size and TRPV1, TRPM3 or TRPA1 immunoreactivity\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003c/ol\u003e \u003c/p\u003e \u003cp\u003eAs an enlarged uterus is one of three major presentations of adenomyosis after abnormal uterine bleeding and dysmenorrhea, we also examined the relationship between uterus size and TRPV1, TRPM3 or TRPA1 immunoreactivity. We found that larger uterus sizes were easily observed in those with higher expression of TRPV1, TRPM3 or TRPA1 in the endometrium (Pearson\u0026rsquo;s r\u0026thinsp;=\u0026thinsp;0.3182/P\u0026thinsp;=\u0026thinsp;0.0190, r\u0026thinsp;=\u0026thinsp;0.3001/P\u0026thinsp;=\u0026thinsp;0.0246 and r\u0026thinsp;=\u0026thinsp;0.3914/P\u0026thinsp;=\u0026thinsp;0.0029, respectively; Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG-I).\u003c/p\u003e \u003cp\u003e \u003col start=6\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003eTRPV1, TRPM3 and TRPA1 expression was upregulated in tamoxifen-induced mice\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003c/ol\u003e \u003c/p\u003e \u003cp\u003eTo determine whether mouse endometrial epithelial cells or stromal cells have a transient receptor potential (TRP) channel expression profile similar to that found in the human endometrium, tamoxifen was used to induce adenomyosis in newborn ICR mice.\u003c/p\u003e \u003cp\u003eMice in each group were killed at Day 5, Day 10, Day 15, Day 25 and Day 42 separately for the calculation of the rate of adenomyosis formation by HE staining. The complete absence of any ectopic endometrium in the myometrium was considered successful establishment of the adenomyosis mouse model. At Day 42, all mice in the adenomyosis model group showed endometrial invasion into the myometrium, while no ectopic endometrium was observed in the myometrium of the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Compared with mice in the control group, the expression of TRPV1, TRPM3 and TRPA1 was significantly increased, and its expression position was similar to those in human samples (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB-C).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003col start=7\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003eThe effect of primidone and atosiban on hot plate response latency following adenomyosis establishment.\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003c/ol\u003e \u003c/p\u003e \u003cp\u003eThe hotplate test is a commonly used method for measuring nociception and evaluating response thresholds to thermal stimuli in rodents. In the present study, all mice were subjected to hot plate testing once a week from 10 weeks after birth. At 13 weeks, mice in different groups were sacrificed after being weighed and subjected to the hotplate test (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). We found that there was no significant difference in body weight among the groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). The hot plate response latency in mice from the ADE group was significantly decreased compared with that in mice from the control group. After 2 weeks of treatment with primidone and 3 weeks of treatment with atosiban, a significantly prolonged response latency was observed in both treatment groups compared with the ADE group, and primidone exhibited a better analgesic effect than atosiban (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003col start=8\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003eThe depth of myometrial infiltration was significantly decreased after primidone treatment.\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003c/ol\u003e \u003c/p\u003e \u003cp\u003eThe depth of myometrial infiltration of the ectopic endometrium was evaluated following the criteria described by Bird [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. As demonstrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD-E, compared with the control group, mice in the ADE group exhibited significantly increased infiltration. After treatment with primidone for 3 weeks, mice demonstrated significantly reduced myometrial infiltration compared with untreated mice in the ADE group. Although mice treated with atosiban displayed less myometrial infiltration than those in the ADE group, the difference was not significant (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05).\u003c/p\u003e \u003cp\u003e \u003col start=9\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003eTranscriptomic analysis of the uterus following primidone treatment in the mouse adenomyosis model\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003c/ol\u003e \u003c/p\u003e \u003cp\u003eTo identify the potential signaling pathway that primidone is involved in in addition to analgesia, high-throughput RNA-seq was performed in mice in the control, ADE model and primidone treatment groups (n\u0026thinsp;=\u0026thinsp;3). Compared with the control group, 517 genes were at least twofold differentially expressed in the tamoxifen-induced adenomyosis group: 271 were downregulated and 246 were upregulated. There were 133 DEGs, including 45 upregulated genes and 88 downregulated genes, in the primidone treatment group compared to the ADE model group. Overall, 27 genes were upregulated in the ADE model group and then downregulated after primidone treatment, while 20 genes were downregulated in the ADE model group and then upregulated after primidone treatment. Hierarchical clustering analysis showed systematic variation in the expression of mRNAs among these three groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eSignificantly enriched GO terms from the three groups were mostly related to the cell cycle and cell division (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). GO terms related to chromosomes and the regulation of cytokinesis were also enriched. KEGG pathway enrichment analysis was also performed to determine the potential biological roles of the DEGs. The top 20 pathways with more than 2 DEGs were screened out, including \u0026ldquo;Cell cycle\u0026rdquo;, \u0026ldquo;Cellular senescence\u0026rdquo;, \u0026ldquo;Pathways in cancer\u0026rdquo;, and \u0026ldquo;PI3K-Akt signaling pathway\u0026rdquo;. Notably, the number of differentially expressed genes associated with \u0026ldquo;Cell cycle\u0026rdquo; was the largest (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003eFinally, we analyzed the expression of 5 genes by RT‒PCR based on fold changes in expression shown in RNA-Seq and prospective therapeutic value to verify our previous data. These were CHIL1, COL9A2, PSMC3IP, NEIL3 and SPC24. The expression ratios of these genes determined by RT‒PCR were consistent with those from RNA-seq analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD-H).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eAdenomyosis is the presence of endometrial glands and stroma within the myometrium, contributing to the most common cause of secondary dysmenorrhea [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. However, despite its common occurrence, it is underdiagnosed and undertreated. It has been reported that the disease is diagnosed on average 10 years after the onset of symptoms, and nonspecific complaints may lead to consultations regarding various medical management [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Considering the significant effects of dysmenorrhea and other types of pain regarding women\u0026rsquo;s reproductive health, further investigation is needed.\u003c/p\u003e \u003cp\u003ePain can be divided into the following three categories: nociceptive pain, inflammatory pain and neuropathic pain [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Dysmenorrhea and cyclic lower abdominal pain caused by ADE can initially be understood as nociceptive inflammatory pain [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Interleukin-6, interleukin-8, TNF-α and PGE\u003csub\u003e2\u003c/sub\u003e, which are considered proinflammatory factors, have been reported to be significantly increased in women with ADE [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. This form of pain could be well managed with NSAIDs by decreasing the levels of prostaglandins. However, a review of 51 different clinical trials found that 18% of women reported minimal or no relief of menstrual pain with NSAIDs [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e], which means there should be other pathways involved in ADE-associated pain.\u003c/p\u003e \u003cp\u003eIn recent years, primary disorders of the uterine layers with hyperperistalsis have been found to play an important role in pain mediator release and subsequent pain fiber activation [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Increased frequency and magnitude of uterine contractions and neurotrophic factor secretion induced by the elevated expression of OTR has been reported to contribute to promoting hyperinnervation and central sensitization, leading to dysmenorrhea and other types of pain in ADE patients [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. However, there is no research on OTR inhibitors in either ADE patients or ADE animal models. Exercise[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e] and nutritional interventions [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e], such as supplementation or increased intake of omega-3 fatty acids and vitamin B, may also provide some benefit, but the evidence is limited to small randomized controlled trials (RCTs). Overall, it seems that a great deal of work is still needed to unravel the mystery of adenomyosis-associated pain.\u003c/p\u003e \u003cp\u003eTRP channels are transmembrane protein complexes, and steroids, including estrogen, progesterone and androgens, have been found to affect the physiology of the cells and regulate where TRP channels are expressed [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Regarding the roles of TRP channels in inflammatory pain, evidence suggests that inflammatory mediators can sensitize or alter the threshold of TRP channels, leading to pain behaviors [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Moreover, calcium is also a key player in a variety of important events, including fertilization, decidualization and implantation [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. The functional expression of the calcium-conducting TRP channels TRPV2, TRPV4, TRPC6 and TRPM7 was described in human endometrial stromal cells, and pregnancy outcome in mice has been found to be perturbed by the deletion of TRPC6 channels [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e], which renders them good candidates for intercellular signaling during processes such as decidualization and embryo implantation, in addition to pain control.\u003c/p\u003e \u003cp\u003eIn our research, we first verified the mRNA expression of different subtypes of TRPV, TRPA, TRPM and TRPC channels by collecting the eutopic endometrium of patients with and without adenomyosis. We found that except for TRPM2, TRPM5, TRPV1, TRPV2, TRPV3, TRPV6 and TRPC7, the expression of the other 14 TRP channels increased significantly in the secretory phase in women without adenomyosis, which may support their possible regulation by ovarian hormones that has been reported by other research and their possible role in fertility. Significantly elevated expression of TRP channels other than TRPV4, TRPC7, TRPM2, TRPM4, TRPM5, and TRPM8 has been found in adenomyosis during the proliferative phase, suggesting their possible involvement in adenomyosis.\u003c/p\u003e \u003cp\u003eThen, we used IHC to test the protein expression levels of TRPV1, TRPM3 and TRPA1, the most popular proteins in pain research, and found that TRPM3 and TRPA1 were significantly increased in the proliferative phase of patients with adenomyosis, which was consistent with the results at the mRNA level. Impressively increased expression of TRPV1 was exhibited in the secretory phase of the adenomyotic endometrium compared with the same phase of the control endometrium, which may contribute to adenomyosis-related infertility. Furthermore, a close positive relationship between TRPV1, TRPM1 or TRPA1 and the severity of dysmenorrhea, amount of menses or uterus size was determined by Spearson and Pearson correlation analysis, suggesting their possible involvement not only in adenomyosis-associated pain but also in the pathogenesis of the disease.\u003c/p\u003e \u003cp\u003eWith the discovery of nociceptive TRP channels, there is tremendous interest expressed by pharmaceutical companies in TRP channels, and they hope to develop a new class of potent, safe analgesics. However, for the time being, the down side of TRP channels has been most prominent. Activation or inhibition of a TRP channel may be beneficial for pain relief while inducing unacceptable adverse effects at the same time. Indeed, the clinical development of TRPV1 antagonists was largely halted because of hyperthermia [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e], and TRPA1-targeted drug development encountered pharmaceutical and pharmacokinetic complications [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Therefore, the spotlight has recently moved to TRPM3.\u003c/p\u003e \u003cp\u003ePrimidone and the flavone isosakuranetin have been reported as TRPM3 antagonists and are reassuringly devoid of serious side effects [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Therefore, in the following experiment, we verified the possible effects of primidone on tamoxifen-induced adenomyosis in newborn ICR mice and compared them with those of atosiban, an oxytocin receptor antagonist. The results showed that primidone exhibited a better analgesic effect than that of atosiban after 3 weeks of treatment. Surprisingly, we found that primidone could also significantly decrease the depth of myometrial infiltration, which suggested that multiple pathological mechanisms may contribute to the effectiveness of TRPM3 inhibition.\u003c/p\u003e \u003cp\u003eTo clarify other possible involved mechanisms, transcriptomic analysis of mouse uteri from the control, ADE model and primidone treatment groups was performed. We first screened out the DEGs that were at least twofold differentially expressed and were increased/decreased in adenomyosis mice and then decreased/increased after primidone treatment. Differential genes were found to be the most associated with \u0026ldquo;Cell cycle\u0026rdquo; and \u0026ldquo;Cell division\u0026rdquo; by GO term enrichment and KEGG enrichment analysis, which reveal that they may be one of the pathways involved in the effectiveness of TRPM3 inhibition. Finally, based on the fold changes in expression in RNA-Seq and prospective therapeutic value, we verified the expression ratios of CHIL1, COL9A2, PSMC3IP, NEIL3, and SPC24. These genes play an important role in multiple pathological mechanisms, including inflammation, tissue remodeling, injury, DNA repair and cell mitosis [\u003cspan additionalcitationids=\"CR34\" citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e], which deserves further investigation. In addition, decreased PSMC3IP and SPC24 have also been reported to contribute to female infertility via meiotic failure [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e], which might be further studied in the field of adenomyosis-related reproductive issues.\u003c/p\u003e \u003cp\u003eOur study has two limitations. First, all ADE patients enrolled in our study were diffuse type, and whether our conclusion can be extended to focal ADE remains to be demonstrated. Second, the transcriptomic analysis is only a preliminary step that does not reveal the full mechanism of TRPM3 antagonists. Genes that are shortlisted by this analysis should be investigated in in vitro or in vivo models involving overexpression/knockdown studies, protein analyses and functional assays. We plan to carry out these experiments in our future research.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003eAcknowledgements\u003c/p\u003e\n\u003cp\u003eWe are grateful to the women who participated in this study, OE Biotech Co. (Shanghai, China) for assisting in sequencing and/or bioinformatics analysis and Xishan Biotech Co. (Suzhou, China) for providing experimental platform.\u003c/p\u003e\n\u003cp\u003eEthics approval\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAll experiments were performed under the guidelines of the National Research Council Guide for the Care and Use of Laboratory Animals and approved by the Medical Ethics Committee of the First Affiliated Hospital of Soochow University (Suzhou, China) and the Institutional Ethics Review Board of the Shanghai Obstetrics and Gynecology Hospital (Shanghai, China).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eConsent to participate\u003c/p\u003e\n\u003cp\u003eAll tissue samples were obtained after written, full and informed consent from recruited subjects.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eConsent for publication\u003c/p\u003e\n\u003cp\u003eAll authors have approved the final version of this manuscript and consent for its publication.\u003c/p\u003e\n\u003cp\u003eData availability\u003c/p\u003e\n\u003cp\u003eThe datasets used and/or analyzed during the present study are available from the corresponding author on reasonable request. The RNA-seq raw data was deposited in the Gene Expression Omnibus database (available: https://www.ncbi.nlm.nih.gov/geo; accession number GSE227384).\u003c/p\u003e\n\u003cp\u003eFunding\u003c/p\u003e\n\u003cp\u003eThe present study was supported by funding from the National Natural Science Foundation of China (No. 82001523 and No.82101215), Gusu Health Talent Project (No. GSWS2021004)\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eCompeting interests\u003c/p\u003e\n\u003cp\u003eAll authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003eAuthors\u0026apos; contributions\u003c/p\u003e\n\u003cp\u003eZ.X.J. designed the study, performed the human sample experiments, analyzed the data and drafted the manuscript. Y.M.P. performed the animal experiments and carried out initial data analysis. H.Z. and X.P.H. contributed to the experimental preparation and human sample collection. Y.Z. and X.P. was involved in patient recruitment and the data interpretation and discussion. M.L. contributed to the conception of the study and critically revised the manuscript. Q.Q.Y. supervised the research project and gave final approval. All authors reviewed the manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eChapron C, Vannuccini S, Santulli P, Abr\u0026atilde;o MS, Carmona F, Fraser IS, et al. Diagnosing adenomyosis: an integrated clinical and imaging approach. Hum Reprod Update. 2020;26(3):392\u0026ndash;411.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUpson K, Missmer SA. Epidemiology of Adenomyosis. Semin Reprod Med. 2020;38(2\u0026ndash;03):89\u0026ndash;107.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuo SW. Cracking the enigma of adenomyosis: an update on its pathogenesis and pathophysiology. Reproduction. 2022;164(5):R101-R121.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVannuccini S, Luisi S, Tosti C, Sorbi F, Petraglia F. Role of medical therapy in the management of uterine adenomyosis. Fertil Steril. 2018;109(3):398\u0026ndash;405.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOladosu FA, Tu FF, Hellman KM. Nonsteroidal anti-inflammatory drug resistance in dysmenorrhea: epidemiology, causes, and treatment. Am J Obstet Gynecol. 2018;218(4):390\u0026ndash;400.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTakayama Y, Derouiche S, Maruyama K, Tominaga M. Emerging Perspectives on Pain Management by Modulation of TRP Channels and ANO1. Int J Mol Sci. 2019; 20(14):3411.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSamanta A, Hughes T, Moiseenkova-Bell VY. Transient Receptor Potential (TRP) Channels. Subcell Biochem. 2018;87:141\u0026ndash;165.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eM\u0026eacute;ndez-Res\u0026eacute;ndiz KA, Enciso-Pablo \u0026Oacute;, Gonz\u0026aacute;lez-Ram\u0026iacute;rez R, Ju\u0026aacute;rez-Contreras R, Rosenbaum T, Morales-L\u0026aacute;zaro SL. Steroids and TRP Channels: A Close Relationship. Int J Mol Sci. 2020;21(11):3819.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDuitama M, Moreno Y, Santander SP, Casas Z, Sutachan JJ, Torres YP, et al. TRP Channels as Molecular Targets to Relieve Cancer Pain. Biomolecules. 2021;12(1):1.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBamps D, Vriens J, de Hoon J, Voets T. TRP Channel Cooperation for Nociception: Therapeutic Opportunities. Annu Rev Pharmacol. 2021;61:655\u0026ndash;677.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJin Z, Liu H, Xu C. Estrogen degrades Scribble in endometrial epithelial cells through E3 ubiquitin ligase HECW1 in the development of diffuse adenomyosis. Biol Reprod. 2020;102(2):376\u0026ndash;387.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJin Z, Wu X, Liu H, Xu C. Celecoxib, a selective COX-2 inhibitor, markedly reduced the severity of tamoxifen-induced adenomyosis in a murine model. Exp Ther Med. 2020;19(5):3289\u0026ndash;3299.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBird CC, McElin TW, Manalo-Estrella P. The elusive adenomyosis of the uterus-revisited. Am J Obstet Gynecol. 1972;112(5):583\u0026ndash;593.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcKenna KA, Fogleman CD. Dysmenorrhea. Am Fam Physician. 2021;104(2):164\u0026ndash;170.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLazaridis A, Grammatis AL, Spencer S, Hirsch M. Nonsurgical management of adenomyosis: an overview of current evidence. Curr Opin Obstet Gyn. 2022;34(5):315\u0026ndash;323.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePatapoutian A, Tate S, Woolf CJ. Transient receptor potential channels: targeting pain at the source. Nat Rev Drug Discov. 2009;8(1):55\u0026ndash;68.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGruber TM, Mechsner S. Pathogenesis of Endometriosis: The Origin of Pain and Subfertility. Cells-basel. 2021;10(6):1381.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCarrarelli P, Yen CF, Funghi L, Arcuri F, Tosti C, Bifulco G, et al. Expression of Inflammatory and Neurogenic Mediators in Adenomyosis. Reprod Sci. 2017;24(3):369\u0026ndash;375.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOwen PR. Prostaglandin synthetase inhibitors in the treatment of primary dysmenorrhea. Outcome trials reviewed. Am J Obstet Gynecol. 1984;148(1):96\u0026ndash;103.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAgostinho L, Cruz R, Os\u0026oacute;rio F, Alves J, Set\u0026uacute;bal A, Guerra A. MRI for adenomyosis: a pictorial review. Insights Imagine. 2017;8(6):549\u0026ndash;556.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Y, Yu P, Sun F, Li TC, Cheng Jm, Duan H. Expression of oxytocin receptors in the uterine junctional zone in women with adenomyosis. Acta Obstet Gyn Scan. 2015;94(4):412\u0026ndash;418.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAzima S, Bakhshayesh HR, Kaviani M, Abbasnia K, Sayadi M. Comparison of the Effect of Massage Therapy and Isometric Exercises on Primary Dysmenorrhea: A Randomized Controlled Clinical Trial. J Pediatr Adol Gynec. 2015;28(6):486\u0026ndash;491.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePattanittum P, Kunyanone N, Brown J, Sangkomkamhang US, Barnes J, Seyfoddin V. Dietary supplements for dysmenorrhoea. Cochrane Db Syst Rev. 2016;3(3):D2124.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUchida Y, Izumizaki M. Effect of menstrual cycle and female hormones on TRP and TREK channels in modifying thermosensitivity and physiological functions in women. J Therm Biol. 2021;100:103029.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJulius D. TRP channels and pain. Annu Rev Cell Dev Bi. 2013;29:355\u0026ndash;384.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQu M, Lu P, Bellve K, Lifshitz LM, ZhuGe R. Mode Switch of Ca (2+) Oscillation-Mediated Uterine Peristalsis and Associated Embryo Implantation Impairments in Mouse Adenomyosis. Front Physiol. 2021;12:744745.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHasna J, Abi NR, Sergent F, Alfaidy N, Bouron A. The Deletion of TRPC6 Channels Perturbs Iron and Zinc Homeostasis and Pregnancy Outcome in Mice. Cell Physiol Biochem. 2019;52(3):455\u0026ndash;467.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDe Clercq K, Held K, Van Bree R, Meuleman C, Peeraer K, Tomassetti C, et al. Functional expression of transient receptor potential channels in human endometrial stromal cells during the luteal phase of the menstrual cycle. Hum Reprod. 2015;30(6):1421\u0026ndash;1436.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSouza MDAD, Nassini R, Geppetti P, De Logu F. TRPA1 as a therapeutic target for nociceptive pain. Expert Opin Ther Tar. 2020;24(10):997\u0026ndash;1008.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKoivisto AP, Belvisi MG, Gaudet R, Szallasi A. Advances in TRP channel drug discovery: from target validation to clinical studies. Nat Rev Drug Discov. 2022;21(1):41\u0026ndash;59.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKr\u0026uuml;gel U, Straub I, Beckmann H, Schaefer M. Primidone inhibits TRPM3 and attenuates thermal nociception in vivo. Pain. 2017;158(5):856\u0026ndash;867.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStraub I, Kr\u0026uuml;gel U, Mohr F, Teichert J, Rizun O, Konrad M, et al. Flavanones that selectively inhibit TRPM3 attenuate thermal nociception in vivo. Mol Pharmacol. 2013;84(5):736\u0026ndash;750.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee CG, Da SC, Dela CC, Ahangari F, Ma B, Kang MJ, et al. Role of chitin and chitinase/chitinase-like proteins in inflammation, tissue remodeling, and injury. Annu Rev Physiol. 2011;73:479\u0026ndash;501.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTrefilova VV, Shnayder NA, Petrova MM, Kaskaeva DS, Tutynina OV, Petrov KV, et al. The Role of Polymorphisms in Collagen-Encoding Genes in Intervertebral Disc Degeneration. Biomolecules. 2021; 11(9):1279.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen L, Huan X, Gao XD, Yu WH, Xiao GH, Li TF, et al. Biological Functions of the DNA Glycosylase NEIL3 and Its Role in Disease Progression Including Cancer. Cancers. 2022; 14(23):5722.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBiswas L, Tyc K, El YW, Morgan K, Xing J, Schindler K. Meiosis interrupted: the genetics of female infertility via meiotic failure. Reproduction. 2021;161(2):R13-R35.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang T, Zhou Y, Wang HH, Meng TG, Guo L, Ma XS, et al. Spc24 is required for meiotic kinetochore-microtubule attachment and production of euploid eggs. Oncotarget. 2016;7(44):71987\u0026ndash;71997.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Adenomyosis, TRPs, Primidone, Pelvic pain, TRPM3","lastPublishedDoi":"10.21203/rs.3.rs-3217639/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3217639/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003ePurpose\u003c/h2\u003e \u003cp\u003eTo test the expression profile of transient receptor potential channels (TRPs) in adenomyosis patients and evaluate the effects of primidone on tamoxifen-induced adenomyosis mice.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eEutopic endometrium from adenomyosis patients (n\u0026thinsp;=\u0026thinsp;20) was collected and subjected to mRNA analysis of TRP channels. TRPA1, TRPV1 and TRPM3 in adenomyosis patients (n\u0026thinsp;=\u0026thinsp;50) and tamoxifen-induced adenomyosis mice (n\u0026thinsp;=\u0026thinsp;6) were examined by immunohistochemistry. From 10 weeks after birth, primidone (2 mg/kg/d) and atosiban (1 mg/kg/d) were given separately to adenomyotic mice by intraperitoneal injection for 3 weeks. The hotplate test was conducted once a week beginning at 10 weeks, and then uterine samples were harvested for HE staining and RNA-seq at 13 weeks.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eThe mRNA expression of 15 TRPs was significantly increased in the proliferative phase of the adenomyotic endometrium. TRPV1, TRPM3 or TRPA1 staining levels were positively correlated with dysmenorrhea severity, menses amount and uterine size. In tamoxifen-induced adenomyosis mice, primidone had a significant effect on both the depth of myometrial infiltration and analgesia. Forty-seven DEGs were identified after primidone treatment, and bioinformatics analysis predicted that they were enriched in the cell cycle and cell division.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eThe expression profile of TRP channels varies significantly in adenomyosis patients, and primidone may provide a potential therapeutic method for adenomyosis management.\u003c/p\u003e","manuscriptTitle":"Inhibition of TRPM3 by primidone provides a potential therapeutic method for adenomyosis management","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-08-07 14:10:15","doi":"10.21203/rs.3.rs-3217639/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"9f42a37f-6a8e-4bba-9788-a9359677ef0d","owner":[],"postedDate":"August 7th, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2023-08-13T08:04:11+00:00","versionOfRecord":[],"versionCreatedAt":"2023-08-07 14:10:15","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3217639","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3217639","identity":"rs-3217639","version":["v1"]},"buildId":"WvIrzKhiLBfengagbw6Ux","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Condition tags

adenomyosisdysmenorrhea

Citation neighborhood

Papers in the corpus that this work cites (lower rings, blue) and that cite this one (upper rings, green). Dot size scales with the paper's in-corpus citation count — bigger dot = more influential within the endo/adeno field. Click a dot to open that paper. [ expand to 2 hops ] — adds papers reached through this work's immediate citers/citees. Heavier; up to 60 extra dots.

References (38)

Source provenance

europepmc
last seen: 2026-07-28T06:53:52.826419+00:00
openalex
last seen: 2026-06-04T00:00:01.174412+00:00
License: CC0 · commercial use OK