Erzhi Tiangui formula increases the number of high-quality blastocysts in patients with advanced age by regulating the Nrf2/HO-1 signaling pathway: a randomized controlled study.

The demographic features of the 120 patients in the EZTG group were compared with those of the 120 patients in the control group (Table  2 ). No significant differences were observed in body mass index (BMI), age, infertility history, and basal hormone levels, including LH, E2, T, TSH, and AMH, between the two groups ( P  > 0.05). The total doses of Gonal-f and endometrial thickness on hCG trigger day were comparable between the two groups. No significant differences were found in the percentages of primary and secondary infertility, IVF, and ICSI between the two groups (all P  > 0.05). Additionally, no statistically significant between-group differences were observed in the causes of infertility. Table 2 Base characteristics of two groups Baseline Characteristics EZTG Group ( n  = 120) Mean (SD) Cintrol Group ( n  = 120) Mean (SD) Two-tailed  P  value Age (SD) (year) 37.26(2.11) 37.33 (2.15) 0.842 BMI (SD) 23.86 (3.09) 23.96 (3.38) 0.118 Duration of infertility (year) 3.97 (3.55) 4.64 (3.74) 0.707 Laboratory tests  FSH (SD) (IU/L) 6.67 (0.99) 6.73(0.93) 0.383  LH (SD) (IU/L) 5.10 (2.27) 4.91 (2.60) 0.153  E2 (SD) (Pg/ml) 35.03(15.75) 38.59 (20.55) 0.230  T(SD) (ng/dl) 22.38(15.59) 24.58(12.89) 0.771  TSH(SD)(uIU/ml) 2.13(0.95) 2.18(0.98) 0.850  AMH (SD) (ng/ml) 2.59(1.77) 2.67(1.80) 0.659 Infertility  Primary infertility—no./total no. (%) 29/120 (24.17) 30/120 (25.0) 0.881 0.881  Secondary infertility—no./total no. (%) 91/120 (75.83) 90/120 (75.0) Causes of infertility  Tubal factor(%) 102/120(85) 95/120(79.17) 0.313  Male factor(%) 9/120(7.5) 11/120(9.17) 0.816  Others(%)† 9/120(7.5) 14/120(11.67) 0.381  Total doses of Gonal-f(IU) 2138.75(874.74) 2216.98(1020.09) 0.145  Endometrial thickness on hCG trigger day (cm)# 1.05(0.19) 1.03(0.18) 0.480 fertilization  IVF—no./total no. (%) 95/120 (79.2) 92/120(76.6) 0.643  ICSI—no./total no. (%) 25/120(20.8) 28/120(23.3) 0.756 †Other factors include unexplained factors and ovulation obstacles. # hCG: human chorionic gonadotropin Base characteristics of two groups 0.881 0.881 †Other factors include unexplained factors and ovulation obstacles. # hCG: human chorionic gonadotropin In this study, a total of 5 patients withdrew from the study (2 in the experimental group and 3 in the control group). Among them, 2 patients withdrew due to “non-compliance with the medication protocol” (1 in the experimental group and 1 in the control group), and 3 patients were lost to follow-up (1 in the experimental group and 2 in the control group). Additionally, 13 patients did not undergo embryo transfer (5 in the experimental group and 8 in the control group). Of these, 10 patients had their transfers canceled due to “absence of high-quality embryos” (4 in the experimental group and 6 in the control group), while 3 patients had their transfers canceled due to “OHSS” (1 in the experimental group and 2 in the control group) (Fig.  1 ). Fig. 1 CONSORT Flow diagram for progress of the participants of the randomised trial CONSORT Flow diagram for progress of the participants of the randomised trial Following treatment with the EZTG formula, a significant improvement was observed in both the number of high-quality embryos (3.53 ± 1.87 vs. 3.01 ± 1.72, P  = 0.025) and the fertilization rate (75.6% vs. 70.7%, P  = 0.016) compared to the control group (Table  3 ). However, pregnancy outcomes were comparable between the two groups (Table  3 ), which may be attributed to the fact that only high-quality embryos were transferred.The live birth rates (35.8% vs. 33.3%, P  = 0.684) and clinical pregnancy rates (45.8% vs. 46.7%, P  = 0.897) were comparable. Similarly, no significant differences were observed in implantation rates (35.3% vs. 42.5%, P  = 0.163), miscarriage rates (9.1% vs. 17.9%, P  = 0.177), ectopic pregnancy rates (3.6% vs. 3.6%, P  = 0.985), or preterm birth rates (4.2% vs. 5.8%, P  = 0.554). Table 3 Therapeutic outcomes in the study population Treatment Outcomes EZTG Group ( n  = 120) Mean (SD) Control Group ( n  = 120) Mean (SD) Two-tailed  P  value No. of collected oocytes 7.84(3.84) 7.87(3.26) 0.957 Fertilization rate(%) 711/941 (75.6) 667/944 (70.7) 0.016 No. of high-quality blastocysts 3.53(1.87) 3.01 (1.72) 0.025 Stage of embryo transferred—no./total no. (%)  D3 78/120 (65.0) 79/120(65.8) 0.852  D5 35/120 (29.2) 30/120(25.0) 0.468 No. of embryos transferred cycle(SD) 1.61(0.51) 1.60(0.55) 0.374 No. of embryos transferred  One embryo—no./total no. (%) 42/120 (35.0) 39/120 (32.5) 0.682 0.896  Two embryos—no./total no. (%) 71/120 (59.2) 70/120 (58.3) Clinical pregnancy rate(%) 55/120(45.8) 56/120(46.7) 0.897 Implantation rate(%) 65/184(35.3) 76/179(42.5) 0.163 Clinical miscarriage rate(%) 5/55(9.1) 10/56 (17.9) 0.177 Ectopic pregnancy rate(%) 2/55(3.6) 2/56(3.6) 0.985 Preterm birth rate(%) 5/120(4.2) 7/120(5.8) 0.554 Live birth rate(%) 43/120(35.8) 40/120(33.3) 0.684 Therapeutic outcomes in the study population 0.682 0.896 The Nrf2/HO-1 pathway has been identified as a crucial player in oxidative and reductive stress [ 30 ]. As shown in Fig.  2 A and 2 B, the mRNA and protein expression levels of Nrf2 and HO-1 in GCs were significantly higher in the experimental group compared to the control group (all P  < 0.001). In contrast, the expression of Keap1, an inhibitor of Nrf2, was significantly lower in the experimental group than in the control group ( P  < 0.001). These results suggest that the EZTG formula may enhance the antioxidant capacity of granulosa cells by regulating the Nrf2/HO-1 signaling pathway, upregulating Nrf2 and HO-1 expression, and downregulating Keap1 expression. Fig. 2 A : mRNA levels of Nrf2, HO-1, and Keap-1 in GCs of patients with advanced age. B : The protein levels of Nrf2, HO-1, and Keap1 in GCs between the two groups. Statistical significance: **, P <0.01; ***, P <0.001 A : mRNA levels of Nrf2, HO-1, and Keap-1 in GCs of patients with advanced age. B : The protein levels of Nrf2, HO-1, and Keap1 in GCs between the two groups. Statistical significance: **, P <0.01; ***, P <0.001 The results of this study demonstrated that the levels of GSH in GCs were significantly higher in the experimental group compared to the control group ( P  < 0.001) (Fig.  3 ). Additionally, the protein expression of antioxidant enzymes, including SOD, CAT, and GPX1, was also significantly elevated in the experimental group (all P  < 0.05) (Fig.  4 A and 4 B). Fig. 3 Comparison of intracellular GSH levels in GCs from advanced-age women between the control and experimental groups. The GSH levels in the experimental group were significantly higher than those in the control group. Statistical significance: ***, P <0.001 Comparison of intracellular GSH levels in GCs from advanced-age women between the control and experimental groups. The GSH levels in the experimental group were significantly higher than those in the control group. Statistical significance: ***, P <0.001 Fig. 4 Comparison of SOD, CAT, and GPX1 protein expression in GCs between the control and experimental groups. Statistical significance: * P < 0.05; *** P < 0.001 Comparison of SOD, CAT, and GPX1 protein expression in GCs between the control and experimental groups. Statistical significance: * P < 0.05; *** P < 0.001 As shown in Fig.  5 , EZTG significantly increased the mRNA and protein expression levels of Bcl-2 ( P  < 0.001), while decreasing the mRNA and protein levels of Bax and Caspase-3 (both P  < 0.01). These results suggest that the EZTG formula can inhibit GCs apoptosis induced by advanced age, providing a theoretical basis for the treatment of infertility in advanced-age patients. Fig. 5 A : Relative mRNA expression levels of Bcl-2, Bax, and Caspase-3 in GCs between the control and experimental groups. Statistical significance: *** P < 0.001. B : Relative protein expression levels of Bcl-2, Bax, and Caspase-3 in GCs between the control and experimental groups. Statistical significance: ** P < 0.01; *** P < 0.001 A : Relative mRNA expression levels of Bcl-2, Bax, and Caspase-3 in GCs between the control and experimental groups. Statistical significance: *** P < 0.001. B : Relative protein expression levels of Bcl-2, Bax, and Caspase-3 in GCs between the control and experimental groups. Statistical significance: ** P < 0.01; *** P < 0.001 As shown in Fig.  6 , the ATP levels in GCs were significantly higher in the experimental group compared to the control group ( P  < 0.001). These results suggest that the EZTG formula may enhance ATP synthesis by improving mitochondrial function and reducing mitochondrial damage, thereby improving oocyte quality. Fig. 6 Comparison of ATP levels in GCs between the control and experimental groups. Statistical significance: *** P < 0.001. between the experimental and control groups Comparison of ATP levels in GCs between the control and experimental groups. Statistical significance: *** P < 0.001. between the experimental and control groups

This single-center, randomized controlled trial aimed to evaluate the effectiveness of the EZTGformula in increasing the number of high-quality embryos in advanced-age patients undergoing IVF. The study received ethical approval from the Ethics Committee of the Reproductive Hospital affiliated with Shandong University (Approval No. 2022-73), and written informed consent was obtained from all participants. All experimental procedures were conducted in accordance with the principles of the Declaration of Helsinki, and the trial was registered with the Chinese Clinical Trial Registry (Registration No. ChiCTR2200065195). A total of 240 women of advanced age with infertility were recruited from the Affiliated Reproductive Hospital of Shandong University between September 2022 and March 2023. The initial sample size was calculated using PASS 11.0 software, assuming a 20% increase in clinical pregnancy rate with the use of the EZTG formula. With a power of 0.9 and a significance level of 0.05, the estimated required sample size was 120 participants. However, following an interim analysis conducted after the enrollment of 60 patients, no significant difference in clinical pregnancy rates was observed between the two groups. To enhance the reliability and accuracy of the study findings, the sample size was expanded to 240 participants. Eligible participants were randomly assigned to either the experimental or control group in a 1:1 ratio. The inclusion criteria were as follows: (1) Women aged 35–42 years; (2) Basic endocrine function within normal range and an antral follicle count (AFC) > 5; (3) Patients planning to undergo IVF due to factors such as tubal blockage, ovulatory dysfunction, endometriosis, or male infertility; (4) Normal liver and kidney function, with no gynecological or systemic diseases. The exclusion criteria included: (1) Uterine malformations or other conditions affecting the uterine cavity, such as septate uterus, unicornuate uterus, rudimentary uterus, untreated intrauterine adhesions, or submucosal fibroids; (2) Abnormal chromosomal karyotype, excluding chromosomal polymorphisms; (3) Untreated hydrosalpinx; (4) Patients with recurrent implantation failure (defined as three or more failed embryo transfers involving the transfer of 3–6 high-quality embryos). The experimental drug EZTG is prepared as granules derived from the original EZTG formula through processes of decoction, concentration, and drying. These granules are manufactured by the Drug Manufacturing Unit at the Affiliated Hospital of Shandong University of Traditional Chinese Medicine. Each package contains 3 g of the formula (batch number:01-FZ032-03). The formula utilizes high-quality, authentic medicinal herbs, including Cuscuta chinensis (Tu Si Zi), Herba Ecliptae (Mo Han Lian), Ligustrum lucidum (Nv Zhen Zi), Angelica sinensis (Dang Gui), Fructus Lycii (Gou Qi Zi), Ligusticum wallichii (Chuan Xiong), Radix Rehmanniae Preparata (Shu Di Huang), Rhizoma cyperi (Xiang Fu), Paeonia lactiflora (Bai Shao), and Radix Glycyrrhizae Preparata (Zhi Gan Cao). The dosages for all ingredients comply with safety standards outlined in the Chinese Pharmacopoeia.The placebo granules, primarily made of dextrin, were designed to closely resemble the color and shape of EZTG (batch number:01-FZ032-03a). Before the study began, all participants were fully informed about the study procedures, and written informed consent was obtained from each patient. Eligible patients were then enrolled and randomly assigned to either the experimental or control group according to a randomization sequence generated using the SAS Proc Plan with a block size of six. In total, 240 patients were randomly allocated to receive either 3 g of EZTG formula or a placebo, administered orally three times a day after dissolving it in warm water. The intervention began on the third day of the menstrual cycle prior to the IVF cycle and continued until the trigger day, typically spanning approximately 45 days. Detailed information on the crude herbal dosages and pharmacological properties of the herbs contained in EZTG granules is presented in Supplemental Table 1. Prior to the commencement of the study, all patients were informed of the study procedure. All patients were enrolled and randomized after signing informed consent. The randomization sequence was created using the SAS Proc Plan with a block size of six. According to the randomization list, 240 patients were randomly assigned to an experimental group and control group who took 3 g of EZTG formula/placebo orally three times a day after dissolving it in warm water. Participants start taking EZTG formula/placebo on the third day of the menstrual cycle before their IVF cycle and continue until the trigger day, which typically lasts about 45 days. The flow chart is shown in Supplemental Fig. 1. Details regarding the crude herbal dosages and pharmacological properties of the herbs in EZTG formula are provided in Supplemental Table 1. All patients underwent controlled ovarian stimulation using an antagonist protocol, a standard regimen in ART. Gonadotropin-releasing hormone antagonists (GnRH ant) were administered to suppress premature luteinizing hormone (LH) surges and prevent early ovulation. The specific regimen was as follows: on the second or third day of menstruation, 150–300 IU of exogenous gonadotropin (Gn) was administered to stimulate follicular development, with dosage adjustments based on serum hormone levels and ovarian response. A daily dose of 0.25 mg of GnRH ant (Cetrorelix, Germany) was administered until the “trigger” criteria were met. These criteria included a dominant follicle diameter of ≥ 11–12 mm, estradiol (E2) levels exceeding 200–300 pg/mL, or LH levels > 10 IU/L (twice the baseline level). When multiple mature follicles reached a mean diameter of 18 mm, final oocyte maturation was triggered by administering 8,000 IU of human chorionic gonadotropin (hCG). Oocyte retrieval was performed 36 h later under transvaginal ultrasound guidance. Primary GCs in follicular fluid (FF) were collected, and one or two embryos were transferred on day 3 or day 5 following oocyte retrieval. Any remaining viable embryos that developed to the blastocyst stage were frozen for future use. According to the Gardner grading system [ 28 ], blastocyst development was classified into six stages, as detailed in Supplemental Table 2. In our study, recovered blastocysts at stage 4 and blastocysts with score of 4BC were defined as high-quality blastocysts. Follicular fluid was collected while puncturing the follicles andcentrifuged at r/min for 5 min to discard the supernatant.Following centrifugation for 10 min at 4000 rpm, the deposited granulosa cells and red blood cells were separated. Isolatedgranulosa cells were washed twice with PBS to obtain clean GCs for further examination. GC lysates were prepared using RIPA lysis buffer, and the GSH content was measured using an ELISA kit (Beyotime, China) according to the manufacturer’s instructions. ATP levels in granulosa cell lysates were measured using a luminometer in accordance with the manufacturer’s instructions (S0026, Beyotime Biotechnology). Following the experimental protocol for western blot, proteins were extracted from granulosa cells using RIPA lysis buffer (Beyotime, China) and quantified with a BCA kit (Solarbio, China). The extracted proteins were separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and subsequently transferred onto polyvinylidene difluoride (PVDF) membranes. The membranes were then incubated with primary antibodies(Beyotime, Cat# P0023A, dilution: 1:1000), followed by anti-rabbit IgG horseradish peroxidase (HRP)-conjugated secondary antibodies (Beyotime, Cat#P0023D, dilution: 1:5000). The primary antibodies used were as follows: Nrf-2 (Proteintech, dilution: 1:1000), HO-1 (Proteintech, 1:2000), Keap1 (Proteintech, 1:1000), SOD (Proteintech, 1:1000), CAT (Proteintech, 1:1000), Bcl-2 (Proteintech, 1:500), Bax (Proteintech, 1:500), and cleaved-caspase-3 (Proteintech, 1:500). Protein bands were visualized using a ChemiDoc Touch Imaging System (Bio-Rad, Hercules, California, USA). Total RNA was extracted from granulosa cells using TRIzol reagent (1000 µl TRIzol per 10^7 cells). Reverse transcription was performed according to the manufacturer’s protocol. Real-time PCR was conducted using HiScript II Q RT SuperMix for qPCR (Vazyme, United States) and the A100 PCR system. The primer sequences used for real-time PCR (qPCR) are listed in Table  1 .The data were expressed as a fold change in mRNA levels relative to the proliferation state, calculated using the 2 −∆∆Ct method [ 29 ]. Table 1 Primer sequences used for RT-PCR Gene Name Primer Sequence (5’→3’) Mus-Bcl-2-F GGATTGTGGCCTTCTTTGAGTTC Mus-Bcl-2-R CTTCAGAGACAGCCAGGAGAAAT Mus-BAX-F GCTACAGGGTTTCATCCAGGATC Mus-BAX-R TGCTGTCCAGTTCATCTCCAATT Mus-Caspase-3-F CAGCCAACCTCAGAGAGACATT Mus-Caspase-3-R TTTCAGTTCAACAGGCCCATTTG Mus-Nrf2-F TGGCAGAGACATTCCCATTTGTA Mus-Nrf2-R CTTGCTCCATGTCCTGCTCTATG Mus-HO-1–134 F GACAGCCCCACCAAGTTCAA Mus-HO-1-134R AGCTCCTCAAACAGCTCAATGT Mus-Keap1-F ATCCAGAGAGGAATGAGTGGCG Mus-Keap1-R TCAACTGGTCCTGCCCATCGTA Mus-actin-154 F GGCTGTATTCCCCTCCATCG Mus-actin-154R CCAGTTGGTAACAATGCCATGT Primer sequences used for RT-PCR An intention-to-treat analysis (ITT) was adopted in this study. Data analysis was performed using SPSS software (version 22.0; IBM, Armonk, NY, USA). Categorical data were expressed as frequencies and percentages, and differences between groups were assessed using the chi-square test or Fisher’s exact test, as appropriate. Continuous data were presented as mean ± standard deviation (SD), and intergroup differences were analyzed using the t-test. All experiments were performed in triplicate. A P -value of < 0.05 was considered statistically significant.

In summary, our findings demonstrate that the EZTG formula can improve embryo quality by reducing oxidative stress levels and decreasing GCs apoptosis through the activation of the Nrf2/HO-1 signaling pathway, thereby protecting the reproductive capacity of women of advanced age. These results have significant implications for enhancing in vitro embryonic development and offer valuable insights for improving pregnancy outcomes in advanced-age patients undergoing IVF.

In this study, we analyzed the effects of EZTG formula on embryo quality in advanced age patients undergoing IVF. We found EZTG can increase the number of high-quality embryos and improve the fertilization rate in advanced age patients. The underlying mechanism may involve the activation of the Nrf2/HO-1 signaling pathway by EZTG, which enhances the expression of downstream antioxidant enzymes (SOD, CAT, and GPX1), strengthens antioxidant capacity, inhibits granulosa cell apoptosis, and ultimately improves oocyte quality. An increasing body of evidence indicates that the likelihood of obtaining high-quality embryos declines with age, particularly in women over 43 years old, among whom the chance of obtaining a blastocyst with normal chromosomes is less than 5% [ 31 , 32 ]. This decline is closely associated with the gradual reduction in oocyte and embryo competence observed in advanced maternal age [ 33 ], posing a significant challenge for reproductive physicians aiming to improve embryo quality. In IVF cycles, despite the implementation of various interventions, including CoQ10 supplementation and growth hormone injections, embryo quality and pregnancy rates remain significantly lower in advanced-age patients compared to their younger counterparts. Kidney-tonifying Chinese medicine has been shown to improve the quality of oocytes and sperm, thereby increasing the number of high-quality embryos [ 34 ], which is consistent with the findings of our study. Although there was no significant difference in clinical pregnancy rates or live birth rates between the two groups, this may be attributed to the fact that all patients received high-quality embryos for transfer, and no significant differences were observed in factors like endometrial thickness between the groups. However, the more number of high-quality embryos in the treatment group suggests that these patients may have more opportunities for embryo transfer, potentially leading to a higher cumulative pregnancy rate. In future studies, we plan to extend the observation period to further evaluate the long-term efficacy of the EZTG formula in patients of advanced age with infertility. By accumulating data from multiple embryo transfer cycles, we aim to gain a clearer understanding of the cumulative pregnancy and live birth rates, providing stronger evidence for the clinical application of the EZTG formula. However, the precise role and molecular mechanisms underlying the effects of the EZTG formula remain unclear. A decline in oocyte quality is widely regarded as a key factor contributing to reduced developmental competence in embryos, primarily due to oxidative damage [ 35 ]. The relationship between OS and age-related oocyte degeneration has been extensively studied [ 36 , 37 ]. Numerous studies have shown that elevated OS is closely associated with the deterioration of oocyte quality and the decline in fertility observed in advanced maternal age [ 35 , 38 , 39 ]. Excessive production of ROS can damage cellular components, including DNA, lipids, and proteins, disrupting the endogenous redox balance and triggering apoptotic mechanisms [ 40 ]. To further investigate the specific mechanisms by which EZTG improves embryo quality, we evaluated the expression of oxidative stress- and apoptosis-related mRNA and proteins in GCs associated with the Nrf2/HO-1 signaling pathway. Our results revealed that EZTG alleviated oxidative stress and reduced apoptosis in GCs. Specifically, the expression of Nrf2, HO-1, GSH, SOD, CAT, and GPX1 was significantly upregulated in the experiment group, while the levels of Keap1, Bax, and Caspase-3 were downregulated. These findings suggest that EZTG may improve embryo quality by mitigating GCs apoptosis through the Nrf2/HO-1 pathway and its downstream antioxidant enzymes, including SOD, CAT, and GSH, in advanced-age patients. GCs, the somatic steroidogenic cells surrounding the oocyte, play a critical role in oocyte maturation, fertilization, and subsequent implantation [ 41 ]. These cells provide essential nutrients and growth factors for oocyte maturation and possess a sophisticated antioxidant system that protects oocytes from OS-induced damage [ 42 ]. The Nrf2/HO-1 pathway has garnered significant attention as a key endogenous antioxidant mechanism [ 43 ]. The first line of defense in this system is mediated by antioxidant enzymes such as SOD and CAT, whose expression is regulated by the ARE under the control of the Nrf2/HO-1 pathway. Activation and nuclear translocation of the primary transcription factor Nrf2 promote the expression of these enzymes, providing robust protection against oxidative damage [ 44 ]. SOD is essential for oocyte development and aging, with high SOD expression observed in human oocytes [ 45 ]. Supplementing SOD protein has been shown to enhance preimplantation development in mice [ 46 ], while reduced SOD levels in MII oocytes of older mice are associated with compromised oocyte quality [ 47 ]. In porcine oocytes, suppressed SOD activity decreases GSH levels, lowers cleavage rates, and impairs blastocyst formation [ 48 ]. The weakening of protective mechanisms against OS renders aging oocytes more vulnerable to OS-induced damage. Additionally, GSH’s antioxidant properties are crucial during embryonic development [ 49 ]. As OS progresses, it generates hydrogen peroxide (H 2 O 2 ) [ 50 ], and reduced CAT levels can lead to elevated H 2 O 2 , further exacerbating oxidative damage [ 51 ]. Our findings demonstrate that EZTG significantly increased the expression of SOD, CAT, and GPX1 in GCs. Additionally, EZTG upregulated the expression of Nrf2 and its downstream effector HO-1 while downregulating Keap1 expression. These results suggest that the antioxidant properties of the EZTG formula may serve as a promising therapeutic strategy to counteract OS-induced fertility decline in patients of advanced maternal age. Mitochondria are intricately linked to the decline in oocyte quality that occurs with aging [ 52 ]. Mitochondria play a crucial role in the production of energy in the form of ATP and are essential for oocyte maturation, fertilization, and early embryonic development [ 53 ]. Studies have shown that the ATP content in oocytes from older women is significantly lower than that in younger women, negatively impacting embryonic developmental potential [ 54 ]. In our study, we found that the EZTG formula significantly improved ATP levels in GCs of advanced-age patients. This suggests that EZTG may enhance mitochondrial function and promote ATP production by activating the Kidney-Tian Gui-Uterus axis, thereby improving oocyte quality. This provides the necessary energy for fertilized egg development and enhances embryo quality in advanced-age patients. According to TCM theory, the key to fertility lies in the “kidney”. Kidney yin and qi are crucial for maintaining women’s fertility and supporting the proper functioning of the reproductive system. Consequently, deficiencies in kidney yin and qi can accelerate the aging process and impair fertility, potentially leading to diminished ovarian reserve [ 17 ]. When kidney qi and yin are insufficient, conception becomes more challenging. Some studies suggest that combining ART with traditional Chinese medicine can improve pregnancy outcomes, and the state of kidney qi plays a crucial role in the success of IVF [ 19 ]. EZTG formula is a compound that blends “Er Zhi Pill” and “Si Wu Decoction.” Mohanlian and Nvzhenzi serve as the sovereign (Jun Yao) herbs in the EZTG formula, nourishing the liver and kidneys, and are essential for its therapeutic effectiveness. Supporting herbs, such as Gouqizi and Tusizi, act as secondary (Chen) herbs, enhancing the actions of the primary ingredients. The Siwu Decoction serves as additional herbs, promoting blood circulation and regulating menstruation. Another supporting herb, Xiangfu, helps soothe the liver and relieve stagnation. Finally, Zhigancao harmonizes the formula’s various components.This combination of ten herbs works synergistically to nourish Yin, tonify the kidneys, enrich the blood, and regulate the Chong meridian. It effectively supports kidney function, increases kidney Yin and “Gui water” reserves, and lays a solid foundation for the development of multiple follicles. The formula promotes follicle maturation and ovulation, ultimately improving the patient’s chances of conception.The main components of the Er Zhi Pill include chlorogenic acid (CGA), lignin, and oleuropein. Recent studies have found that CGA prevents apoptosis and DNA damage by clearing excess ROS and activating the Nrf2 antioxidant pathway [ 55 ]. Chen et al. demonstrated that lignin activates the expression of Nrf2 and antioxidant genes (HO-1), resulting in a decrease in ROS and malondialdehyde (MDA) levels, while enhancing the activities of SOD, CAT, and GPX [ 56 ]. Therefore, it can be hypothesized that the effects of EZTG on ovarian function may partly be attributed to CGA and ligustrin in Ligustrum lucidum . However, current data remain insufficient to fully explain the exact mechanism by which EZTG enhances embryo quality. Recent findings have indicated a strong correlation between excessive oxidative stress and apoptosis. The apoptotic factors Bax and Caspase-3 play key roles in the regulation of GCs growth and apoptosis during follicular development [ 57 ]. Oxidative stress-induced apoptosis of GCs may compromise oocyte quality and reduce fertilization rates [ 58 ], thereby decreasing embryo quality and affecting reproductive outcomes. In our study, we assessed the level of apoptosis in granulosa cells and observed that, in the EZTG group, the expression of Bax and Caspase-3 decreased, while the expression of Bcl-2 increased in the granulosa cells of patients with advanced age.These results suggest that the EZTG formula may suppress GCs apoptosis in advanced-age patients, reduce the number of atretic follicles, and improve ovarian reserve function. To the best of our knowledge, this is the first study to document the effects of EZTG in alleviating oxidative stress-related mitochondrial dysfunction and apoptosis in granulosa cells, while also activating the Nrf2/HO-1 signaling pathway. These findings suggest a novel mechanism by which EZTG may improve ovarian function in women of advanced age undergoing IVF. The current study had certain limitations. Firstly, the sample size in this clinical study is relatively small, and the patient population is homogeneous, which may introduce some bias in the results. Secondly, this study only analyzed pregnancy outcomes from a single IVF cycle and did not assess cumulative live birth rates, limiting the ability to fully evaluate the long-term treatment effects and pregnancy outcomes after multiple cycles. Future studies should consider conducting multi-center RCTs with larger sample sizes and long-term follow-up on cumulative live birth rates to enhance the external validity and clinical applicability of the results.

The function of human tissues gradually declines with age, and the reproductive system is particularly vulnerable. The ovary is the first organ in women to exhibit signs of aging, with its function beginning to diminish in the mid-30s [ 1 ]. A decline in both the quantity and quality of oocytes is a key indicator of reproductive aging. Notably, this decline typically begins around the age of 35 and becomes more pronounced after 40. As more women choose to delay pregnancy, there has been a significant global increase in the number of advanced-age women seeking assisted reproductive technologies (ART). Clinical data from ART cycles suggest that the primary cause of age-related fertility decline is the reduced number of oocytes. Additionally, advanced maternal age is linked to a higher frequency of chromosomal aneuploidies in embryos, negatively impacting pregnancy outcomes in IVF cycles [ 2 , 3 ]. While the precise molecular mechanisms underlying the reduced competence of aging oocytes remain unclear, it is evident that oocyte quality is a crucial factor influencing the success of ART. Ovarian hypofunction in older patients often results in a progressive decline in oocyte quality during IVF cycles, posing a significant challenge for advanced-age women attempting to conceive. Although the molecular mechanisms of ovarian dysfunction are not yet fully understood, they are believed to be multifactorial, with oxidative stress (OS) identified as a major contributing factor [ 4 ]. OS is closely associated with mitochondrial dysfunction [ 5 ] and can induce apoptosis in ovarian granulosa cells,creating a vicious cycle in which initial cellular damage compromises cell survival and exacerbates further abnormalities, ultimately leading to a decline in overall ovarian function [ 6 ]. OS also contributes to a decrease in oocyte quality by promoting the accumulation of reactive oxygen species (ROS) and significantly depleting intracellular glutathione (GSH) [ 7 ]. As one of the most crucial intracellular antioxidants in oocytes, GSH plays a vital role in protecting them from oxidative damage by scavenging ROS. However, during OS, GSH levels decline, leading to elevated ROS levels, impaired oocyte quality, and reduced fertility. Consequently, embryo viability and blastocyst development in vitro may be adversely affected [ 8 ]. Nuclear factor erythroid 2-related factor 2 (Nrf2) is a key transcription factor belonging to the cap “n” collar subfamily of basic region-leucine zipper transcription factors and is central to the cellular response to OS [ 9 , 10 ]. It regulates various oxidative stress-related molecules, including ROS, GSH, and superoxide dismutase (SOD) [ 11 , 12 ]. Under OS conditions, Nrf2 dissociates from its inhibitor, Kelch-like ECH-associated protein 1 (Keap1), and translocates to the nucleus. There, it binds to antioxidant response elements (AREs) within the promoter regions of target genes, enhancing the transcription of antioxidant genes such as heme oxygenase-1 (HO-1), SOD, and NADPH quinone oxidoreductase 1 [ 13 , 14 ]. Through the upregulation of these genes, Nrf2 promotes the expression of antioxidant enzymes, anti-apoptotic proteins, and detoxification factors [ 15 ]. Recent research has indicated that Nrf2 plays a role in maintaining ovarian reserve functionality [ 16 ]. By activating the expression of these protective genes, Nrf2 helps reestablish cellular redox homeostasis, neutralizes excess ROS, and facilitates the detoxification of harmful substances. This protective mechanism is essential for cellular survival and defense against OS-induced damage. According to Traditional Chinese Medicine (TCM) theory, ovarian decline in women is closely linked to deficiencies in kidney qi and yin [ 17 ]. In TCM, the kidneys play a crucial role in regulating aging and reproductive health. Kidney qi and yin are believed to support reproductive function and are associated with fertility reserves, as kidney essence is considered essential for producing eggs and sperm. A deficiency in kidney qi and yin can accelerate reproductive aging and diminish fertility, paralleling the mechanisms observed in conditions like diminished ovarian reserve (DOR) and poor ovarian response during IVF treatment [ 18 ]. Therefore, nourishing the kidneys is regarded as a potential strategy to slow ovarian decline and preserve fertility. Some studies have suggested that integrating kidney-tonifying Chinese medicine into IVF cycles can improve pregnancy outcomes [ 19 ]. Our previous research has demonstrated that Chinese medicine may alleviate oxidative stress in oocytes and increase the number of high-quality embryos in individuals with DOR [ 20 ]. The Erzhi Tiangui (EZTG) formula is a well-known traditional Chinese medicine composed of ten herbs, recognized for its ability to tonify the kidneys, boost energy, nourish the blood and yin, and regulate the Chong and Ren meridians [ 21 ]. It was initially formulated by Fang Lian [ 22 ]. Prior studies have shown that the EZTG formula can improve embryo quality in advanced-age patients by reducing the expression of apoptotic proteins in follicular fluid [ 23 ]. Additionally, it has been found to enhance the fertilization rate in DOR patients with kidney deficiency syndrome by upregulating miR-214-3p while downregulating let-7e-5p and miR-140-3p during IVF cycles [ 24 ]. Lian et al. further reported that the EZTG formula may activate the PI3K/Akt pathway, suppress Bad protein expression, inhibit granulosa cells (GCs) apoptosis, and improve clinical pregnancy outcomes for IVF patients [ 25 ]. Other studies have suggested that the EZTG formula can reduce the expression of apoptosis-related molecules (FasL, Fas, Caspase-8, and Caspase-3) in the Fas signaling pathway [ 26 ], increase the expression of glial cell line-derived neurotrophic factor (GDNF) and its receptor GFRα-1 mRNA, and enhance oocyte quality [ 27 ]. However, the antioxidant effects of the EZTG formula in the GCs of advanced-age patients and the associated signaling pathways remain unexplored. The EZTG formula may counteract oxidative stress and inhibit apoptotic pathways by activating the Nrf2/HO-1 signaling pathway. Therefore, this study aimed to investigate the effects of the EZTG formula on antioxidant markers, oxidative stress levels, GCs apoptosis, and the Nrf2/HO-1 signaling pathway.

Supplementary Material 1. Supplementary Material 1. Supplementary Material 2. Supplementary Material 2. Supplementary Material 3. Supplementary Material 3. Supplementary Material 4. Supplementary Material 4. Supplementary Material 5. Supplementary Material 5. Supplementary Material 6. Supplementary Material 6. Supplementary Material 7. Supplementary Material 7. Supplementary Material 8. Supplementary Material 8. Supplementary Material 9. Supplementary Material 9. Supplementary Material 10. Supplementary Material 10. Supplementary Material 11. Supplementary Material 11. Supplementary Material 12. Supplementary Material 12.