Methods
Forty-two male Wistar rats were obtained from the Shahid Mirghani Research Institute (Golestan, Iran). All rats were housed in standard vivarium conditions with an ambient temperature maintained at 22 °C ± 3 °C and subjected to a 12-hour light-dark cycle. Dietary regimens were implemented as follows: a control diet offering ad libitum access to fresh water and standard chow ( n = 10) and a HFD consisting of 40% fat ( n = 32), both administered over a duration of 25 weeks. This investigation adhered strictly to the guidelines outlined in the US National Institutes of Health’s Guide for the Care and Use of Laboratory Animals 18 and complied with local governmental regulations. Ethical approval was granted by the Research Ethics Committee of the Sports Science Research Institute, Golestan, Iran (IR.SSRI.REC.1395.115). This study is reported in accordance with ARRIVE guidelines ( https://arriveguidelines.org ).
After a one-week acclimatization and habituation period, rats were randomly assigned to one of five groups for 25 weeks: normal diet ( n = 10), HFD + HIIT + Ade ( n = 9), HFD + HIIT ( n = 8), HFD + Ade ( n = 8) and HFD control ( n = 7). Prior to initiating the main experimental protocol, animals assigned to the HFD groups were fed a HFD (40% fat content) ad libitum for 13 weeks to induce obesity 19 . The study comprised 4 phases: (1) initiation and baseline weighing, (2) fattening (weeks 1–13), (3) first intervention (weeks 14–19, Ade administered intraperitoneally (IP) at 0.2 mg/kg + HIIT), and (4) second intervention (weeks 20–25, Ade administered intraperitoneally at 0.4 mg/kg + HIIT). Throughout the 25-week study protocol, animals in the HFD groups continued to receive the HFD, whereas rats in the normal diet group were maintained on a standard chow diet. At the beginning of the fourth phase and to prevent differences in caloric intake from confounding the treatment effects (isolating the exercise/Ade effects), the amount of food provided to all groups was standardized based on the mean consumption (gr) of the HFD control group, and this consistent feeding regimen was maintained for the last 6 weeks of the study. Body weight was measured on the first day of each week throughout the 25-week study, and the dose of Ade was adjusted weekly based on each rat’s weight. After 25 weeks, all rats were sacrificed for tissue collection and evaluation.
Ade was administered daily at 0.2 mg/kg during the third phase and 0.4 mg/kg during the fourth phase of the study. We selected the IP route rather than intravenous (IV) because IV boluses can provoke abrupt cardiovascular responses (such as bradycardia, atrioventricular block and hypotension), whereas non-IV routes allow slower systemic absorption and reduce acute hemodynamic risk 20 , 21 . The selected doses were informed by Ade’s very short plasma half-life (on the order of seconds), indicating that higher per-dose amounts or slower-release delivery routes are necessary to achieve meaningful receptor engagement outside of transient IV bolus contexts 19 , 20 .
To further support the feasibility of the IP approach for Ade receptor signaling in vivo, published rodent studies have shown that selective A2A-receptor agonists delivered IP at sub-mg/kg doses (0.25–0.5 mg/kg) produce robust systemic physiological effects, demonstrating successful engagement of peripheral Ade pathways using this route 22 , 23 . Ade (3 mg/mL; College of Pharmacy, Tehran University of Medical Sciences) was freshly prepared in sterile 0.9% saline and adjusted to body mass with a standardized injection volume of 1 mL per rat. During the first six weeks, rats received daily IP injections of 0.2 mg/kg; the dose was increased to 0.4 mg/kg during the second six weeks to evaluate potential dose-dependent effects while remaining well below recognized toxicity thresholds. In HIIT groups, Ade was administered ~ 3 h prior to training to avoid overlap with acute cardiovascular actions while permitting receptor activation during the exercise window 24 . Injections were performed aseptically in the lower right abdominal quadrant using an appropriate needle gauge, with aspiration to avoid intravascular entry. All administrations were logged to ensure consistency and reproducibility. Across the 12-week protocol, no mortality or clinically evident distress was observed (confirming the tolerability of the dosing regimen).
The normal diet provided 4.30 kcal/g, comprising 3.87% fat (from soy oil), 17.46% casein protein, 68.7% carbohydrates, 8.97% minerals and 1% vitamins. The HFD had a caloric density of 5.81 kcal/g, containing 40% fat (20% from soy oil and 20% from subcutaneous animal fat), 14.1% casein protein, 36.58% carbohydrates, 8.4% minerals and 0.72% vitamins 19 .
The HIIT regimen was progressively increased in volume and intensity during the intervention period. One week prior to the main training protocol, the rats were acclimated to the treadmill by running at speeds of 6, 8, and 10 m/min. Subsequently, each rat underwent a maximal running speed test on a treadmill until exhaustion to determine their maximal running speed (Vmax) 25 . The average Vmax was recorded for the group. The HIIT protocol was then implemented 26 , consisting of intervals at 85% to 90% Vmax intensity. Each training session included a 3-minute warm-up at 10 m/min, followed by HIIT, and concluded with a 2-minute cooldown at 15 m/min. HIIT was performed 5 times a week with 1 min active/rest ratio (for more details see Table 1 ). The periodized HIIT program was adapted from previous research that demonstrated fat loss in obese rats 19 .
Maximal running speed (Vmax) was determined based on established protocols, with exhaustion defined as the point of voluntary cessation despite gentle encouragement. Treadmill sessions were conducted in a temperature-controlled (22–25 °C), acoustically insulated room to minimize environmental stress and ensure consistency in physiological responses.
Table 1 HIIT protocol. Week 1 Bouts 2 ,
n
Load 3 , m/min Time 4 , min Active rest 5 , min Bouts 6 ,
n
Load 7 , m/min Distance 8 , m 1 7 31 1 1 6 15 307 2 8 31 1 1 7 15 353 3 8 35 1 1 7 17 399 4 9 36 1 1 8 17 460 5 9 41 1 1 8 19 521 6 9 45 1 1 8 20 565 7 10 45 1 1 9 22 648 8 10 47 1 1 9 22 668 9 10 49 1 1 9 23 697 10 10 50 1 1 9 24 716 11 10 52 1 1 9 24 736 12 10 55 1 1 9 25 775 1: Bouts : Number of high-intensity running intervals performed per session each week. 2: Load : Running speed during high-intensity intervals. 3: Time : Duration of each high-intensity interval, measured in minutes. 4: Active rest : Duration of low-intensity recovery periods between intervals. 5: Distance : Total distance covered per session, combining both high-intensity and recovery phases.
HIIT protocol.
1: Bouts : Number of high-intensity running intervals performed per session each week.
2: Load : Running speed during high-intensity intervals.
3: Time : Duration of each high-intensity interval, measured in minutes.
4: Active rest : Duration of low-intensity recovery periods between intervals.
5: Distance : Total distance covered per session, combining both high-intensity and recovery phases.
Rats were anesthetized using sodium pentobarbital (40 mg/kg; IP) 24 h after the end of their intervention (and 8 h of fasting). Following the induction of complete anesthesia, cardiac puncture was performed to obtain blood samples, which were then centrifuged for serum separation and stored at −80 °C for further analysis. For skeletal muscle analysis, the distal portion of the gastrocnemius muscle was excised, specifically sampled from the muscle belly just proximal to the tendon to avoid contamination from ligament or connective tissue. Each sample measured approximately 2 × 2 mm and was consistently collected from the same anatomical region across animals to ensure standardization and minimize sampling bias. This tissue was immediately processed for downstream molecular and histological assessments.
Homogenization of gastrocnemius tissue ( n = 7 per group) was conducted in TRIzol reagent using a tissue homogenizer (Tissue-Lyser LT; Qiagen, Valencia, CA). Total RNA was extracted and its purity and concentration were quantified using a Nanodrop spectrophotometer (Thermo Scientific, Wilmington, DE). Synthesis of first-strand complementary DNA (cDNA) was facilitated via a high-capacity cDNA reverse transcription kit (Applied Biosystems). Specific primer sequences were designed based on sequences obtained from the National Center for Biotechnology Information primer design tool (Table 2 ). Primers were synthesized by Pishgam (Pishgam, Iran). The quantitative PCR reactions were prepared with a volume of 20 µL per well in a 96-well plate, containing 10 µL of SYBR Green Master mix (Amplicon), gene-specific primers at optimized concentrations and 1000 ng/µL of cDNA. PCR amplifications were performed in duplicate under the following thermal conditions: initial denaturation at 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 45 s. Specificity of the amplified products was confirmed via melt curve dissociation analysis. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was employed as an endogenous control, and mRNA expression levels were calculated by the 2_ΔΔCT method and expressed as fold difference relative to GAPDH. Real-time PCR analyses were conducted applying ABI Applied Biosystems Real-Time PCR Systems (StepOne, Hettich Centrifuges, UNIVERSAL 320, with a capacity range of 4 × 100 mL | 32 × 15 mL, RPM/RCF: 15,000/21,382, and temperature control from − 20 to + 40 °C).
Table 2 The sequences of primers used in real-time PCR. Gene Primer Sequences AMPK F: GCTTACCGATGACCACGATC R: TTCATTCACAGCGAGGTTGC ACC F: CCTCCGTCAGCTCAGATACA R: TTTACTAGGTGCAAGCCAGACA HSL F: TCACTGGTTTCAGCCTCTTCC R: ATGAGACAGCCCCGAGAT CGI-58 F: ATCAGCAGCAGCAGCCAA R: CCTGTTAGCAGAAGACAGTCCTTA A 2A F: TCTAAATGCTGGGAGGTCAA R: CTCACGGTGGTCCTTTGTTG GAPDH F: CATACTCAGCACCAGCATCACC R: AAGTTCAACGGCACAGTCAAGG
The sequences of primers used in real-time PCR.
F: GCTTACCGATGACCACGATC
R: TTCATTCACAGCGAGGTTGC
F: CCTCCGTCAGCTCAGATACA
R: TTTACTAGGTGCAAGCCAGACA
F: TCACTGGTTTCAGCCTCTTCC
R: ATGAGACAGCCCCGAGAT
F: ATCAGCAGCAGCAGCCAA
R: CCTGTTAGCAGAAGACAGTCCTTA
F: TCTAAATGCTGGGAGGTCAA
R: CTCACGGTGGTCCTTTGTTG
F: CATACTCAGCACCAGCATCACC
R: AAGTTCAACGGCACAGTCAAGG
Following the deparaffinization process, tissue sections ( n = 5 per group) were incubated with primary antibodies targeting AMPK, ACC, HSL, CGI-58 and A 2A . This incubation was performed at a temperature of 37 °C for 90 min to facilitate optimal antibody binding. Subsequently, the sections were transferred to a dark room and subjected to three sequential washes to remove unbound antibodies. Next, 4′,6-diamidino-2phenylindole (DAPI, D9542 – Sigma) was applied for nuclear staining over a period of 20 min. After staining, sections were rinsed with phosphate-buffered saline (PBS) to eliminate excess DAPI. A mounting medium composed of a glycerol-PBS mixture was then applied to the samples to enhance fluorescence retention and stability. Fluorescent imaging was performed using an Olympus microscope (Japan) and the resultant images were evaluated for marker specificity and overall quality using ImageJ software (version 1.4). All images were analyzed in a blinded fashion to prevent bias. To minimize confounding from high-fat diet–induced intramuscular fat infiltration, regions of interest (ROIs) were selectively drawn to include only intact muscle fibers and exclude adipocyte-rich or connective tissue areas. Thus, fluorescence intensity measurements reflect protein expression localized to muscle fibers rather than non-contractile elements, ensuring accurate representation of molecular adaptations to the interventions.
Data are shown as mean ± SEM. Normality of the data was assessed using the Shapiro–Wilk test. Comparisons among groups for gene and protein expressions of AMPK, ACC, HSL , CGI-58, A 2A were determined by one-way analysis of variance with Tukey’s tests, after confirming homogeneity of variances with Levene’s test. Differences in weight between groups were evaluated using two-way analysis of variance, followed by LSD post hoc tests. In all analyses, statistical significance was set at P < 0.05. Sample size estimation was performed using G*Power software (version 3.1), based on parameters derived from previous research 27 , which indicated a large effect size (f = 0.4), α = 0.05, statistical power of 0.80, and a moderate correlation among repeated measures ( r = 0.5). This analysis yielded a required total sample size of 35 animals (7 per group) to detect significant differences in gene and protein expression profiles 12 . All statistical analyses were performed using IBM SPSS Statistics software (version 26.0; IBM Corp., Armonk, NY, USA). Throughout the figures, significance is denoted using asterisks as follows: **** P ≤ 0.0001, *** P ≤ 0.001, ** P ≤ 0.01, and * P < 0.05.
Results
Across all study groups, the weights in the second ( P = 0.008 for the normal diet group; P < 0.001 for other groups), third and fourth phases were significantly higher than in the first phase ( P < 0.001). The average weights of the groups were not significantly different in the first ( P = 0.626) and second ( P = 0.489) phases, while significant differences were observed in the third and fourth phases ( P < 0.001). Moreover, LSD post hoc test results indicated that the weight of the HFD group was significantly higher than that of all other groups in the third ( P < 0.05) and fourth ( P < 0.001) phases. Moreover, the weight of the HFD + Ade group was significantly higher than that of the HFD + HIIT + Ade group in the third ( P = 0.016) and fourth ( P < 0.001) phases. Additionally, in the third and fourth phase, the weight of the HFD + Ade group was significantly higher than that of the HFD + HIIT group ( P < 0.001). During the third and fourth phases of the study, the mean body weight in the HFD + HIIT group was higher than that of the HFD + HIIT + Ade group ( P < 0.001). Notably, the most pronounced reduction in body weight was observed in the HFD + HIIT + Ade group, while the HFD group exhibited the least weight loss (Tables 3 , 4 and 5 ).
Table 3 Mean and standard deviation of weight in the four phases by group. Group Phase
N
Mean SD Normal Diet I 10 121.82 7.97 II 9 359.02 9.05 III 8 371.50 10.06 IV 8 359.76 5.11 HFD I 7 126.69 9.83 II 7 359.43 8.44 III 7 413.25 12.06 IV 6 484.04 13.56 HFD + Ade I 8 123.70 18.14 II 8 371.49 9.68 III 7 388.52 30.20 IV 7 420.11 16.77 HFD + HIIT + Ade I 9 120.35 20.12 II 9 371.48 13.15 III 6 360.31 26.27 IV 6 351.50 18.97 HFD + HIIT I 8 117.90 10.46 II 8 361.80 8.92 III 7 367.43 13.53 IV 7 355.05 23.75 Phase I : At start of study. Phase II : After 13 weeks. Phase III : After 19 weeks. Phase IV: At the end of the study (after 25 weeks).
Mean and standard deviation of weight in the four phases by group.
Phase I : At start of study.
Phase II : After 13 weeks.
Phase III : After 19 weeks.
Phase IV: At the end of the study (after 25 weeks).
Table 4 Comparison of weight mean differences and effect size in the four phases by group. Group Phase Cohen’s d MD 95% CI Chi-squared I 2 (%)
P
Normal Diet I vs. II 12.50 233.04 218.70–247.37.70.37 8.00 0.0 0.0021 II vs. III 1.3 12.48 4.44–20.52 56.00 87.5 0.0314 II vs. IV 0.062 0.74 −9.24-10.72 7.00 0.0 0.0382 III vs. IV 1.14 11.74 3.16–20.32 56.00 87.5 0.0457 HFD I vs. II 25.47 233.18 224.71–241.64.71.64 42.00 85.71 0.0189 II vs. III 3.27 54.59 39.14–70.03 6.00 0.0 0.0276 II vs. IV 8.82 124.61 109.78–139.44.78.44 5.00 0.0 0.0215 III vs. IV 3.03 70.79 46.27–95.31 5.00 0.0 0.0392 HFD + Ade I vs. II 15.23 246.68 233.13–260.22.13.22 7.00 0.0 0.0415 II vs. III 0.47 17.03 −20.52-54.58 5.00 0.0 0.0582 II vs. IV 2.47 51.48 32.23–70.72 6.00 0.0 0.0479 III vs. IV 0.89 31.59 −5.66-68.84 5.00 0.0 0.0729 HFD + HIIT + Ade I vs. II 10.70 239.98 222.75–257.22.75.22 72.00 88.89 0.0036 II vs. III −0.43 −11.16 −38.57-16.25 5.00 0.0 0.0098 II vs. IV 0.87 19.97 −3.95-43.90 30.00 83.33 0.0086 III vs. IV −0.53 −8.81 −26.15-8.52 30.00 83.33 0.0154 HFD + HIIT I vs. II 12.16 239.08 222.64–255.52.64.52 7.00 0.0 0.0271 II vs. III 0.40 5.63 −7.13-18.39 42.00 85.71 0.0386 II vs. IV −0.25 −6.75 −31.41-17.91 6.00 0.0 0.0337 III vs. IV −0.62 −12.38 −30.94-6.17 6.00 0.0 0.0498 Abbreviations: CI: confidence interval, Phase I: At start of study, Phase II: After 13 weeks, Phase III: After 19 weeks, Phase IV: At the end of the study (after 25 weeks).
Comparison of weight mean differences and effect size in the four phases by group.
Abbreviations: CI: confidence interval, Phase I: At start of study, Phase II: After 13 weeks, Phase III: After 19 weeks, Phase IV: At the end of the study (after 25 weeks).
Table 5 Comparison of effect size on weight at the third and fourth phases between groups. Phase Group Cohen’s d 95% CI Chi-squared I 2
P
III Normal diet vs. HFD 1.4825 −0.33-3.29 0.60 0.0 0.4706 HFD vs. HFD + Ade 1.12 0.45–1.79 4.21 52.3 0.0019 HFD vs. HFD + HIIT + Ade 1.48 0.83–2.13 5.67 58.9 0.0004 HFD vs. HFD + HIIT 0.76 0.12–1.40 3.02 41.7 0.0231 HFD + Ade vs. HFD + HIIT −0.36 −1.01-0.29 2.11 33.5 0.2745 HFD + Ade vs. HFD + HIIT + Ade 0.39 −0.26-1.04 2.34 36.1 0.2412 HFD + HIIT vs. HFD + HIIT + Ade 0.74 0.09–1.39 3.18 43.2 0.0276 IV Normal diet vs. HFD 1.33 −0.45-3.11 5.02 80.08 0.0751 HFD vs. HFD + Ade 0.94 0.28–1.60 3.89 49.8 0.0047 HFD vs. HFD + HIIT + Ade 1.21 0.56–1.86 4.76 55.1 0.0011 HFD vs. HFD + HIIT 0.61 −0.03-1.26 2.87 39.4 0.0612 HFD + Ade vs. HFD + HIIT −0.33 −0.98-0.32 2.02 32.1 0.2964 HFD + Ade vs. HFD + HIIT + Ade 0.27 −0.38-0.92 1.88 30.4 0.4127 HFD + HIIT vs. HFD + HIIT + Ade 0.58 −0.07-1.23 2.76 38.2 0.0745 Abbreviations: CI : confidence interval, Phase III : After 19 weeks, Phase IV : At the end of the study (after 25 weeks).
Comparison of effect size on weight at the third and fourth phases between groups.
Abbreviations: CI : confidence interval, Phase III : After 19 weeks, Phase IV : At the end of the study (after 25 weeks).
Figure 1 depicts the impact of various interventions on gene expression.
Fig. 1 Relative expression of AMPK, ACC, HSL, CGI-58, A 2A genes ( n = 7 per group). ACC: Acetyl-CoA carboxylase, AMPK: AMP-activated protein kinase, HSL: Hormone-sensitive lipase, CGI-58: Comparative gene identification-58, A 2A : adenosine 2 receptor, ND: Normal diet, HFD: High-fat diet, Ade: Adenosine, HIIT: High intensity interval training (*** P ≤ 0.001, **** P ≤ 0.0001).
Relative expression of AMPK, ACC, HSL, CGI-58, A 2A genes ( n = 7 per group). ACC: Acetyl-CoA carboxylase, AMPK: AMP-activated protein kinase, HSL: Hormone-sensitive lipase, CGI-58: Comparative gene identification-58, A 2A : adenosine 2 receptor, ND: Normal diet, HFD: High-fat diet, Ade: Adenosine, HIIT: High intensity interval training (*** P ≤ 0.001, **** P ≤ 0.0001).
The expression ACC (critical enzyme in lipogenesis) was significantly higher in the HFD group compared to all other groups ( P < 0.001). Conversely, ACC expression was significantly reduced in the HFD + HIIT group compared to the HFD, HFD + HIIT + Ade and HFD + Ade groups ( P < 0.001).
Expression levels of CGI-58 (a key regulator of lipolysis) were significantly decreased in the HFD group in comparison to the ND group ( P < 0.001). Moreover, CGI-58 expression was significantly upregulated in the HFD + HIIT + Ade and the HFD + HIIT groups ( P ≤ 0.0001), suggesting that HIIT can stimulate lipolysis through CGI-58 activation.
The highest gene expression of AMPK (a cellular energy sensor that can activate lipolysis) was observed in the HFD + HIIT + Ade group compared to all other groups ( P ≤ 0.0001), while the lowest was documented in the HFD group ( P ≤ 0.0001).
An increased HSL expression was observed in the HFD + HIIT and HFD + HIIT + Ade groups compared to the HFD and HFD + Ade groups ( P ≤ 0.001).
A 2A receptor gene expression was elevated in the HFD group compared to the ND group ( P ≤ 0.0001). Substantial elevations were also noted in the HFD + HIIT and HFD + HIIT + Ade groups relative to all other groups ( P ≤ 0.001). Moreover, A 2A gene expression in the HFD + Ade group was reduced compared to the HFD group ( P ≤ 0.001).
Figure 2 illustrates the impact of various interventions on protein expression.
Fig. 2 AMPK protein expression in the study groups: (A) : ND, (B) : HFD, (C) HFD + Ade, (D) : HFD + HIIT, (E) : HFD + Ade + HIIT ( n = 5 per group). Nuclei stain by DAPI, Magnification: × 400. Ade: Adenosine, AMPK: AMP-activated protein kinase, HFD: High-fat diet, HIIT: High intensity interval training, ND: Normal diet. (****: P ≤ 0.0001, ***: P ≤ 0.001).
AMPK protein expression in the study groups: (A) : ND, (B) : HFD, (C) HFD + Ade, (D) : HFD + HIIT, (E) : HFD + Ade + HIIT ( n = 5 per group). Nuclei stain by DAPI, Magnification: × 400. Ade: Adenosine, AMPK: AMP-activated protein kinase, HFD: High-fat diet, HIIT: High intensity interval training, ND: Normal diet. (****: P ≤ 0.0001, ***: P ≤ 0.001).
Protein levels of AMPK were significantly lower in the HFD group compared to the ND group ( P ≤ 0.001). However, the intervention groups significantly increased AMPK expression, with significant elevations ( P ≤ 0.0001) observed in the HFD + HIIT + Ade and HFD + HIIT groups compared to the HFD and HFD + Ade groups. Similarly, AMPK expression elevated in HFD + Ade + HIIT in comparison with HFD + HIIT ( P = 0.001) (Fig. 2 ).
The protein expression of ACC was significantly ( P ≤ 0.001) higher in the HFD group compared to the ND group ( P ≤ 0.0001). In the interventional groups, ACC protein expression was significantly decreased compared to HFD group ( P ≤ 0.001), and the most pronounced reduction was observed in the HFD + HIIT + Ade group (Fig. 3 ). Additionally, ACC expression was significantly lower in HFD + HIIT and HFD + Ade + HIIT groups compared to the HFD + Ade group ( P ≤ 0.0001) and HFD + Ade + HIIT had lower expression in comparison with HFD + HIIT ( P = 0.028).
Fig. 3 The protein expression of ACC in study groups: (A) : ND, (B) : HFD, (C) HFD + Ade, (D) : HFD + HIIT, (E) : HFD + Ade + HIIT ( n = 5 per group). Nuclei stain by DAPI, Magnification: × 400. ACC: Acetyl-CoA carboxylase, Ade: Adenosine, HFD: High-fat diet, HIIT: High intensity interval training, ND: Normal diet. (****: P ≤ 0.0001, *: P < 0.050).
The protein expression of ACC in study groups: (A) : ND, (B) : HFD, (C) HFD + Ade, (D) : HFD + HIIT, (E) : HFD + Ade + HIIT ( n = 5 per group). Nuclei stain by DAPI, Magnification: × 400. ACC: Acetyl-CoA carboxylase, Ade: Adenosine, HFD: High-fat diet, HIIT: High intensity interval training, ND: Normal diet. (****: P ≤ 0.0001, *: P < 0.050).
Compared to the HFD group, HSL protein expression was significantly ( P ≤ 0.0001) elevated in the HFD + HIIT + Ade and HFD + HIIT groups ( P ≤ 0.0001). These increases were also significant relative in HFD + HIIT and HFD + Ade + HIIT compared to the HFD + Ade group ( P ≤ 0.0001). Furthermore, HFD + HIIT had higher HSL expression than HFD + Ade + HIIT (Fig. 4 ).
Fig. 4 The protein expression of HSL in study groups: (A) : ND, (B) : HFD, (C) HFD + Ade, (D) : HFD + HIIT, (E) : HFD + Ade + HIIT ( n = 5 per group). Nuclei stain by DAPI, Magnification: × 400. Ade: Adenosine, HFD: High-fat diet, HIIT: High intensity interval training, HSL: Hormone-sensitive lipase, ND: Normal diet. (****: P ≤ 0.0001).
The protein expression of HSL in study groups: (A) : ND, (B) : HFD, (C) HFD + Ade, (D) : HFD + HIIT, (E) : HFD + Ade + HIIT ( n = 5 per group). Nuclei stain by DAPI, Magnification: × 400. Ade: Adenosine, HFD: High-fat diet, HIIT: High intensity interval training, HSL: Hormone-sensitive lipase, ND: Normal diet. (****: P ≤ 0.0001).
Protein levels of CGI-58 were decreased in the HFD group compared to the ND group ( P ≤ 0.001). Interventional groups showed significant increase compared to HFD group ( P < 0.050). Moreover, CGI-58 protein expression levels were significantly ( P ≤ 0.0001) elevated in the HFD + HIIT + Ade and HFD + HIIT groups compared to HFD + Ade group ( P ≤ 0.0001) (Fig. 5 ) and HFD + HIIT group had higher levels of CGI-58 than HFD + Ade + HIIT ( P = 0.002).
Fig. 5 The protein expression of CGI-58 in study groups: (A) : ND, (B) : HFD, (C) HFD + Ade, (D) : HFD + HIIT, (E) : HFD + Ade + HIIT ( n = 5 per group). Nuclei stain by DAPI, Magnification: × 400. Ade: Adenosine, A2A: Adenosine 2 A receptor, CGI-58, Comparative gene identification-58, HFD: High-fat diet, HIIT: High intensity interval training, ND: Normal diet. (****: P ≤ 0.0001, ***: P ≤ 0.001, *: P ≤ 0.05).
The protein expression of CGI-58 in study groups: (A) : ND, (B) : HFD, (C) HFD + Ade, (D) : HFD + HIIT, (E) : HFD + Ade + HIIT ( n = 5 per group). Nuclei stain by DAPI, Magnification: × 400. Ade: Adenosine, A2A: Adenosine 2 A receptor, CGI-58, Comparative gene identification-58, HFD: High-fat diet, HIIT: High intensity interval training, ND: Normal diet. (****: P ≤ 0.0001, ***: P ≤ 0.001, *: P ≤ 0.05).
The protein expression of A 2A was significantly ( P ≤ 0.001) lower in the HFD group compared to the ND group ( P < 0.05). Interventional groups showed significant increase compared to HFD group ( P ≤ 0.001). Furthermore, A 2A protein expression levels were significantly ( P ≤ 0.0001) elevated in the HFD + HIIT + Ade and HFD + HIIT groups compared to HFD + Ade group ( P ≤ 0.0001) (Fig. 6 ).
Fig. 6 The protein expression of A2A in study groups: (A) : ND, (B) : HFD, (C) HFD + Ade, (D) : HFD + HIIT, (E) : HFD + Ade + HIIT ( n = 5 per group). Nuclei stain by DAPI, Magnification: × 400. Ade: Adenosine, A2A: Adenosine 2 A receptor, HFD: High-fat diet, HIIT: High intensity interval training, ND: Normal diet. (*: P ≤ 0.05, ***: P ≤ 0.001 ****: P < 0.0001).
The protein expression of A2A in study groups: (A) : ND, (B) : HFD, (C) HFD + Ade, (D) : HFD + HIIT, (E) : HFD + Ade + HIIT ( n = 5 per group). Nuclei stain by DAPI, Magnification: × 400. Ade: Adenosine, A2A: Adenosine 2 A receptor, HFD: High-fat diet, HIIT: High intensity interval training, ND: Normal diet. (*: P ≤ 0.05, ***: P ≤ 0.001 ****: P < 0.0001).
Conclusion
The experimental data demonstrate that the combined application of HIIT and Ade elicited a more pronounced weight loss and upregulation in the transcription and translation of HSL and AMPK in murine models subjected to a HFD than either intervention alone. Furthermore, this combined modality resulted in the most significant reduction in ACC levels. These outcomes support the premise that concurrent HIIT and Ade administration enhances the molecular pathways involved in lipolysis, thus facilitating augmented fat oxidation and adiposity reduction. The impact of Ade as a standalone treatment was comparatively subdued; however, its integration with HIIT markedly improved fat burning and lipolysis.
The findings suggest that HIIT protocols—particularly those with shorter recovery intervals—may offer a time-efficient strategy to enhance mitochondrial biogenesis and improve metabolic health in diabetic conditions. These adaptations could support interventions targeting insulin resistance and impaired lipid metabolism. However, given the study’s limitations—including the absence of oxidative stress markers, lipid profile assessments, and multi-tissue analyses—caution is warranted in translating these results to clinical settings. Future research in human populations, incorporating oxidative and lipid biomarkers, AMPK activation status, and systemic tissue responses, is essential to validate and optimize such protocols for broader application in metabolic disease management.
Discussion
This investigation assessed the impacts of HFD intervention combined with HIIT and Ade administration over 12 weeks. We observed that the combined intervention (HFD + HIIT + Ade) group had the highest gene and protein expressions of AMPK and HSL. The CGI-58 gene and protein expression was noted in the HFD + HIIT group, which underscores the potential of HIIT to stimulate lipolytic enzymes independently of pharmacological enhancement. Weight analysis revealed the most substantial reduction in the HFD + HIIT + Ade group, aligning with enhanced expressions of lipolytic markers. In contrast, ACC gene expression was the lowest in the HFD + HIIT group, highlighting HIIT’s potent effect on reducing lipogenic activity. Protein expression patterns mirrored these findings, with the lowest ACC levels observed in the HFD + HIIT + Ade group, suggesting an inhibitory effect on lipogenesis through combined interventions.
Consistent with our findings concerning ACC expression, a study by Xin-Meng et al. (2024) demonstrated significant decrease in ACC gene expression in obese mice after 8 weeks of HFD combined with HIIT 28 . Conversely, 8 weeks of HIIT combined with a normal diet did not cause significant changes in ACC expression in obese mice 28 . Furthermore, an additional study revealed significant increases in ACC phosphorylation, indicative of reduced ACC activity, and enhanced hepatic lipolysis after 8 weeks of HFD combined with HIIT 29 . However, a distinct pattern emerged with 4 weeks of HIIT plus a calorie-restricted diet (12.5% caloric restriction), which led to increased ACC mRNA expression in HFD-treated rats, aligning with an increase in IMGT volume 7 . This discrepancy might be attributable to the shorter fasting period (6 h) and intervention duration (4 weeks) used, diverging from findings by Pereira M et al. (2009), which suggested a minimum effective duration of 6 weeks for HIIT to influence molecular variables significantly 30 . Previous research has linked increased ACC gene expression with enhanced lipogenic activity and weight gain. Thus, the observed reduction in ACC expression through HFD + HIIT HFD may beneficially stimulate β-oxidation of fatty acids in mitochondria and subsequently elevate lipolysis 28 , 31 .
Regarding AMPK gene expression, our outcomes revealed the highest and lowest levels in the HFD + HIIT + Ade and HFD groups, respectively. This aligns with the majority of literature, where increases in AMPK phosphorylation have been reported following 8 weeks of HFD with HIIT in rats 28 . A study demonstrated that 12 weeks of HFD + HIIT + Ade significantly enhanced hepatic AMPK expression compared to HFD + Ade in HFD-treated rats 32 . These improvements in AMPK expression through HIIT may primarily mediate the reversal of weight gain induced by HFD, due to increased fatty acid oxidation and suppressed lipogenesis 28 . Activation of AMPK is known to stimulate its downstream targets, such as PPARα and CPT1, improving mitochondrial function and increasing fatty acid oxidation 28 . Furthermore, β-adrenergic stimulation during HIIT may also contribute to AMPK activation and promote lipolysis by enhancing mitochondrial biogenesis 2 , 31 . Additionally, physiological doses of Ade have been shown to activate AMPK, thereby reducing ACC expression and initiating lipolysis 13 , 33 . Beyond metabolic regulation, physical activity has also been shown to exert anti-inflammatory and hormonal balancing effects in chronic conditions such as endometriosis, further supporting its systemic therapeutic potential 34 . Supporting the anti-inflammatory role of exercise, Saeidi et al. (2020) reported that resistance training significantly reduced Gremlin-1 and MIF levels in obese men, which may contribute to improved lipid metabolism and enhanced responsiveness to lipolytic stimuli 35 .
The analysis also revealed that the HFD + HIIT group exerted the most significant influence on both gene and protein expression levels of CGI-58, while the HFD group demonstrated the least impact. A survey of existing literature pertinent to CGI-58 expression corroborates that HIIT consistently elicits beneficial outcomes in both HFD- fed human and animal models 31 , 36 . Conversely, moderate-intensity continuous training (MICT) (when coupled with HFD) does not consistently enhance CGI-58 expression 5 . Indeed, the study by Fardinia et al. (2012) demonstrated that a 12-week regimen of HIIT, but not MICT, significantly increased CGI-58 gene expression in the visceral adipose tissue (VAT) of mice subjected to a HFD 31 . CGI-58 is known to activate ATGL, which is crucial for augmenting this enzyme’s activity. It has also been demonstrated that increased interaction between CGI-58 and ATGL following exercise-induced muscular contractions plays a pivotal role in the activation of ATGL by CGI-58. This activation is essential for the initial mobilization of fats and the hydrolysis of TG into DAG and glycerol. Furthermore, the ATGL activation by CGI-58 is instrumental in initiating the cascade of lipolytic stimulants such as SIRT-1, enhancing PPARα and promoting mitochondrial biogenesis via PGC-1α activation 37 . Supporting this mechanistic pathway, recent findings by Delfan et al. (2022) demonstrated that two workload-matched HIIT protocols significantly modulated regulatory factors associated with mitochondrial biogenesis in the soleus muscle of diabetic rats, highlighting the role of exercise intensity and structure in optimizing mitochondrial adaptations 38 . Recent investigations have identified a strong correlation between skeletal muscle CGI-58 and the expression of complexes 1 and 2 of the electron transport chain in obese individuals at baseline 5 . This suggests that increased CGI-58 expression may be integrally linked to both enhanced lipolytic activity and mitochondrial oxidative capacities in adipose and skeletal muscle tissues 5 , 39 .
In the examination of HSL, it was observed that the HFD + HIIT + Ade group exhibited significantly elevated levels of protein and gene expression of HSL relative to other groups. Importantly, however, HSL and CGI-58 protein levels in skeletal muscle were in some cases higher in the HIIT-alone group than in the HIIT + Ade group. At first glance, this pattern may seem counterintuitive, since one might expect that combining a pharmacological agent with exercise would amplify (not attenuate) lipolytic signaling. However, this finding aligns with known Ade receptor cross-talk: Ade can simultaneously activate A1 receptors (Gi-coupled), which dampen cAMP–PKA signaling and suppress lipolytic enzyme induction, and A2A receptors (Gs-coupled), which enhance AMPK activation and fatty acid oxidation. Thus, while HIIT alone maximally engages the β-adrenergic → cAMP → PKA pathway to increase HSL and CGI-58 expression, the addition of Ade shifts the metabolic priority toward oxidative flux (increased AMPK, decreased ACC) rather than further elevating triglyceride-hydrolyzing enzymes. This dual-receptor model has been demonstrated in both adipocytes and skeletal muscle, and underscores the functional distinction between lipolysis 40 , 41 (HSL/CGI-58) and fat oxidation (AMPK/ACC): increasing one does not necessarily require maximization of the other.
The combined intervention of HIIT + Ade therefore represents not a redundant or antagonistic effect, but rather a metabolic reprogramming, whereby HIIT stimulates cAMP-mediated lipolysis, while Ade biases the system toward sustained fatty-acid oxidation via AMPK. This is consistent with Ade receptor biology and the well-established role of AMPK in promoting fat oxidation through ACC inhibition 20 , 42 , 43 . In this context, A2A-receptor signaling is metabolically permissive (for example by promoting oxidative/thermogenic programs in vivo), which helps explain why the HIIT + Ade condition can show enhanced AMPK and reduced ACC even if some lipolytic markers do not peak as high as with HIIT alone 20 , 41 . Moreover, phosphorylation of HSL remains challenging at physiological catecholamine concentrations, and obesity can blunt catecholamine signaling (catecholamine resistance) in adipose tissue, which helps explain context-dependent HSL responses 44 . In contrast, HIIT is well known to raise circulating catecholamines and upregulate β-adrenergic-cAMP/PKA-HSL signaling, increasing triglyceride hydrolysis and fat oxidation 45 . Therefore, the slightly attenuated HSL/CGI-58 expression in the HIIT + Ade group may simply reflect an adaptive shift from fat mobilization to fat oxidation capacity once lipolytic demand is met—an efficient repartitioning of resources rather than an adverse interaction.
The activation of HSL is pivotal as it prevents the accumulation of deleterious lipid metabolites such as ceramides and DAG, which are byproducts of basal lipolysis in metabolic disorders and obesity due to diminished adrenergic stimulation. In support of the protective role of exercise against muscle damage and metabolic dysfunction, Ghanbari et al. (2023) demonstrated that combining circuit resistance training with saffron supplementation significantly reduced muscle damage biomarkers such as CK, LDH, and CK-MB in young individuals, suggesting enhanced recovery and anti-inflammatory effects that may complement lipolytic adaptations 46 . Therefore, HSL activation induced by HIIT interventions is recognized as a vital regulator of TG hydrolysis in skeletal muscle and indicative of effective fat mobilization 47 , 48 . Thus, it can be concluded that HIIT intervention combined with Ade is likely a key factor in the alignment of gene and protein expression in the intervention groups compared to the HFD group. The literature on the combined impacts of concurrent interventions, particularly the combination HIIT and Ade on A 2A receptor gene expression, remains sparse. Mirghani et al. (2019) reported congruence with the current study, observing an elevation in A 2A receptor gene expression in rats following 12 weeks of HFD + HIIT, in comparison to moderate-intensity continuous training (MICT) 49 . Conversely, Farsi et al. (2020) observed no substantial alterations in A 2A receptor gene expression in the cardiac muscle of rats subjected to a regimen of HFD + HIIT + Ade over the same duration 12 . Several factors may account for the discrepancies between these studies and our findings. First, A 2A receptor mRNA expression levels are typically high in the heart muscle, but the normal density of A 2A receptors in this tissue is relatively low. Additionally, the expression density of the A1 receptor in heart tissue is quite high, which may influence the lack of significant change in A 2A receptor gene expression while concurrently reducing A1 receptor gene expression. Despite the significant elevation in A 2A receptor gene expression, no significant changes were noted in A 2A protein levels across any experimental groups.
Additionally, Hedayati et al. (2020) demonstrated in a parallel investigation that combining HIIT with Ade significantly augmented the expression of the A2B in hepatic tissue of HFD-treated rats 32 , a receptor similarly involved in lipolysis like the A 2A receptor. This enhanced response was potentially facilitated by an Ade dosage of 0.2 mg/kg administered over 12 weeks, coupled with intrinsically higher expression levels of the A2B receptor, contributing to the effectiveness of the HFD + HIIT + Ade intervention. The observed improvement in A 2A receptor gene expression following the HFD + HIIT + Ade protocol can likely be ascribed to both the physiological impacts of intense training and the pharmacological effects of Ade. Existing literature suggests that the expression of the A 2A receptor significantly escalates in response to stressful conditions such as high-intensity exercise, possibly linked to the intensity of the activity 50 . During such exercises, elevated ATP consumption acts as a stimulus for Ade release, potentially fostering long-term upregulation of A 2A receptor gene expression 51 . Collectively, these results underscore the combined influence of intense physical exertion and increased Ade levels in enhancing A 2A receptor activation, thereby promoting lipolysis and promoting weight loss in rats on a HFD. Similar combined effects have also been reported with other bioactive compounds. For instance, Saeidi et al. (2023) demonstrated that supplementation with spinach-derived thylakoid significantly enhanced the metabolic benefits of HIIT in obese males, improving adipokine profiles, insulin sensitivity, and lipid metabolism beyond exercise alone 52 . Comparable combined effects have also been observed with other bioactive supplements. Delfan et al. (2024) reported that combining HIIT with spirulina supplementation significantly improved adipokine profiles, insulin resistance, and anthropometric indices in obese males, reinforcing the potential of integrated exercise-nutrient strategies for cardiometabolic health 53 . Another study by Delfan et al. (2022) demonstrated that both volume-matched HIIT protocols (2:1 and 1:1 work-to-recovery ratios) significantly enhanced mitochondrial biogenesis markers (PGC-1α, p53, and citrate synthase) in the soleus muscle of diabetic rats. Notably, the 2:1 protocol elicited greater improvements in p53 and CS expression and insulin levels, suggesting superior metabolic adaptations despite equal training volumes 38 .
The investigation into weight changes among the various intervention groups revealed that the maximum reduction in weight was observed in the HFD + HIIT + Ade group, followed by the HFD + HIIT group. Both HIIT and Ade appear to have significantly contributed to these changes. Prior research has found HIIT to be more effective than MICT in weight control in rats subjected to a HFD, potentially due to elevated levels of lipolytic hormones and enhanced adipocyte responsiveness to catecholamines 54 . Additionally, reductions in skeletal muscle TG volume and white adipose tissue (WAT) volume post-HIIT interventions were more pronounced compared to those observed with MICT, which could be attributed to increased phosphorylation or activation of HSL 55 . Furthermore, new evidence suggests that lactate (produced during HIIT interventions) plays an important role as a signaling molecule in lipid metabolic adaptation, although the precise mechanisms underlying this process remain to be elucidated 54 . It has been suggested that this occurs through the activation of extracellular signal-activated kinases and AMPK-activated protein kinase 56 .
The mechanisms leading to enhanced fat reduction in HIIT are often attributed to the post-exercise recovery period, where a prevailing hypothesis suggests that the elevated excess post-exercise oxygen consumption associated with HIIT during this phase leads to increased total energy expenditure and enhanced fat oxidation for glycogen synthesis. Additionally, the increase in lipolysis observed during the recovery period may result from the redistribution of TG from adipose tissue to muscle, augmenting muscle energy substrate stores, a phenomenon often described as a training paradox.
The gastrocnemius muscle was selected due to its central role in fatty acid oxidation during exercise and its direct responsiveness to HIIT-induced metabolic signaling. Unlike adipose tissue, which primarily stores and releases fatty acids, skeletal muscle is the main site of their oxidation—accounting for over 70% during physical activity 57 , 58 . Key markers such as AMPK and ACC are highly expressed in muscle, where AMPK activation promotes mitochondrial fatty acid uptake via ACC phosphorylation 59 . A 2A receptor also shows higher expression in muscle and contributes to exercise-related vascular and metabolic adaptations 60 . While HSL and CGI‑58 are more prominent in adipose tissue, they also support intracellular lipolysis in muscle 61 , 62 . Therefore, skeletal muscle provides a mechanistically relevant tissue for evaluating HIIT-induced lipid metabolism.
The consumption of Ade also plays a significant role, both independently and in combination with HIIT, in enhancing gene and protein expression 63 , particularly of HSL, AMPK and receptors which contributed to greater weight loss in the HFD + HIIT + Ade group. Although the highest expression levels of A 2A gene and protein were observed in the HFD + HIIT + Ade group and the lowest in the HFD + Ade group, these variations did not achieve statistical significance. In conditions of obesity, increased Ade levels activate A1 receptors in WAT, inhibiting lipolysis. However, the Ade concentrations required to stimulate lipolysis are lower in WAT and brown adipose tissue (BAT) (at 1.7 nmol/L and 3 nmol/L, respectively). Elevated Ade levels in this study had a beneficial impact on weight loss, especially when combined with HIIT, which stimulates β-adrenergic receptors via increased sympathetic signaling, thereby activating A 2A receptors and promoting WAT thermogenesis and browning 14 . The high expression of A 2A receptors in BAT (coupled with its high vascularization), suggests that the enhanced vascular function induced by HIIT 64 and the substantial dose of Ade can stimulate the A 2A receptor in BAT tissue, thereby increasing its thermogenic properties through the upregulation of Vascular Endothelial Growth Factor-A (VEGF-A).
This study has several limitations. First, the absence of oxidative stress markers (e.g., ROS, SOD, GPx, CAT) restricts interpretation of AMPK and A 2A receptor-related findings. Including such measurements in future studies would help clarify whether redox imbalance contributes to the observed shifts in energy metabolism and receptor expression. Second, although we assessed key molecular regulators of lipid metabolism (AMPK, HSL, CGI-58 and ACC), we did not directly measure lipid metabolic endpoints such as circulating triglycerides, cholesterol, free fatty acids or tissue lipid content. As a result, our conclusions regarding enhanced lipid metabolism (while supported by coordinated changes in lipolytic and lipogenic markers) remain indirect and should be interpreted with caution. Additionally, although total AMPK protein was quantified, its phosphorylation status (the most direct indicator of AMPK activation) was not assessed. This limits the precision with which AMPK signaling can be interpreted, even though downstream markers (such as increased HSL and CGI-58, reduced ACC) suggest functional activation of the pathway. Future studies should include Western blot analysis of phosphorylated AMPK (p-AMPK) to provide a more definitive assessment of AMPK activity in response to HIIT and Ade treatment. Similarly, the observed mismatch between A2A mRNA and protein levels in HFD rats (while possibly attributable to post-transcriptional regulation or oxidative stress–induced protein degradation) remains speculative in the absence of direct assessments of oxidative status or protein turnover. Future work should include parallel evaluation of redox markers and/or proteasomal activity to clarify mechanisms driving this discrepancy. Moreover, although our pilot confirmed that 0.2 and 0.4 mg/kg intraperitoneal Ade were safe and feasible, the optimal intraperitoneal dosing regimen for chronic metabolic outcomes has not been established, and Ade’s very short plasma half-life together with receptor-subtype–specific actions indicates that dose, timing, and route can materially influence efficacy 20 , 21 . Accordingly, future studies should implement structured dose–response designs and compare IP with alternative delivery approaches to define the minimum effective and maximum safe parameters for sustained metabolic engagement. Finally, the exclusive focus on skeletal muscle limits understanding of systemic adaptations; future studies should include adipose and hepatic tissues for broader metabolic insight.
It is also important to point out that the variability observed in this study was very low across key outcome measures. While such small standard deviations are uncommon in human research, they are consistent with findings from controlled rodent models where genetic, environmental, and procedural uniformity substantially minimizes inter-individual variation 65 , 66 . This high degree of control can be considered a methodological strength, as it enhances internal validity and allows clearer detection of intervention effects. However, it may also limit external generalizability to more heterogeneous human populations.
Introduction
Obesity is a major global health concern, serving as a primary contributor to a spectrum of disorders such as metabolic syndrome, hypertension, stroke, cancer, type 2 diabetes, and cardiovascular diseases, thereby significantly elevating mortality rates worldwide (WHO,2024). The accumulation of excess fat results from an imbalance between lipogenesis (fat synthesis) and lipolysis (fat breakdown), with impaired lipolytic activity leading to increased fat storage. This metabolic imbalance exacerbates obesity and its associated health complications 1 . Enhancing lipolysis through the upregulation of lipolytic genes and proteins can promote the degradation of stored fats and restore metabolic homeostasis. Consequently, developing effective strategies to enhance lipolytic activity is crucial for combating the global obesity epidemic and improving human health. Among the key regulators of lipolysis are hormone-sensitive lipase (HSL) and adipose triglyceride lipase (ATGL) 2 , 3 .
HSL is a crucial enzyme involved in the hydrolysis of triglycerides (TG), diacylglycerols (DAG) and monoacylglycerols (MAG), playing a prominent role in all stages of lipolysis and often referred to as the main regulator of this process. Additionally, comparative gene identification-58 (CGI-58) is an important activator of ATGL, the first enzyme acting in the lipolysis pathway 4 . Furthermore, AMP-activated protein kinase (AMPK) is a critical signaling molecule that regulates lipid metabolism and energy homeostasis 5 , 6 . Activation of AMPK increases cyclic AMP (cAMP) levels, leading to enhanced protein kinase A (PKA) activity, which ultimately promotes lipolysis 2 . Conversely, acetyl-CoA carboxylase (ACC) is a key enzyme involved in lipogenesis 3 , 7 . Studies have shown that a high-fat diet (HFD) can reduce lipolytic activity by inhibiting epinephrine-induced AMPK activation, resulting in decreased levels of CGI-58, ATGL and AMPK, as well as increased levels of ACC 2 , 8 .
Given the impact of diet on these metabolic pathways, interventions such as exercise training emerge as potential strategies to modulate lipolysis 9 . Exercise training, particularly high-intensity interval training (HIIT), has been shown to modulate lipolytic proteins, including ATGL, HSL, and perilipin (PLIN) 2 , 10 , thereby reducing intramuscular triglyceride (IMGT) content in obese individuals 9 and alleviating fat-induced stress in skeletal muscles 5 . HIIT also increases the expression of CGI-58, ATGL, and AMPK while decreasing ACC levels 2 . Additionally, HIIT activates the β-adrenergic receptor signaling pathway, leading to the phosphorylation of HSL by PKA and facilitating the binding of PLIN to CGI-58, thereby promoting lipolysis 11 .
Besides exercise, certain biochemical compounds like Adesosine (Ade) play significant roles in lipid metabolism. Ade is a purine nucleoside composed of an adenine base attached to a ribose sugar, released from ATP, ADP and AMP (molecules critical for cellular energy transfer and metabolism) 12 . During intense exercise, Ade levels may increase due to ATP breakdown. Ade is involved in various physiological processes, including the regulation of lipid metabolism, exerting its effects through binding to specific G protein-coupled receptors located on the membranes of different tissues 13 . These receptors include A 1 , A 2A , A 2B , A 3 . The A 1 and A 3 receptors act as inhibitory receptors, while the A 2A and A 2B receptors act as activators of lipolysis. Depending on the receptor subtype and the concentration of Ade, it can have inhibitory or stimulatory effects on lipolysis 12 . For instance, in obese individual’s Ade concentrations are higher than normal, sufficient to activate A 1 , A 2A , A 3 receptors but not the A 2B receptor, which requires higher Ade concentrations for activation 14 . Therefore, in obesity the predominance of lipogenesis-promoting receptors such as A 1 and A 3 leads to increased fat storage. In contrast, during stress conditions such as physical activity, A 2A and A 2B receptors are engaged, promoting lipolysis 12 , 15 . Importantly, Ade alone has been shown to increase the expression of lipolytic genes and counteract HFD-induced weight gain 12 . Thus, combining Ade administration with HIIT may potentiate weight loss effects under HFD conditions 16 , 17 .
Despite these findings, studies examining the combined effects of HIIT and Ade on lipolysis are limited. Although it has been indicated that the combination of HIIT and Ade consumption enhances fat oxidation 12 , studies describing the effects of Ade injection on body function are few, and the cellular and molecular mechanisms responsible for lipolysis in conjunction with HIIT are not well understood. Therefore, the aim of this study is to investigate whether HIIT, Ade or their combination affect the molecular pathways of CGI-58, HSL, AMPK, A 2A and ACC gene and protein expression and determine if they activate lipolysis. To our knowledge, no prior study has examined the effect of Ade injection combined with HIIT on gene and protein expression in lipid metabolism in an obese rodent model. Our hypothesis is that HIIT in combination with Ade injection can have a greater effect on the CGI-58, HSL, AMPK, A 2A and ACC gene and protein expression treatment of HFD-induced obesity compared to injection of Ade alone.
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.