Identification of long non-coding RNAs BAT5, MALAT1, and UBOX5 in the peripheral blood leukocytes of women with endometriosis before surgery and at 1 month after surgery

Identification of long non-coding RNAs BAT5, MALAT1, and UBOX5 in the peripheral blood leukocytes of women with endometriosis before surgery and at 1 month after surgery | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Identification of long non-coding RNAs BAT5, MALAT1, and UBOX5 in the peripheral blood leukocytes of women with endometriosis before surgery and at 1 month after surgery Hülya Aydınlı, Meryem Hocaoglu, İlayda Loçlar Karaalp, Elvan Yağimli Öztürk, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8011405/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Given the potential roles of long non-coding RNAs lncRNAs in endometriosis pathogenesis and inflammation, based on the existing literature, we aimed investigate expression of lncRNAs BAT5 , MALAT1 , and UBOX5 in the blood leukocytes of women with endometriosis before surgery and at 1 month after surgery. Methods and Results This prospective longitudinal cohort study included women with surgically confirmed endometriosis (n = 28),women without endometriosis (n = 27), and women with endometriosis who were followed up (n = 20).The relative expression levels oflncRNAs BAT5, MALAT1 ,and UBOX5 in blood samples from endometriosis patients were determined using real-time quantitative PCR and compared with those of the controls. Preoperative MALAT1 expression was significantly upregulated and UBOX5 e xpression was downregulated in the endometriosis group compared to the control group ( p = 0.005,p = 0.029,respectively). There was a significant drop in MALAT1 expression levels at 1 month after surgery (16.77 ± 34.17) compared to the preoperative levels (44.33 ± 83.15)(p = 0.048).Moreover, we observed no significant difference in postoperative UBOX5 expression levels in the endometriosis group (28.17 ± 67.31) compared to both the control group (15.09 ± 36.29)and preoperative levels (13.92 ± 17.44),(p = 0.112;p = 0.594,respectively). Preoperative BAT5 expression levels were not significantly different in the endometriosis group (9.26 ± 16.02) compared to the controls (3.06 ± 4.28) ( p = 0.103).The area under the ROC curve of MALAT1 was 0.70, and CA-125 was UBOX5 0.66. A positive correlation was observed between preoperative BAT5 expression and CA 19 − 9 level (r = 0.422;p = 0.036). Conclusions This is the first study to reveal that the expression of circulating MALAT1 and UBOX5 may contribute to thepathogenesis of endometriosis, potentially through involvement in inflammation. MALAT1 may serve as a promising biomarker for the diagnosis and monitoring of endometriosis. Endometriosis long non-coding RNAs BAT5 MALAT1 UBOX5 inflammation Figures Figure 1 Figure 2 Introduction Endometriosis is an inflammatory disease characterized by endometrium-like glandular tissue and stroma outside the uterus, affecting nearly 10% of reproductive-age women and causing chronic pelvic pain and infertility [ 1 ]. Despite several theories proposed to elucidate the etiology of endometriosis, the exact pathogenesis of the condition is still poorly understood [ 2 , 3 ]. The difficulties inherent in understanding endometriosis are related to its multifactorial nature [ 4 ]. Inflammation is one of the most important key players in the pathogenesis of endometriosis. The presence of ectopic tissue in the peritoneal cavity is associated with overproduction of prostaglandins, cytokines, and chemokines (4–6). In addition, endometriosis lesions are complex multicellular structures, and vascularization, including angiogenesis, serves a crucial function in their establishment, survival, and growth [ 5 ]. The diagnosis of endometriosis is often delayed by several years after the onset of the symptoms [ 6 ]. Currently, there are no reliable non-invasive diagnostic biomarkers for endometriosis. However, a non-invasive diagnostic biomarker of endometriosis may prevent delays in diagnosis, leading to timelier and more efficient medical and surgical treatment of the disease [ 7 , 8 ]. Genome-wide human transcriptional studies have revealed numerous non-protein-coding RNAs (ncRNAs), including short and long ncRNAs Long ncRNAs (lncRNAs) are molecules larger than 200 nucleotides that have important regulatory roles in a wide variety of biological processes. This suggests that lncRNAs, in addition to being potential biomarkers for the clinical diagnosis of the disease, may also play a role in disease development [ 9 ]. Therefore, several studies identified lncRNAs involved in the etiopathogenesis of endometriosis which is related to systemic chronic inflammation [ 10 ]. H19 lncRNA has been associated with infertility [ 11 ], and with the proliferation and migration of MALAT1 (metastasis-associated lung adenocarcinoma transcript 1) endometriosis cells, which has also been shown in many other cancer types [ 12 ]. A recent study investigated the expression patterns and function of UBOX5-AS1 (UBOX5 Antisense RNA 1) in hypoxic endometrial epithelial cells, demonstrating that UBOX5 is activated under hypoxic conditions, which play an important role in the endometriosis lesion microenvironment, where it may stimulate the biosynthesis of estrogens and the expression of estrogen receptors [ 13 , 14 ]. Moreover, in a microarray-based lncRNA expression profiling study, BAT5 (HLA-B associated transcript 5) was identified among the lncRNAs proposed as a candidate biomarker for coronary artery disease [ 15 ]. Given the potential roles of lncRNAs in endometriosis pathogenesis and inflammation, based on the existing literature, we aimed to investigate the expression profiles of candidate lncRNAs BAT5 , MALAT1 , and UBOX5 in blood leukocytes from women with endometriosis compared to those of controls before surgery and at 1 month after surgery. Furthermore, to better understand the potential impact of lncRNAs implicated in endometriosis, we designed a unique short-term follow-up study of patients who underwent surgery for endometriosis. Materials and methods Ethical Approval This study has been approved by Ethics Committee of the Istanbul Medical Faculty, Istanbul, Turkey (2018/1519). All research subjects have signed informed consent to participate and publish. This study was performed in accordance with the ethical standards in the Declaration of Helsinki (2013). Study subjects and sample collection This prospective longitudinal cohort study was conducted at Goztepe Prof. Dr. Süleyman Yalçın City Hospital affiliated to Istanbul Medeniyet University and Sancaktepe Şehit Prof. Dr. İlhan Varank Education and Training Hospital, Istanbul, Turkey between December 2019 and July 2022. Women aged 18-50 years with regular menstrual cycles with endometriosis (n = 28) and surgically confirmed endometriosis-free women (n = 27) were enrolled in this study. Laparoscopy was performed to determine the presence or absence of endometriosis in the patients. Endometriosis was diagnosed based on surgical and histological findings in 28 women. Among the surgically confirmed 27 endometriosis-free women, the indications for laparoscopy were different benign medical indications such as infertility, prolapsed uterus, or ovarian cyst. The exclusion criteria were body mass index (BMI) ³30 kg/m 2 , pregnancy, postmenopausal status, concurrent malignancies, acute or chronic inflammatory diseases, systemic autoimmune disorders, diabetes mellitus, and other major systemic diseases receiving hormonal treatment for ≥ 3 months before the study. The phase of the menstrual cycle was evaluated based on the patient’s menstrual history and last menstrual period. Preoperative finding such as parity, smoking status, infertility, BMI, CA 125 and CA19-9 serum levels, hemoglobin, hematocrit, white blood cell (WBC), thrombocyte, C-reactive protein (CRP), Erythrocyte Sedimentation Rate (ESR) levels, fasting blood glucose and HbA1c levels, intraoperative findings including endometrioma diameter, presence of bilaterality of endometrioma, presence of peritoneal endometriosis lesions, revised American Society for Reproductive Medicine (r ASRM stage) score were recorded [16, 17]. Follow-up assessments were performed for patients with endometriosis 1 month after surgery. Patients were questioned verbally during the preoperative and postoperative periods to evaluate endometriosis-related pelvic pain including dyspareunia, deep dysmenorrhea, and non-cyclic pelvic pain. Patients' pain degree was measured using a verbal rating scale (VRS) with 6 pain intensity descriptors defined as "no pain", "mild", "disturbing", "distressing", "terrible", and "unbearable" [18]. Fasting venous blood samples at the phase of the menstrual cycle were collected from each participant into 10 ml Vacuette K 2 EDTA tubes (BD, Franklin Lakes, NJ, USA) before surgery for both groups and at 1st month after operation for the endometriosis group. Total RNA isolation from peripheral blood and determination of RNA quality Peripheral blood was collected from the patients in a 10 ml EDTA tube and transported to the laboratory by cold transport within 4 h at the latest, and leukocyte separation was performed. Blood in a 10 ml EDTA tube was transferred to a 50 ml falcon tube. Gey's aolution was added to double the amount of blood on top of the transferred blood. The thoroughly mixed tubes were kept in a refrigerator at +4°C for 20 min. The mixture was centrifuged at 1500 rpm for 10 min at room temperature. The supernatant was removed, and the precipitated pellet was dispersed. Equal volume of 1X Gey's solution was added to the pellet and centrifuged at 1500 rpm for 10 min at room temperature. After the supernatant was removed and the pellet was dispersed, 1 ml of 1X PBS was added. The mixture was centrifuged at 1500 rpm for 5 min at room temperature, and the supernatant was removed. The pellet was homogenized with 800 μl of TRIzol solution on ice in a fume hood. Subsequently, 200 μL of pre-chilled (+4°C) chloroform was added to the homogenized leukocyte samples. The mixture was vortexed for 15 s and then incubated on ice for 2 min. Subsequently, the samples were centrifuged at 12,000 x g for 20 min at +4°C. The resulting aqueous phase was carefully transferred to a new tube. An equal volume of pre-chilled (+4°C) 100% isopropanol was added, and the mixture was gently mixed. The total RNA isolated from the leukocytes was stored at -80°C for further use. A NanoDrop 2000 (Thermo Scientific™, USA) was used to determine the concentration of total RNAs isolated from blood and to check for protein and chemical contamination. RNA concentration measurements with a ratio of A260 nm / A280 nm measured by taking 1 μl sample in the range of 1.8-2.0 were considered to be of good quality and included in subsequent studies. cDNA Expression cDNA samples were synthesized using the BIORAD iScript ™ cDNA Synthesis Kit. Total RNA samples obtained from leukocytes and stored at -80°C were thawed on ice prior to use. The concentrations were adjusted to 100 ng/μl using RNase-free water. Quantitative real-time PCR SYBR Green (BIORAD) kit was used to determine the expression levels of selected lncRNA candidates by quantitative simultaneous polymerase chain reaction (qRT-PCR). β-actin was used as the endogenous gene to normalize the expression levels of these lncRNA candidates. The primer sequences used in this study are as follows : BAT5 forward primer ATTCCAGCTCCTGGGTTACTTG and reverse primer TCCGATGTGTTGCTTCCAAGA, MALAT1 forward primer GAATTGCGTCATTTAAAGCCTAGTT and reverse primer GTTTCATCCTACCACTCCCAATTAAT, UBOX5 forward primer TGACAAGCAAGACCCAAGGA and reverse primer CAGAGTTAGGCAGGCATTTCA, and ACTB (β-actin) forward primer GACCCAGATCATGTTTGAGACC and reverse primer TGGTGGTGAAGCTGTAGCC. The study protocol was designed on the LightCycler 480 device according to the kit used. Determination of lncRNA expression levels by relative quantitation After the PCR program was terminated in the LC480 device, the melting curves (Tm calling) and amplification curves of the samples were checked with the LC480 software, and the Ct values were determined using the "Release Absolute Quantification/2nd Derivative Max" analysis. The Ct values obtained from RT-PCR with duplicate samples were checked. Those repeated twice and having a Ct value of of ≥ 40 were not included in the calculations. The Ct value of each sample was subtracted from the Ct values of the endogenous control genes to obtain the ΔCt values. The average ΔCt values of the control group obtained using this method were used as a calibrator. To calculate the ΔΔCt values, the ΔCt values of the control group, selected as the calibrator, were subtracted from the obtained ΔCt values. The ΔΔCt values of the samples studied in pairs obtained by this calculation were averaged. The relative expression of the target lncRNAs in patient samples was compared to that of the calibrator, and the results were expressed as relative quantification (RQ) values. The RQ value was calculated using the 2^-(mean ΔΔCt value) formulation. Spearman's rank correlation coefficient was performed to calculate the correlation between RQ values and continuous variables in each group. Statistical analyses The expression levels (RQ values) of lncRNAs in the endometriosis, follow-up, and control groups were compared. The expression levels of lncRNAs in the study groups and the normality of continuous variables in clinical data were analyzed using the "Shapiro-Wilk" test, and it was determined that the data did not fit the normal distribution with 95% confidence. Therefore, the lncRNA expression levels were evaluated between groups using the Mann-Whitney U test. Continuous variables conforming to the normal distribution in clinical data were evaluated statistically using the Student’s t-test, and categorical variables were evaluated statistically using the X 2 test. Analysis of covariance (ANCOVA) was used to control for the confounding variables. To determine the diagnostic significance of expression levels of the lncRNAs in leukocytes for endometriosis, their sensitivity and specificity were examined using receiver operating characteristic (ROC) curve analysis. An area under the ROC curve (AUC) between 0.5 and 1 is considered to have diagnostic significance. SPSS software (version 20.0, Chicago, IL, USA) was used for statistical analysis, and p<0.05 was considered significant. Power and sample size calculations were performed using G*Power statistical software [19]. In this study, the power analysis (α=0.05) with independent Mann-Whitney U test (effect size, d= 0.75) was calculated as 88% in sample size (n=27) for the two groups. Results Baseline characteristics 28 endometriosis patients and 27 control subjects were included in the study. Eight out of 28 patients with endometriosis were lost to the follow-up, while 20 women were evaluated at 1 month after surgery. The median age of the endometriosis group was 37.68 ± 8.04 and 39.44 ± 6.68 for the control group (p=0.500). The clinical and biochemical characteristics of the study groups are presented in Table 1. There were no significant differences in age, parity, BMI, smoking status, or deep dyspareunia VRS scores between the endometriosis and control groups (p > 0.05). As expected, the dysmenorrhea VRS score, non-cyclic pelvic pain VRS score, and serum CA 125 level were significantly higher in the endometriosis group than those in the control group (p < 0.05). When we looked at the intraoperative findings , according to the rASRM classification, 96.4% (n=27) of patients with endometriosis were in stage III-IV, while only one (3.6%) was diagnosed in stage I-II. In addition, while 53.6% (n=15) of the patients diagnosed with endometriosis had peritoneal endometriosis lesions, 60.7% (n=17) had deep endometriosis. While 23 (82.1%) patients with endometriosis had endometriomas bilaterally, the mean diameter of endometriomas was 6.18 ± 2.89. A comparison of the preoperative and postoperative clinical and biochemical parameters of patients with endometriosis is shown in Table 2. The VRS scores for dyspareunia and dysmenorrhea were lower in the endometriosis group after surgery than before surgery (p=0.017; p=0.0001). However, the non-cyclic pelvic pain VRS score was not significantly different between the preoperative and postoperative periods (p= 0.076). Before surgery, dysmenorrhea, dyspareunia, and non-cyclic pelvic pain symptoms in women with endometriosis were 85.7%, 39.3%, and 64.3%, respectively. One month after surgery, these values decreased to 0%, %0, and 30%, respectively. Expression profile of circulating lncRNAs BAT5, MALAT1, and UBOX5 The expression levels of lncRNAs BAT5 , MALAT1 , and UBOX5 in circulating leukocytes among the study groups were presented in Table 3 and Figure 1. Preoperative expression level of BAT5 in the endometriosis group (9.26 ± 16.02) was higher than in the control group (3.06 ± 4.28), showing a 3-fold increase; however, this difference was not statistically significant ( p =0.103). Preoperative MALAT1 expression level was found to be significantly upregulated in the endometriosis group (44.33 ± 83.15) compared to the control group (10.30 ± 19.76), with a 4.3-fold increase ( p =0.005). In contrast, preoperative UBOX5 expression level was significantly lower in the endometriosis group (13.92 ± 17.44) compared to the control group (15.09 ± 36.29), showing a 1.08-fold decrease ( p =0.029). Furthermore, postoperative BAT5 expression level was not found to be significantly different between the endometriosis group (4.46 ± 10.17) and the control group (3.06 ± 4.28) (p=0.239). BAT5 expression level showed a decrease at 1 month after surgery (4.46 ± 10.17) compared to the pre-operative levels (9.26 ± 16.02), though neither change was statistically significant (p = 0.414). Similarly, MALAT1 expression level remained higher at 1 month after surgery in the endometriosis group (16.77 ± 34.17) than in the control group (10.30 ± 19.76); though neither change was statistically significant (p = 0.244). There was a significant drop in MALAT1 expression levels (16.77 ± 34.17) at 1 month after surgery compared to the levels in before surgery (44.33 ± 83.15) (p = 0.048). In addition, UBOX5 expression level (28.17 ± 67.31) increased in the postoperative period (28.17 ± 67.31) compared to both the control group (15.09 ± 36.29) and the preoperative levels (13.92 ± 17.44), (p = 0.112), (p = 0.594) respectively; but also, these differences were not statistically significant. ROC analysis ROC analysis for serum CA 125, MALAT1 and UBOX5 lncRNAs in circulating leukocytes between patients with endometriosis and controls were shown in Table 4 and Figure 2. The AUC of the expression ratio of preoperative CA 125, MALAT1 and UBOX5 were 0.84 (95% CI: 0.73-0.95), 0.70 (95% CI: 0.56-0.85), 0.66 (95% CI: 0.50-0.82), respectively; with cut-off 23.27 and 5.83, 4.37, respectively; sensitivity of 80.8%, 62.5% and 54.2%, specificity of 75.0 % and 71.0%, 91.0% respectively (Table 4 and Figure 2). Correlation analysis between clinical parameters and the expression levels of lncRNAs in the study groups The correlation analysis was done to identify the associations of clinical parameters and lncRNAs BAT5 , MALAT1 , and UBOX5 . There was a positive correlation between preoperative BAT5 expression and serum CA 19-9 level (r = 0.422; p = 0.036). Thrombocyte count was found to be negatively associated with preoperative UBOX5 expression (r = -0.487; p = 0.010). No correlations were observed with the other clinical features (data not shown). Discussion Our study is based on the hypothesis that the expression levels of selected candidate lncRNAs in leukocytes of endometriosis patients, based on the findings of studies investigating the molecular etiopathogenesis of endometriosis, may have a predictive effect on disease diagnosis and follow-up. We examined lncRNAs BAT5, MALAT1, and UBOX5 in the peripheral blood leukocytes of women with endometriosis, compared to the controls before surgery and at 1 month after surgery. We showed that preoperative MALAT1 expression level was significantly upregulated and UBOX5 expression level was downregulated in the endometriosis group compared to the control group. On the other hand, preoperative and postoperative BAT5 expression levels were not found to be significantly different between the endometriosis group and the controls. No significant difference in BAT5 expression levels was observed between the preoperative and postoperative periods whereas MALAT1 expression level showed a significant drop at 1 month after surgery compared to the preoperative levels. In addition, we observed no significant difference in UBOX5 expression level in the postoperative period compared to both the control group and the preoperative levels. According to ROC analysis, serum CA 125 level demonstrated good diagnostic performance, while MALAT1 showed moderate diagnostic accuracy. Moreover, we found that BAT5 expression level was positively correlated with serum CA 19-9 level and thrombocyte count was negatively associated with the preoperative UBOX5 expression level. LncRNAs have been reported to control various aspects of cellular processes, including cell proliferation, apoptosis, differentiation, angiogenesis, and immune functions [20]. Because lncRNAs generally form highly stable secondary structures, their quantitative detection is possible. These properties suggest that lncRNAs may not only be potential biomarkers for clinical diagnosis of the disease but also important factors in disease development [21]. Cui et al. identified 86 differentially expressed lncRNAs and 1,228 differentially expressed mRNAs in eutopic endometrial tissues of 17 ovarian endometriosis patients compared with normal endometrial tissues from 17 patients without visible endometriosis [22]. Pathway analysis and gene ontology analysis showed that lncRNAs are involved in biological processes and signaling pathways that play a role in the development of endometriosis, such as proliferation, adhesion, migration, angiogenesis, steroidogenesis, and notch signaling [23]. UBOX5 is a gene that codes for proteins. The innate immune system and class I MHC-mediated antigen processing and presentation are two of its associated mechanisms [24]. Considering the fact that endometriosis is chronic inflammatory disease, there are a few studies in the literature examining lncRNA UBOX5 expression levels in endometriosis [13, 25]. It is known that hypoxia is a key feature, linked to the spread of endometrial cells through a process called epithelial-mesenchymal transition (EMT). Liu et al. reported that in ectopic endometrium, hypoxia-inducible factor-1α (HIF-1α) can accelerate upregulation of the expression of lncRNA UBOX antisense RNA 1 (UBOX5-AS1), promote EMT, and give rise to the occurrence and progression of endometriosis [13, 26]. The authors of the study proposed that upregulated expression of the lncRNA UBOX5-AS1 is essential for regulating the hypoxia-regulated EMT and endometriosis's invasiveness, indicating that lncRNA UBOX5-AS1 may be an important possible endometriosis treatment target [13]. Furthermore, a recent study showed that lncRNA UBOX5-AS1 expression was significantly increased in ovarian endometriotic tissue and primary ectopic endometrial stromal cells. They also found that expression of lncRNA UBOX5-AS1 was significantly positively correlated with demethylase Alk B homologous protein 5 (ALKBH5) expression and autophagy contributing to the progression of ovarian endometriosis [25]. In our study, we observed a significant decrease in preoperative UBOX5 expression levels in endometriosis patients compared to the control group. Moreover, our results are important in showing that, this significant decrease lost its relevance as UBOX5 expression levels increased beyond the control group in 1-month follow-up, and from another perspective, the expression levels reached similar values to those of the control group marking a novel aspect in the literature. Our findings also indicated that a negative association between thrombocyte count and preoperative UBOX5 expression levels. Our results contradict the findings of previous studies. In fact, a possible reason for this could be that lncRNA levels in tissue may not always match those in blood leukocytes. Factors such as the timing of blood sampling, disease stage, and sampling methods may also contribute to variations in UBOX5 expression levels. MALAT1 encodes an 8.7-kb exonic transcript that exhibits high transcription levels in a variety of tissues, including the heart, kidney, and brain and is shown to be linked to the production of pro-inflammatory cytokines [27]. A review of the literature on MALAT1 revealed several key findings related to its role in endometriosis [26]. Yu et al. demonstrated that MALAT1 levels were significantly higher in ectopic endometrium compared to the controls, and highlighted its role in facilitating endometrial cell apoptosis via the NF-κB/iNOS signaling pathway. This pathway modulates MMP-9 expression, which in turn suppresses endometrial cell proliferation and invasion. The NF-κB/iNOS signaling pathway is crucial for inflammation and immune responses, while MMP-9 is involved in various physiological processes, including cell proliferation and migration. MALAT1 has been shown to downregulate the NF-κB/iNOS pathway, further inhibiting MMP-9 expression and contributing to endometriosis progression [28-31]. Similarly, our findings suggested that preoperative MALAT1 expression level was significantly upregulated in the endometriosis group compared to the control group. Also, t here was a significant drop in MALAT1 expression levels at one month after surgery compared to before surgery. According to ROC analysis, MALAT1 showed moderate diagnostic accuracy. Furthermore, Feng et al. found that loss of MALAT1 promoted apoptosis of human endometrial stromal cells (HESCs) probably through miR-126-5p/CREB1 axis mediated PI3K/AKT pathway contributing the development of endometriosis [32]. In this concept, Li et al. showed that the expression level of MALAT1 was significantly reduced in endometriosis granulosa cells (GCs) compared to the controls. Also, MALAT1 lncRNA levels were significantly lower in the GCs of infertile endometriosis patients wih advanced stage [33]. On the other hand, in a recent study by Szaflik et al. reported no significant difference in the expression of MALAT1 in ectopic endometrium compared to the normal endometrium [34]. Although current studies showed contradictive results, overall, findings from the recent reports emphasize the significant role of MALAT1 in the pathogenesis of endometriosis, particularly through its inflammatory effects. Our findings indicated that MALAT1 expression in blood leukocytes may serve as a biomarker for diagnosis and monitoring the disease. BAT5 is located within the gene cluster of the human major histocompatibility complex (MHC) class III, suggesting a potential role in the immune system [35]. Cai et al. were the first to identify BAT5 as a long non-coding RNA (lncRNA) in a microarray-based expression profiling study, showing that its expression in peripheral blood mononuclear cells was twofold higher in patients with coronary artery disease compared to healthy controls [36]. Therefore, it is suggested that patients with myocardial infarction are associated with decreased monocytes BAT5 expression levels in leukocytes compared with controls and may have an impact on myocardial infarction pathogenesis in the acute phase [37]. To the best of our knowledge, no studies have investigated circulating BAT5 expression levels in women with endometriosis. We made a hypothesis that the observed direction of change in leukocytes aligns with previously reported findings in monocytes, suggesting that BAT5 may be involved in the inflammatory processes of endometriosis, similar to its role in coronary artery disease. Therefore, in our study, we observed no significant difference in preoperative and postoperative BAT5 expression levels between the endometriosis group and the controls. Moreover, there was no significant difference in BAT5 expression level between the preoperative levels and postoperative levels. We found that BAT5 expression level was positively correlated with serum CA 19-9 level. From this standpoint, studies from the literature indicated that serum CA19-9 levels were significantly increased in endometriosis patients compared to the controls and were associated with the endometriosis severity [38]. Finally, the lack of change in BAT5 expression in blood leucocytes could be attributed to cell type-specific expression, post-transcriptional regulation, or technical factors. Further research is needed to better understand these mechanisms. A key strength of our research lies within the fact that comparison of lncRNA BAT5, MALAT1 , and UBOX5 expression levels in women with endometriosis before surgery and at 1 month after surgery. Considering that lncRNAs may serve as potential biomarkers for endometriosis, their expression levels are expected to change after endometriosis surgery, particularly during the early postoperative period. On the other hand, given that endometriosis is a chronic inflammatory disease, this study is the first to reveal the expression of lncRNAs in blood leukocytes from women. Meanwhile, there are several limitations of our study. Endometriosis surgeries are performed by several expert surgeons; it would be better if all surgeries were done by the same surgeon. Another limitation is the endometriotic tissue expression levels of lncRNAs were not examined in our study. It is needed to know that the correlation between the tissue and blood expression levels of lncRNAs which expands our understanding of the pathogenesis of endometriosis. Lastly, our analysis was limited to lncRNA expression during the early postoperative period. Therefore, we recommend investigating the comparison of expression levels of lncRNAs between the preoperative and late postoperative periods to provide a bridging gap in understanding of endometriosis pathophysiology. To the best of our knowledge, this is the first study of exploring the expression profile of blood leucocyte lncRNAs UBOX5, MALAT1 , and BAT5 in women with endometriosis compared to the controls before surgery and at 1 month after surgery. Our study findings revealed that expression of lncRNA MALAT1 and UBOX5 seems to be contributed to the pathogenesis of endometriosis, potentially through its involvement in inflammation. Moreover, MALAT1 may serve as a promising biomarker for the diagnosis and monitoring of endometriosis. The data obtained in our study may enrich the limited literature on BAT5 lncRNA. Further studies are necessary to support our findings and to clarify the roles of these lncRNAs in the molecular pathogenesis of endometriosis. Declarations DATA AVAILABILITY Data will be made available on request. Author Contributions Project development: MH, HA, AT, NT, EB; Performed the experiments: HA, AK, EB Analyzed the data: HA, MH, İK, EB; Data collection or management: HA, MH, İK, EÖ, AK, NT, EB; Contributed reagents/ materials/analysis tools: HA, MH, İK, EÖ, AK, NT, EB, HA, AK; Wrote the manuscript: HA, MH, EB; Final edit of paper: HA, MH, EB, İK, EÖ, AK, NT, AT. All authors read and approved the manuscript. Ethical Approval: This study has been approved by Ethics Committee of the Istanbul Medical Faculty, Istanbul. University, Istanbul, Turkey (2018/1519). All research subjects have signed informed consent to participate and publish. This study was performed in accordance with the ethical standards in the Declaration of Helsinki (2013). Funding: The work was supported by the Scientific Research Projects Coordination Unit of Istanbul University, Turkey [Project numbers: TYL2017-27357 and 28473]. Conflict of interest: The authors declare that they have no conflict of interest. Declaration of generative AI : The authors declare that there is no use of generative AI and AI-assisted technologies. References Moustafa S, Burn M, Mamillapalli R, Nematian S, Flores V, Taylor HS (2020) Accurate diagnosis of endometriosis using serum microRNAs. Am J Obstet Gynecol 223:557 e1-557. e11 Arafah M, Rashid S, Akhtar M (2021) Endometriosis: a comprehensive review. Adv Anat Pathol 28:30–43 Vercellini P, Viganò P, Somigliana E, Fedele L (2014) Endometriosis: pathogenesis and treatment. Nat Reviews Endocrinol 10:261–275 Malvezzi H, Marengo EB, Podgaec S, Piccinato CA (2020) Endometriosis: current challenges in modeling a multifactorial disease of unknown etiology. J translational Med 18:311 Saunders PT, Horne AW (2021) Endometriosis: Etiology, pathobiology, and therapeutic prospects. Cell 184:2807–2824 Yan W, Hu H, Tang B (2020) Progress in understanding the relationship between long noncoding RNA and endometriosis. Eur J Obstet Gynecol reproductive biology: X 5:100067 La Ferlita A, Battaglia R, Andronico F, Caruso S, Cianci A, Purrello M, Di Pietro C (2018) Non-coding RNAs in endometrial physiopathology. Int J Mol Sci 19:2120 Wang Y, Li Y, Yang Z, Liu K, Wang D (2015) Genome-wide microarray analysis of long non-coding RNAs in eutopic secretory endometrium with endometriosis. Cell Physiol Biochem 37:2231–2245 Marques-Rocha JL, Samblas M, Milagro FI, Bressan J, Martínez JA, Marti A (2015) Noncoding RNAs, cytokines, and inflammation‐related diseases. FASEB J 29:3595–3611 Panir K, Schjenken JE, Robertson SA, Hull ML (2018) Non-coding RNAs in endometriosis: a narrative review. Hum Reprod Update 24:497–515 Ghazal S, McKinnon B, Zhou J, Mueller M, Men Y, Yang (2015) L H19 lncRNA alters stromal cell growth via IGF signaling in the endometrium of women with endometriosis. EMBO Mol Med 7(8):996–1003 Liang Z, Chen Y, Zhao Y, Xu C, Zhang A, Zhang Q, Wang D, He J, Hua W, Duan P (2017) miR-200c suppresses endometriosis by targeting MALAT1 in vitro and in vivo. Stem Cell Res Ther 8:251 Liu H, He H, Zhang Z, Wang L, Zhang L, Liu Y, Xiong W (2021) Upregulation of the long noncoding RNA UBOX5 antisense RNA 1 (UBOX5-AS1) under hypoxic conditions promotes epithelial-mesenchymal transition in endometriosis. Annals Translational Med 9:790 Li W-N, Wu M-H, Tsai S-J (2021) Hypoxia and reproductive health: the role of hypoxia in the development and progression of endometriosis. Reproduction 161:F19–F31 Cai Y, Yang Y, Chen X, Wu G, Zhang X, Liu Y, Yu J, Wang X, Fu J, Li C (2016) Circulating ‘lncRNA OTTHUMT00000387022’from monocytes as a novel biomarker for coronary artery disease. Cardiovascular Res 112:714–724 Canis M, Donnez JG, Guzick DS, Halme JK, Rock JA, Schenken RS, Vernon MW (1997) Revised american society for reproductive medicine classification of endometriosis: 1996. Fertil Steril 67:817–821 Bandini V, Giola F, Ambruoso D, Cipriani S, Chiaffarino F, Vercellini P (2024) The natural evolution of untreated deep endometriosis and the effect of hormonal suppression: A systematic literature review and meta-analysis. Acta Obstet Gynecol Scand 103:1722–1735 Melzack R (1975) The McGill Pain Questionnaire: major properties and scoring methods. Pain 1:277–299 Faul F, Erdfelder E, Lang A-G, Buchner A (2007) G* Power 3: A flexible statistical power analysis program for the social, behavioral, and biomedical sciences. Behav Res Methods 39:175–191 Wang H, Sha L, Huang L, Yang S, Zhou Q, Luo X, Shi B (2019) LINC00261 functions as a competing endogenous RNA to regulate BCL2L11 expression by sponging miR-132-3p in endometriosis. Am J Translational Res 11:2269 Wang W-T, Sun Y-M, Huang W, He B, Zhao Y-N, Chen Y-Q (2016) Genome-wide long non-coding RNA analysis identified circulating LncRNAs as novel non-invasive diagnostic biomarkers for gynecological disease. Sci Rep 6:23343 Cui D, Ma J, Liu Y, Lin K, Jiang X, Qu Y, Lin J, Xu K (2018) Analysis of long non-coding RNA expression profiles using RNA sequencing in ovarian endometriosis. Gene 673:140–148 Hudson QJ, Proestling K, Perricos A, Kuessel L, Husslein H, Wenzl R, Yotova I (2021) The role of long non-coding RNAs in endometriosis. Int J Mol Sci 22:11425 Zhang Y-M, Meng L-B, Yu S-J, Ma D-X (2020) Identification of potential crucial genes in monocytes for atherosclerosis using bioinformatics analysis. J Int Med Res 48:0300060520909277 Liu H, Liang J, Wang X, Xiong W, Zhang L, Dai X, Wang X, Wang X, Xu Y, Liu Y (2025) ALKBH5 promotes autophagy and progression by mediating m6A methylation of lncRNA UBOX5-AS1 in endometriosis. Am J Physiology-Cell Physiol 328:C639–C656 Liu Y, Zhang W, Jin L, Ren J, Liu Z, Lu D (2023) The role of long noncoding RNAs in endometriosis progression. Front Bioscience-Landmark 28:109 Gordon AD, Biswas S, Feng B, Chakrabarti S (2018) MALAT1: a regulator of inflammatory cytokines in diabetic complications. Endocrinol diabetes metabolism 1:e00010 Tano K, Mizuno R, Okada T, Rakwal R, Shibato J, Masuo Y, Ijiri K, Akimitsu N (2010) MALAT-1 enhances cell motility of lung adenocarcinoma cells by influencing the expression of motility-related genes. FEBS Lett 584:4575–4580 Li X, Song Y, Liu F, Liu D, Miao H, Ren J, Xu J, Ding L, Hu Y, Wang Z (2017) Long non-coding RNA MALAT1 promotes proliferation, angiogenesis, and immunosuppressive properties of mesenchymal stem cells by inducing VEGF and IDO. J Cell Biochem 118:2780–2791 Zhang X, Hamblin MH, Yin K-J (2017) The long noncoding RNA Malat1: Its physiological and pathophysiological functions. RNA Biol 14:1705–1714 Yu J, Chen LH, Zhang B, Zheng QM (2019) The modulation of endometriosis by lncRNA MALAT1 via NF-κB/iNOS. Eur Rev Med Pharmacol Sci 23:4073–4080. 10.26355/eurrev_201905_17908 Feng Y, Tan BZ (2020) LncRNA MALAT1 inhibits apoptosis of endometrial stromal cells through miR-126-5p-CREB1 axis by activating PI3K-AKT pathway. Mol Cell Biochem 475:185–194. 10.1007/s11010-020-03871-y Li Y, Liu YD, Chen SL, Chen X, Ye DS, Zhou XY, Zhe J, Zhang J (2019) Down-regulation of long non-coding RNA MALAT1 inhibits granulosa cell proliferation in endometriosis by up-regulating P21 via activation of the ERK/MAPK pathway. Mol Hum Reprod 25:17–29. 10.1093/molehr/gay045 Szaflik T, Romanowicz H, Szyłło K, Kołaciński R, Michalska MM, Samulak D, Smolarz B (2022) Analysis of Long Non-Coding RNA (lncRNA) UCA1, MALAT1, TC0101441, and H19 Expression in Endometriosis. Int J Mol Sci 23. 10.3390/ijms231911583 Fontanesi L, Galimberti G, Calò DG, Fronza R, Martelli PL, Scotti E, Colombo M, Schiavo G, Casadio R, Buttazzoni L, Russo V (2012) Identification and association analysis of several hundred single nucleotide polymorphisms within candidate genes for back fat thickness in Italian Large White pigs using a selective genotyping approach. J Anim Sci 90:2450–2464. 10.2527/jas.2011-4797 Cai Y, Yang Y, Chen X, Wu G, Zhang X, Liu Y, Yu J, Wang X, Fu J, Li C, Jose PA, Zeng C, Zhou L (2016) Circulating 'lncRNA OTTHUMT00000387022' from monocytes as a novel biomarker for coronary artery disease. Cardiovasc Res 112:714–724. 10.1093/cvr/cvw022 Senturk H, Karaayvaz EB, Oksen D, Yildiz M, Yildiz CE, Gedikbasi A, Komurcu-Bayrak E (2023) The Importance of Decreased Expression Levels of BAT5 and IL21R-AS1 in Circulating Leukocytes of Patients with Acute Myocardial Infarction. Authorea Preprints Shuang T, Wang Y, Zhao L, Zhang K, Yin P, Guo L, Jing W, Feng X, Li Q (2022) Extremely high serum CA19-9 level along with elevated D-dimer in assisting detection of ruptured ovarian endometriosis. Ann Med 54:1444–1451 Tables Tables 1 to 4 are available in the Supplementary Files section. Additional Declarations No competing interests reported. Supplementary Files Table1.docx Table2.docx Table3.docx Table4.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8011405","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":540051730,"identity":"d3bf0dbb-190f-4768-93a1-9876bb43abf7","order_by":0,"name":"Hülya Aydınlı","email":"","orcid":"","institution":"Istanbul University","correspondingAuthor":false,"prefix":"","firstName":"Hülya","middleName":"","lastName":"Aydınlı","suffix":""},{"id":540051731,"identity":"f13483f1-33ce-4149-b64e-b3c281af8fff","order_by":1,"name":"Meryem Hocaoglu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABHklEQVRIiWNgGAWjYDCCA0hsxgYDIMneACQMLIjQwgbTwgMSMpAgVguIIZEAJnHq4Lt9gHXDxz2H5XTnNz/+OKPgnry55POrG34USDDwt3cnYNMieS6B7eaMZ4eNzY6xmUluMCg23Dk7p+xmD9BhEmfObsCmxeAMA9ttngOHE7cdYzBjfGCQwLjhdk7aDR6gFgOJXNxa/hw4XL/tGPvnj0At9htunkm7+YeQFoYDhxPMjvEYAB2WkLjhBvux2/hskTzD2Haz50C64bZjOWWSMwwSkjecyWG7LWMgwYPLL3xnmI/d+HHAWt7s8PHNH3v+JNhuOH782c03f2zk+Nt7sWqBRkYzsgiPAZjErhwO6pA57A8IqB4Fo2AUjIIRBgDhrW6NuBdVEQAAAABJRU5ErkJggg==","orcid":"","institution":"Goztepe Prof. Dr. Süleyman Yalçın City Hospital, Istanbul Medeniyet University","correspondingAuthor":true,"prefix":"","firstName":"Meryem","middleName":"","lastName":"Hocaoglu","suffix":""},{"id":540051733,"identity":"6d52d131-13b2-4534-961d-3dc3c9ddc180","order_by":2,"name":"İlayda Loçlar Karaalp","email":"","orcid":"","institution":"Goztepe Prof. Dr. Süleyman Yalçın City Hospital, Istanbul Medeniyet University","correspondingAuthor":false,"prefix":"","firstName":"İlayda","middleName":"Loçlar","lastName":"Karaalp","suffix":""},{"id":540051735,"identity":"9889f057-7939-4750-b88d-74d7d997c1dc","order_by":3,"name":"Elvan Yağimli Öztürk","email":"","orcid":"","institution":"Goztepe Prof. Dr. Süleyman Yalçın City Hospital, Istanbul Medeniyet University","correspondingAuthor":false,"prefix":"","firstName":"Elvan","middleName":"Yağimli","lastName":"Öztürk","suffix":""},{"id":540051737,"identity":"0bee3d62-0a06-464e-84f1-4e2aa741018c","order_by":4,"name":"Aslı Karacan","email":"","orcid":"","institution":"Istanbul University","correspondingAuthor":false,"prefix":"","firstName":"Aslı","middleName":"","lastName":"Karacan","suffix":""},{"id":540051739,"identity":"93a2adf5-5831-4ca1-971d-3b599a193932","order_by":5,"name":"Niyazi Tuğ","email":"","orcid":"","institution":"Sancaktepe Şehit Prof. Dr. İlhan Varank Education and Training Hospital","correspondingAuthor":false,"prefix":"","firstName":"Niyazi","middleName":"","lastName":"Tuğ","suffix":""},{"id":540051740,"identity":"dda3415c-74df-4c46-b65e-3e767f49e794","order_by":6,"name":"Abdulkadir Turgut","email":"","orcid":"","institution":"Goztepe Prof. Dr. Süleyman Yalçın City Hospital, Istanbul Medeniyet University","correspondingAuthor":false,"prefix":"","firstName":"Abdulkadir","middleName":"","lastName":"Turgut","suffix":""},{"id":540051742,"identity":"7e19e0fb-7ac2-4e9a-8c3d-e9fa1d0f2221","order_by":7,"name":"Evrim Komurcu Bayrak","email":"","orcid":"","institution":"Istanbul University","correspondingAuthor":false,"prefix":"","firstName":"Evrim","middleName":"Komurcu","lastName":"Bayrak","suffix":""}],"badges":[],"createdAt":"2025-11-02 13:53:33","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8011405/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8011405/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":96243896,"identity":"249ca4d6-ab15-4359-b057-12fddd9a0511","added_by":"auto","created_at":"2025-11-19 07:17:16","extension":"jpg","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4353398,"visible":true,"origin":"","legend":"","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8011405/v1/98ffeb186a5081c1b5a04e36.jpg"},{"id":96242827,"identity":"f59676d7-333c-4d80-a531-a9a207334b39","added_by":"auto","created_at":"2025-11-19 07:14:31","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":87208,"visible":true,"origin":"","legend":"","description":"","filename":"Mainmanuscript.docx","url":"https://assets-eu.researchsquare.com/files/rs-8011405/v1/2ef30542a2e439344179fb16.docx"},{"id":96243927,"identity":"06583445-138f-4a11-8c61-87e5bace9b59","added_by":"auto","created_at":"2025-11-19 07:17:19","extension":"jpg","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2432265,"visible":true,"origin":"","legend":"","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8011405/v1/be937b8029784787725f5464.jpg"},{"id":95914103,"identity":"44f0fba4-ee41-407b-a229-4753dbb10923","added_by":"auto","created_at":"2025-11-14 11:11:17","extension":"docx","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":22700,"visible":true,"origin":"","legend":"","description":"","filename":"Table1.docx","url":"https://assets-eu.researchsquare.com/files/rs-8011405/v1/6d17803d45175351957fc45c.docx"},{"id":95914100,"identity":"892f10a0-1846-4387-a6d7-3c053462b9e8","added_by":"auto","created_at":"2025-11-14 11:11:17","extension":"docx","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":18874,"visible":true,"origin":"","legend":"","description":"","filename":"Table2.docx","url":"https://assets-eu.researchsquare.com/files/rs-8011405/v1/81a302224c88e68a303cbf82.docx"},{"id":95914105,"identity":"7c190fb3-695f-4a57-a4ee-a6dbc8cd19a7","added_by":"auto","created_at":"2025-11-14 11:11:17","extension":"docx","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":18590,"visible":true,"origin":"","legend":"","description":"","filename":"Table3.docx","url":"https://assets-eu.researchsquare.com/files/rs-8011405/v1/d023023fb0bd2e5bc0daeb5e.docx"},{"id":96243091,"identity":"bb1e30ff-a443-4d2f-b725-be0c3e725587","added_by":"auto","created_at":"2025-11-19 07:15:31","extension":"docx","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":16906,"visible":true,"origin":"","legend":"","description":"","filename":"Table4.docx","url":"https://assets-eu.researchsquare.com/files/rs-8011405/v1/83454caf01487cab80a67e25.docx"},{"id":95914109,"identity":"7c0f2041-0302-46a5-8942-e39ad5a88b83","added_by":"auto","created_at":"2025-11-14 11:11:17","extension":"json","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":9398,"visible":true,"origin":"","legend":"","description":"","filename":"1d914ae0292e45e8af8b508e3f119a35.json","url":"https://assets-eu.researchsquare.com/files/rs-8011405/v1/119522a9613a93fe1bf93e51.json"},{"id":95914110,"identity":"edbcb5f8-8cbb-45ea-80c5-b9e87c7a4d95","added_by":"auto","created_at":"2025-11-14 11:11:18","extension":"xml","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":135204,"visible":true,"origin":"","legend":"","description":"","filename":"1d914ae0292e45e8af8b508e3f119a351enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-8011405/v1/0a90d514a89484cd4642db63.xml"},{"id":96243017,"identity":"4a9eebbc-8e70-4788-81f8-5c2807c86f95","added_by":"auto","created_at":"2025-11-19 07:15:12","extension":"jpg","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4353398,"visible":true,"origin":"","legend":"","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8011405/v1/5680223ffe4f80f4a0b3e0ec.jpg"},{"id":95914108,"identity":"4733ab5f-6f0f-4087-8166-2eafad433fce","added_by":"auto","created_at":"2025-11-14 11:11:17","extension":"jpg","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2432265,"visible":true,"origin":"","legend":"","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8011405/v1/a182bf2dc6971d7a0b79dd55.jpg"},{"id":95914113,"identity":"ed5c48c6-9f5b-444e-a25a-3f71c29e7310","added_by":"auto","created_at":"2025-11-14 11:11:18","extension":"png","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6894861,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure1.png","url":"https://assets-eu.researchsquare.com/files/rs-8011405/v1/661e9ef97f6bc88b9ed77e3f.png"},{"id":96243513,"identity":"21e3aa29-e707-4af8-8809-6d84637a1b8b","added_by":"auto","created_at":"2025-11-19 07:16:35","extension":"png","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":789331,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure2.png","url":"https://assets-eu.researchsquare.com/files/rs-8011405/v1/e8abe7292c30c12f2a77332d.png"},{"id":95914115,"identity":"9140b96b-b5a6-48a9-a14a-db382bdcbc34","added_by":"auto","created_at":"2025-11-14 11:11:18","extension":"xml","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":133296,"visible":true,"origin":"","legend":"","description":"","filename":"1d914ae0292e45e8af8b508e3f119a351structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-8011405/v1/5cb6b0825bf7d8def3f1c4e2.xml"},{"id":95914112,"identity":"f5c155f0-5ef9-4dbd-8418-43b56fe59861","added_by":"auto","created_at":"2025-11-14 11:11:18","extension":"html","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":145256,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-8011405/v1/92783ea6f022b6b2cf7d6162.html"},{"id":95914101,"identity":"2d5cba9b-107f-4b68-9410-f693cd6e8c9a","added_by":"auto","created_at":"2025-11-14 11:11:17","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":4353398,"visible":true,"origin":"","legend":"\u003cp\u003eThe expression levels of circulating long non-coding RNAs \u003cem\u003eBAT5, MALAT1\u003c/em\u003e, and \u003cem\u003eUBOX5 \u003c/em\u003ein women with endometriosis and the controls, before surgery and 1 month after surgery\u003c/p\u003e","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8011405/v1/abb495b14413b56cadc8794c.jpg"},{"id":95914096,"identity":"e32c73c4-cf8b-4cad-a4c2-d48257ec68be","added_by":"auto","created_at":"2025-11-14 11:11:17","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":135936,"visible":true,"origin":"","legend":"\u003cp\u003eReceiver operating characteristic (ROC) analysis for serum CA-125\u003cem\u003e \u003c/em\u003eand the expression levels of\u003cem\u003e \u003c/em\u003elncRNAs\u003cem\u003e MALAT1 \u003c/em\u003eand\u003cem\u003e UBOX5 \u003c/em\u003ebetween women with endometriosis and the controls\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-8011405/v1/f03ce321cf9005214ca008fc.png"},{"id":98224310,"identity":"c393f1fd-0830-4239-a554-601c5d18de42","added_by":"auto","created_at":"2025-12-15 12:10:09","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":5368477,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8011405/v1/f2c43376-2153-4e67-840f-7c6cf7112364.pdf"},{"id":95914094,"identity":"87076035-c67f-46b2-86a6-5e7a562a3c40","added_by":"auto","created_at":"2025-11-14 11:11:17","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":22700,"visible":true,"origin":"","legend":"","description":"","filename":"Table1.docx","url":"https://assets-eu.researchsquare.com/files/rs-8011405/v1/153a2e7154bd8236a66af8a1.docx"},{"id":95914095,"identity":"5d8101f9-db55-4e11-823b-3c70924e08fd","added_by":"auto","created_at":"2025-11-14 11:11:17","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":18874,"visible":true,"origin":"","legend":"","description":"","filename":"Table2.docx","url":"https://assets-eu.researchsquare.com/files/rs-8011405/v1/0a00e48600276f4462ac863a.docx"},{"id":96244240,"identity":"9cd33de1-6305-4927-84fd-ce1174687463","added_by":"auto","created_at":"2025-11-19 07:18:00","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":18590,"visible":true,"origin":"","legend":"","description":"","filename":"Table3.docx","url":"https://assets-eu.researchsquare.com/files/rs-8011405/v1/52e6562296fc56b6149aeb20.docx"},{"id":96243086,"identity":"663f9ebc-b54f-4a63-904f-7cc1d4c93e82","added_by":"auto","created_at":"2025-11-19 07:15:29","extension":"docx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":16906,"visible":true,"origin":"","legend":"","description":"","filename":"Table4.docx","url":"https://assets-eu.researchsquare.com/files/rs-8011405/v1/76c6ee9e2bc0a48e78c6a2d6.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Identification of long non-coding RNAs BAT5, MALAT1, and UBOX5 in the peripheral blood leukocytes of women with endometriosis before surgery and at 1 month after surgery","fulltext":[{"header":"Introduction","content":"\u003cp\u003eEndometriosis is an inflammatory disease characterized by endometrium-like glandular tissue and stroma outside the uterus, affecting nearly 10% of reproductive-age women and causing chronic pelvic pain and infertility [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Despite several theories proposed to elucidate the etiology of endometriosis, the exact pathogenesis of the condition is still poorly understood [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. The difficulties inherent in understanding endometriosis are related to its multifactorial nature [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Inflammation is one of the most important key players in the pathogenesis of endometriosis. The presence of ectopic tissue in the peritoneal cavity is associated with overproduction of prostaglandins, cytokines, and chemokines (4\u0026ndash;6). In addition, endometriosis lesions are complex multicellular structures, and vascularization, including angiogenesis, serves a crucial function in their establishment, survival, and growth [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. The diagnosis of endometriosis is often delayed by several years after the onset of the symptoms [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Currently, there are no reliable non-invasive diagnostic biomarkers for endometriosis. However, a non-invasive diagnostic biomarker of endometriosis may prevent delays in diagnosis, leading to timelier and more efficient medical and surgical treatment of the disease [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eGenome-wide human transcriptional studies have revealed numerous non-protein-coding RNAs (ncRNAs), including short and long ncRNAs Long ncRNAs (lncRNAs) are molecules larger than 200 nucleotides that have important regulatory roles in a wide variety of biological processes. This suggests that lncRNAs, in addition to being potential biomarkers for the clinical diagnosis of the disease, may also play a role in disease development [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Therefore, several studies identified lncRNAs involved in the etiopathogenesis of endometriosis which is related to systemic chronic inflammation [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. \u003cem\u003eH19\u003c/em\u003e lncRNA has been associated with infertility [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e], and with the proliferation and migration of \u003cem\u003eMALAT1\u003c/em\u003e (metastasis-associated lung adenocarcinoma transcript 1) endometriosis cells, which has also been shown in many other cancer types [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. A recent study investigated the expression patterns and function of UBOX5-AS1 (UBOX5 Antisense RNA 1) in hypoxic endometrial epithelial cells, demonstrating that UBOX5 is activated under hypoxic conditions, which play an important role in the endometriosis lesion microenvironment, where it may stimulate the biosynthesis of estrogens and the expression of estrogen receptors [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Moreover, in a microarray-based lncRNA expression profiling study, \u003cem\u003eBAT5\u003c/em\u003e (HLA-B associated transcript 5) was identified among the lncRNAs proposed as a candidate biomarker for coronary artery disease [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Given the potential roles of lncRNAs in endometriosis pathogenesis and inflammation, based on the existing literature, we aimed to investigate the expression profiles of candidate lncRNAs \u003cem\u003eBAT5\u003c/em\u003e, \u003cem\u003eMALAT1\u003c/em\u003e, and \u003cem\u003eUBOX5\u003c/em\u003e in blood leukocytes from women with endometriosis compared to those of controls before surgery and at 1 month after surgery. Furthermore, to better understand the potential impact of lncRNAs implicated in endometriosis, we designed a unique short-term follow-up study of patients who underwent surgery for endometriosis.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003e\u003cstrong\u003e\u003cem\u003eEthical Approval\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study has been approved by Ethics Committee of the Istanbul Medical Faculty, Istanbul, Turkey (2018/1519). All research subjects have signed informed consent to participate and publish. This study was performed in accordance with the ethical standards in the Declaration of Helsinki (2013).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eStudy subjects and sample collection\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis prospective longitudinal cohort study was conducted at Goztepe Prof. Dr. Süleyman Yal\u0026ccedil;ın City Hospital affiliated to Istanbul Medeniyet University and Sancaktepe Şehit Prof. Dr. İlhan Varank Education and Training Hospital, Istanbul, Turkey between December 2019 and July 2022. Women aged 18-50 years with regular menstrual cycles with endometriosis (n = 28) and surgically confirmed endometriosis-free women (n = 27) were enrolled in this study. \u0026nbsp;Laparoscopy was performed to determine the presence or absence of endometriosis in the patients. Endometriosis was diagnosed based on surgical and histological findings in 28 women. Among the surgically confirmed 27 endometriosis-free women, the indications for laparoscopy were different benign medical indications such as infertility, prolapsed uterus, or ovarian cyst. The exclusion criteria were body mass index (BMI)\u0026nbsp;\u0026sup3;30 kg/m\u003csup\u003e2\u003c/sup\u003e, pregnancy, postmenopausal status, concurrent malignancies, acute or chronic inflammatory diseases, systemic autoimmune disorders, diabetes mellitus, and other major systemic diseases receiving hormonal treatment for \u0026ge; 3 months before the study. The phase of the menstrual cycle was evaluated based on the patient\u0026rsquo;s menstrual history and last menstrual period. Preoperative finding such as parity, smoking status, infertility, BMI, CA 125 and CA19-9 serum levels, hemoglobin, hematocrit, white blood cell (WBC), thrombocyte, C-reactive protein (CRP),\u0026nbsp;Erythrocyte Sedimentation Rate (ESR) levels,\u0026nbsp;fasting blood glucose and HbA1c levels, intraoperative findings including\u0026nbsp;endometrioma diameter, presence of bilaterality of endometrioma,\u0026nbsp;presence of peritoneal endometriosis lesions,\u0026nbsp;revised American Society for Reproductive Medicine (r ASRM stage) score were recorded\u0026nbsp;[16, 17]. Follow-up assessments were performed for patients with endometriosis 1 month after surgery.\u0026nbsp;Patients were questioned verbally during the preoperative and postoperative periods to evaluate endometriosis-related pelvic pain including dyspareunia, deep dysmenorrhea, and non-cyclic pelvic pain.\u0026nbsp;Patients\u0026apos; pain degree was measured using a verbal rating scale (VRS) with 6 pain intensity descriptors defined as \u0026quot;no pain\u0026quot;, \u0026quot;mild\u0026quot;, \u0026quot;disturbing\u0026quot;, \u0026quot;distressing\u0026quot;, \u0026quot;terrible\u0026quot;, and \u0026quot;unbearable\u0026quot;\u0026nbsp;[18]. Fasting venous blood samples at the\u0026nbsp;phase of the menstrual cycle\u0026nbsp;were collected from each participant into 10 ml Vacuette K\u003csub\u003e2\u003c/sub\u003eEDTA tubes (BD, Franklin Lakes, NJ, USA) before surgery for both groups and at 1st month after operation for the endometriosis group.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eTotal RNA isolation from peripheral blood and determination of RNA quality\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePeripheral blood was collected from the patients in a 10 ml EDTA tube and transported to the laboratory by cold transport within 4 h at the latest, and leukocyte separation was performed. Blood in a 10 ml EDTA tube was transferred to a 50 ml falcon tube. Gey\u0026apos;s aolution was added to double the amount of blood on top of the transferred blood. The thoroughly mixed tubes were kept in a refrigerator at +4\u0026deg;C for 20 min. The mixture was centrifuged at 1500 rpm for 10 min at room temperature. The supernatant was removed, and the precipitated pellet was dispersed. Equal volume of 1X Gey\u0026apos;s solution was added to the pellet and centrifuged at 1500 rpm for 10 min at room temperature. After the supernatant was removed and the pellet was dispersed, 1 ml of 1X PBS was added. The mixture was centrifuged at 1500 rpm for 5 min at room temperature, and the supernatant was removed. The pellet was homogenized with 800 \u0026mu;l of TRIzol solution on ice in a fume hood. Subsequently, 200 \u0026mu;L of pre-chilled (+4\u0026deg;C) chloroform was added to the homogenized leukocyte samples. The mixture was vortexed for 15 s and then incubated on ice for 2 min. Subsequently, the samples were centrifuged at 12,000 x g for 20 min at +4\u0026deg;C. The resulting aqueous phase was carefully transferred to a new tube. An equal volume of pre-chilled (+4\u0026deg;C) 100% isopropanol was added, and the mixture was gently mixed. The total RNA isolated from the leukocytes was stored at -80\u0026deg;C for further use. A NanoDrop 2000 (Thermo Scientific\u0026trade;, USA) was used to determine the concentration of total RNAs isolated from blood and to check for protein and chemical contamination. RNA concentration measurements with a ratio of A260 nm / A280 nm measured by taking 1 \u0026mu;l sample in the range of 1.8-2.0 were considered to be of good quality and included in subsequent studies.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003ecDNA Expression\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ecDNA samples were synthesized using the BIORAD iScript \u0026trade; cDNA Synthesis Kit. Total RNA samples obtained from leukocytes and stored at -80\u0026deg;C were thawed on ice prior to use. The concentrations were adjusted to 100 ng/\u0026mu;l using RNase-free water.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eQuantitative real-time PCR\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSYBR Green (BIORAD) kit was used to determine the expression levels of selected lncRNA candidates by quantitative simultaneous polymerase chain reaction (qRT-PCR). \u0026beta;-actin was used as the endogenous gene to normalize the expression levels of these lncRNA candidates. The primer sequences used in this study are as follows\u003cem\u003e: BAT5\u003c/em\u003e forward primer ATTCCAGCTCCTGGGTTACTTG and reverse primer TCCGATGTGTTGCTTCCAAGA, \u003cem\u003eMALAT1\u003c/em\u003e forward primer GAATTGCGTCATTTAAAGCCTAGTT and reverse primer GTTTCATCCTACCACTCCCAATTAAT, \u003cem\u003eUBOX5\u003c/em\u003e forward primer TGACAAGCAAGACCCAAGGA and reverse primer CAGAGTTAGGCAGGCATTTCA, and \u003cem\u003eACTB\u003c/em\u003e (\u0026beta;-actin) forward primer GACCCAGATCATGTTTGAGACC and reverse primer TGGTGGTGAAGCTGTAGCC. The study protocol was designed on the LightCycler 480 device according to the kit used.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eDetermination of lncRNA expression levels by relative quantitation\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter the PCR program was terminated in the LC480 device, the melting curves (Tm calling) and amplification curves of the samples were checked with the LC480 software, and the Ct values were determined using the \u0026quot;Release Absolute Quantification/2nd Derivative Max\u0026quot; analysis. The Ct values obtained from RT-PCR with duplicate samples were checked. Those repeated twice and having a Ct value of of \u0026ge; 40 were not included in the calculations. The Ct value of each sample was subtracted from the Ct values of the endogenous control genes to obtain the \u0026Delta;Ct values. The average \u0026Delta;Ct values of the control group obtained using this method were used as a calibrator. To calculate the \u0026Delta;\u0026Delta;Ct values, the \u0026Delta;Ct values of the control group, selected as the calibrator, were subtracted from the obtained \u0026Delta;Ct values. The \u0026Delta;\u0026Delta;Ct values of the samples studied in pairs obtained by this calculation were averaged. The relative expression of the target lncRNAs in patient samples was compared to that of the calibrator, and the results were expressed as relative quantification (RQ) values. The RQ value was calculated using the 2^-(mean \u0026Delta;\u0026Delta;Ct value) formulation. Spearman\u0026apos;s rank correlation coefficient was performed to calculate the correlation between RQ values and continuous variables in each group.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eStatistical analyses\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe expression levels (RQ values) of lncRNAs in the endometriosis, follow-up, and control groups were compared. The expression levels of lncRNAs in the study groups and the normality of continuous variables in clinical data were analyzed using the \u0026quot;Shapiro-Wilk\u0026quot; test, and it was determined that the data did not fit the normal distribution with 95% confidence. Therefore, the lncRNA expression levels were evaluated between groups using the Mann-Whitney U test. Continuous variables conforming to the normal distribution in clinical data were evaluated statistically using the Student\u0026rsquo;s t-test, and categorical variables were evaluated statistically using the X\u003csup\u003e2\u003c/sup\u003e test. Analysis of covariance (ANCOVA) was used to control for the confounding variables. To determine the diagnostic significance of expression levels of the lncRNAs in leukocytes for endometriosis, their sensitivity and specificity were examined using receiver operating characteristic (ROC) curve analysis. An area under the ROC curve (AUC) between 0.5 and 1 is considered to have diagnostic significance. SPSS software (version 20.0, Chicago, IL, USA) was used for statistical analysis, and p\u0026lt;0.05 was considered significant. Power and sample size calculations were performed using G*Power statistical software [19].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn this study, the power analysis (\u0026alpha;=0.05) with independent Mann-Whitney U test (effect size, d= 0.75) was calculated as 88% in sample size (n=27) for the two groups.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003e\u003cem\u003eBaseline characteristics\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e28 endometriosis patients and 27 control subjects were included in the study.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eEight out of 28 patients with endometriosis were lost to the follow-up, while 20 women were evaluated at 1 month after surgery. The median age of the endometriosis group was 37.68 \u0026plusmn; 8.04 and 39.44 \u0026plusmn; 6.68 for the control group (p=0.500). The clinical and biochemical characteristics of the study groups are presented in Table 1.\u0026nbsp;There were no significant differences in age, parity, BMI, smoking status, or deep dyspareunia VRS scores\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003ebetween the endometriosis and control groups (p \u0026gt; 0.05). As expected, the dysmenorrhea VRS score, non-cyclic pelvic pain VRS score, and serum CA 125 level were significantly higher in the endometriosis group than those in the control group (p \u0026lt; 0.05). \u0026nbsp;When we looked at the intraoperative findings\u003cstrong\u003e,\u0026nbsp;\u003c/strong\u003eaccording to the rASRM classification, 96.4% (n=27) of patients with endometriosis were in stage III-IV, while only one (3.6%) was diagnosed in stage I-II. In addition, while 53.6% (n=15) of the patients diagnosed with endometriosis had peritoneal endometriosis lesions, 60.7% (n=17) had deep endometriosis. While 23 (82.1%) patients with endometriosis had endometriomas bilaterally, the mean diameter of endometriomas was 6.18 \u0026plusmn; 2.89. A comparison of the preoperative and postoperative clinical and biochemical parameters of patients with endometriosis is shown in Table 2. The VRS scores for dyspareunia and dysmenorrhea were lower in the endometriosis group after surgery than before surgery (p=0.017; p=0.0001). However, the non-cyclic pelvic pain VRS score was not significantly different between the preoperative and postoperative periods (p= 0.076). Before surgery, dysmenorrhea, dyspareunia, and non-cyclic pelvic pain symptoms in women with endometriosis were 85.7%, 39.3%, and 64.3%, respectively. One month after surgery, these values decreased to 0%, %0, and 30%, respectively.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eExpression profile of circulating\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003elncRNAs BAT5, MALAT1, and UBOX5\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe expression levels of lncRNAs\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cem\u003eBAT5\u003c/em\u003e, \u003cem\u003eMALAT1\u003c/em\u003e, and \u003cem\u003eUBOX5\u003c/em\u003e in circulating leukocytes among the study groups were presented in Table 3 and Figure 1. \u0026nbsp;Preoperative expression level of \u003cstrong\u003e\u003cem\u003eBAT5\u0026nbsp;\u003c/em\u003e\u003c/strong\u003ein the endometriosis group (9.26 \u0026plusmn; 16.02) was higher than in the control group (3.06 \u0026plusmn; 4.28), showing a 3-fold increase; however, this difference was not statistically significant (\u003cem\u003ep\u003c/em\u003e=0.103). Preoperative\u003cstrong\u003e\u003cem\u003e\u0026nbsp;MALAT1\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eexpression level was found to be significantly upregulated in the endometriosis group (44.33 \u0026plusmn; 83.15) compared to the control group (10.30 \u0026plusmn; 19.76), with a 4.3-fold increase (\u003cem\u003ep\u003c/em\u003e=0.005). In contrast, preoperative\u003cstrong\u003e\u003cem\u003e\u0026nbsp;UBOX5\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eexpression level was significantly lower in the endometriosis group (13.92 \u0026plusmn; 17.44) compared to the control group (15.09 \u0026plusmn; 36.29), showing a \u003cstrong\u003e1.08-fold decrease\u003c/strong\u003e (\u003cem\u003ep\u003c/em\u003e=0.029). Furthermore, postoperative \u003cstrong\u003e\u003cem\u003eBAT5\u003c/em\u003e\u003c/strong\u003e expression level was not found to be significantly different between the endometriosis group (4.46 \u0026plusmn; 10.17) and the control group (3.06 \u0026plusmn; 4.28) (p=0.239). \u0026nbsp;\u003cstrong\u003e\u003cem\u003eBAT5\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eexpression level showed a decrease at 1 month after surgery (4.46 \u0026plusmn; 10.17) compared to the pre-operative levels (9.26 \u0026plusmn; 16.02), though neither change was statistically significant (p = 0.414). Similarly, \u003cstrong\u003e\u003cem\u003eMALAT1\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eexpression level remained higher at 1 month after surgery in the endometriosis group (16.77 \u0026plusmn; 34.17) than in the control group (10.30 \u0026plusmn; 19.76); though neither change was statistically significant (p = 0.244).\u003cstrong\u003e\u0026nbsp;There was a significant drop in \u003cem\u003eMALAT1\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eexpression levels (16.77 \u0026plusmn; 34.17)\u003cstrong\u003e\u0026nbsp;\u003cstrong\u003eat 1 month after surgery compared to the levels in before surgery (44.33 \u0026plusmn; 83.15) (p = 0.048). In addition, \u003cem\u003eUBOX5\u003c/em\u003e\u003c/strong\u003e\u003c/strong\u003e expression level (28.17 \u0026plusmn; 67.31) increased in the postoperative period (28.17 \u0026plusmn; 67.31) compared to both the control group (15.09 \u0026plusmn; 36.29) and the preoperative levels (13.92 \u0026plusmn; 17.44), (p = 0.112), (p = 0.594) respectively; but also, these differences were not statistically significant.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eROC analysis\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eROC analysis for serum CA 125, \u003cem\u003eMALAT1\u003c/em\u003e and \u003cem\u003eUBOX5\u003c/em\u003e lncRNAs in circulating leukocytes between patients with endometriosis and controls were shown in Table 4 and Figure 2. \u0026nbsp;The AUC of the expression ratio of preoperative CA 125, \u003cem\u003eMALAT1\u003c/em\u003e and \u003cem\u003eUBOX5\u003c/em\u003e were 0.84 (95% CI: 0.73-0.95), 0.70 (95% CI: 0.56-0.85), 0.66 (95% CI: 0.50-0.82), respectively; with cut-off 23.27 and 5.83, 4.37, respectively; sensitivity of 80.8%, 62.5% and 54.2%, specificity of 75.0 % and 71.0%, 91.0% respectively (Table 4 and Figure 2).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eCorrelation analysis between clinical parameters and the expression levels of lncRNAs in the study groups\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe correlation analysis was done to identify the associations of clinical parameters and lncRNAs\u0026nbsp;\u003cem\u003eBAT5\u003c/em\u003e, \u003cem\u003eMALAT1\u003c/em\u003e, and \u003cem\u003eUBOX5\u003c/em\u003e. There was a positive correlation between preoperative \u003cem\u003eBAT5\u0026nbsp;\u003c/em\u003eexpression and serum\u0026nbsp;CA 19-9 level (r = 0.422; p = 0.036).\u0026nbsp;Thrombocyte count was found to be negatively associated with preoperative \u003cem\u003eUBOX5\u0026nbsp;\u003c/em\u003eexpression\u003cstrong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e(r = -0.487; p = 0.010).\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eNo correlations were observed with the other clinical features (data not shown).\u0026nbsp;\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eOur study is based on the hypothesis that the expression levels of selected candidate lncRNAs in leukocytes of endometriosis patients, based on the findings of studies investigating the molecular etiopathogenesis of endometriosis, may have a predictive effect on disease diagnosis and follow-up. We examined lncRNAs \u003cem\u003eBAT5, MALAT1,\u0026nbsp;\u003c/em\u003eand \u003cem\u003eUBOX5\u003c/em\u003e in the peripheral blood leukocytes of women with endometriosis, compared to the controls before surgery and at 1 month after surgery. We showed that preoperative \u003cem\u003eMALAT1\u0026nbsp;\u003c/em\u003eexpression level was significantly upregulated and \u003cstrong\u003e\u003cem\u003eUBOX5\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eexpression level was downregulated in the endometriosis group compared to the control group. On the other hand, preoperative and postoperative \u003cstrong\u003e\u003cem\u003eBAT5\u0026nbsp;\u003c/em\u003e\u003c/strong\u003eexpression levels were not found to be significantly different between the endometriosis group and the controls. No significant difference in \u003cem\u003eBAT5\u003c/em\u003e expression levels was observed between the preoperative and postoperative periods whereas \u003cstrong\u003e\u003cem\u003eMALAT1\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003eexpression level showed a significant drop at 1 month after surgery compared to the preoperative levels. In addition, we observed no\u003c/strong\u003e significant difference in\u003cstrong\u003e\u0026nbsp;\u003cem\u003eUBOX5\u003c/em\u003e\u003c/strong\u003e expression level in the postoperative period compared to both the control group and the preoperative levels. \u0026nbsp;According to ROC analysis, serum CA 125 level demonstrated good diagnostic performance, while \u003cem\u003eMALAT1\u003c/em\u003e showed moderate diagnostic accuracy. Moreover, we found that \u003cem\u003eBAT5\u0026nbsp;\u003c/em\u003eexpression level was positively correlated with serum CA 19-9 level and thrombocyte count was negatively associated with the preoperative \u003cem\u003eUBOX5\u0026nbsp;\u003c/em\u003eexpression level.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; LncRNAs have been reported to control various aspects of cellular processes, including cell proliferation, apoptosis, differentiation, angiogenesis, and immune functions [20]. Because lncRNAs generally form highly stable secondary structures, their quantitative detection is possible. These properties suggest that lncRNAs may not only be potential biomarkers for clinical diagnosis of the disease but also important factors in disease development \u0026nbsp; [21]. Cui et al. \u0026nbsp;identified 86 differentially expressed lncRNAs and 1,228 differentially expressed mRNAs in eutopic endometrial tissues of 17 ovarian endometriosis patients compared with normal endometrial tissues from 17 patients without visible endometriosis [22]. Pathway analysis and gene ontology analysis showed that lncRNAs are involved in biological processes and signaling pathways that play a role in the development of endometriosis, such as proliferation, adhesion, migration, angiogenesis, steroidogenesis, and notch signaling [23].\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eUBOX5\u003c/em\u003e is a gene that codes for proteins. The innate immune system and class I MHC-mediated antigen processing and presentation are two of its associated mechanisms [24].\u003cstrong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003eConsidering the fact that endometriosis is chronic inflammatory disease, there are a few studies in the literature examining lncRNA \u003cem\u003eUBOX5\u003c/em\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eexpression levels\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003ein endometriosis [13, 25].\u003cstrong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003eIt is known that hypoxia is a key feature, linked to the spread of endometrial cells through a process called epithelial-mesenchymal transition (EMT). Liu et al. reported that in ectopic endometrium, hypoxia-inducible factor-1\u0026alpha; (HIF-1\u0026alpha;) can accelerate upregulation of the expression of lncRNA \u003cem\u003eUBOX\u003c/em\u003e antisense RNA 1 (UBOX5-AS1), promote EMT, and give rise to the occurrence and progression of endometriosis [13, 26]. The authors of the study proposed that upregulated expression of the lncRNA \u003cem\u003eUBOX5-AS1\u003c/em\u003e is essential for regulating the hypoxia-regulated EMT and endometriosis\u0026apos;s invasiveness, indicating that lncRNA \u003cem\u003eUBOX5-AS1\u003c/em\u003e may be an important possible endometriosis treatment target [13]. Furthermore, a recent study showed that lncRNA UBOX5-AS1 expression was significantly increased in ovarian endometriotic tissue and primary ectopic endometrial stromal cells. They also found that expression of lncRNA \u003cem\u003eUBOX5-AS1\u003c/em\u003e was significantly positively correlated with demethylase Alk B homologous protein 5 (ALKBH5) expression and autophagy contributing to the progression of ovarian endometriosis [25]. In our study, we observed a significant decrease in preoperative \u003cem\u003eUBOX5\u003c/em\u003e expression levels in endometriosis patients compared to the control group. Moreover, our results are important in showing that, this significant decrease lost its relevance as \u003cem\u003eUBOX5\u003c/em\u003e expression levels increased beyond the control group in 1-month follow-up, and from another perspective, the expression levels reached similar values to those of the control group marking a novel aspect in the literature. Our findings also indicated that a negative association between thrombocyte count and preoperative \u003cem\u003eUBOX5\u0026nbsp;\u003c/em\u003eexpression levels. Our results contradict the findings of previous studies. In fact, a possible reason for this could be that lncRNA levels in tissue may not always match those in blood leukocytes. Factors such as the timing of blood sampling, disease stage, and sampling methods may also contribute to variations in \u003cem\u003eUBOX5\u0026nbsp;\u003c/em\u003eexpression levels.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eMALAT1\u0026nbsp;\u003c/em\u003eencodes an 8.7-kb exonic transcript that exhibits high transcription levels in a variety of tissues, including the heart, kidney, and brain and is shown to be linked to the production of pro-inflammatory cytokines [27].\u003cem\u003e\u0026nbsp;\u003c/em\u003eA review of the literature on \u003cem\u003eMALAT1\u003c/em\u003e revealed several key findings related to its role in endometriosis [26].\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eYu et al. demonstrated that \u003cem\u003eMALAT1\u003c/em\u003e levels were significantly higher in ectopic endometrium compared to the controls, and highlighted its role in facilitating endometrial cell apoptosis via the NF-\u0026kappa;B/iNOS signaling pathway. This pathway modulates MMP-9 expression, which in turn suppresses endometrial cell proliferation and invasion. The NF-\u0026kappa;B/iNOS signaling pathway is crucial for inflammation and immune responses, while MMP-9 is involved in various physiological processes, including cell proliferation and migration. \u003cem\u003eMALAT1\u003c/em\u003e has been shown to downregulate the NF-\u0026kappa;B/iNOS pathway, further inhibiting MMP-9 expression and contributing to endometriosis progression [28-31]. Similarly, our findings suggested that preoperative \u003cem\u003eMALAT1\u003c/em\u003e expression level was significantly upregulated in the endometriosis group compared to the control group. Also, t\u003cstrong\u003ehere was a significant drop in MALAT1\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eexpression levels \u003cstrong\u003eat one month after surgery compared to before surgery.\u0026nbsp;\u003c/strong\u003eAccording to ROC analysis, \u003cem\u003eMALAT1\u003c/em\u003e showed moderate diagnostic accuracy. Furthermore, Feng et al. found that loss of \u003cem\u003eMALAT1\u0026nbsp;\u003c/em\u003epromoted apoptosis of human endometrial stromal cells (HESCs) probably through miR-126-5p/CREB1 axis mediated PI3K/AKT pathway contributing the development of endometriosis [32]. In this concept, Li et al. showed that the expression level of \u003cem\u003eMALAT1\u003c/em\u003e was significantly reduced in endometriosis granulosa cells (GCs) compared to the controls. Also, \u003cem\u003eMALAT1\u003c/em\u003e lncRNA levels were significantly lower in the GCs of infertile endometriosis patients wih advanced stage [33].\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eOn the other hand, in a recent study by Szaflik et al. reported no significant difference in the expression of \u003cem\u003eMALAT1\u003c/em\u003e in ectopic endometrium compared to the normal endometrium [34]. Although current studies showed contradictive results, overall, findings from the recent reports emphasize the significant role of \u003cem\u003eMALAT1\u003c/em\u003e in the pathogenesis of endometriosis, particularly through its inflammatory effects. Our findings indicated that \u003cem\u003eMALAT1\u0026nbsp;\u003c/em\u003eexpression in blood leukocytes may serve as a biomarker for diagnosis and monitoring the disease.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eBAT5\u003c/em\u003e is located within the gene cluster of the human major histocompatibility complex (MHC) class III, suggesting a potential role in the immune system [35]. Cai et al. were the first to identify BAT5 as a long non-coding RNA (lncRNA) in a microarray-based expression profiling study, showing that its expression in peripheral blood mononuclear cells was twofold higher in patients with coronary artery disease compared to healthy controls [36]. Therefore, it is suggested that patients with myocardial infarction are associated with decreased monocytes \u003cem\u003eBAT5\u003c/em\u003e expression levels in leukocytes compared with controls and may have an impact on myocardial infarction pathogenesis in the acute phase [37]. To the best of our knowledge, no studies have investigated circulating BAT5 expression levels in women with endometriosis. We made a hypothesis that the observed direction of change in leukocytes aligns with previously reported findings in monocytes, suggesting that \u003cem\u003eBAT5\u003c/em\u003e may be involved in the inflammatory processes of endometriosis, similar to its role in coronary artery disease. Therefore, in our study, we observed no significant difference in preoperative and postoperative \u003cstrong\u003e\u003cem\u003eBAT5\u0026nbsp;\u003c/em\u003e\u003c/strong\u003eexpression levels between the endometriosis group and the controls. Moreover, there was no significant difference in \u003cstrong\u003e\u003cem\u003eBAT5\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eexpression level between the preoperative levels and postoperative levels. We found that \u003cem\u003eBAT5\u0026nbsp;\u003c/em\u003eexpression level was positively correlated with serum CA 19-9 level. From this standpoint, studies from the literature indicated that serum CA19-9 levels were significantly increased in endometriosis patients compared to the controls and were associated with the endometriosis severity [38]. Finally, the lack of change in \u003cstrong\u003e\u003cem\u003eBAT5\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eexpression in blood leucocytes could be attributed to cell type-specific expression, post-transcriptional regulation, or technical factors. Further research is needed to better understand these mechanisms.\u003c/p\u003e\n\u003cp\u003eA key strength of our research lies within the fact that comparison of lncRNA \u003cem\u003eBAT5, MALAT1\u003c/em\u003e, and \u003cem\u003eUBOX5\u0026nbsp;\u003c/em\u003eexpression levels in women with endometriosis before surgery and at 1 month after surgery. Considering that lncRNAs may serve as potential biomarkers for endometriosis, their expression levels are expected to change after endometriosis surgery, particularly during the early postoperative period. On the other hand, given that endometriosis is a chronic inflammatory disease, this study is the first to reveal the expression of lncRNAs in blood leukocytes from women. \u0026nbsp;Meanwhile, there are several limitations of our study. Endometriosis surgeries are performed by several expert surgeons; it would be better if all surgeries were done by the same surgeon. Another limitation is the endometriotic tissue expression levels of lncRNAs were not examined in our study. It is needed to know that the correlation between the tissue and blood expression levels of lncRNAs which expands our understanding of the pathogenesis of endometriosis. Lastly, our analysis was limited to lncRNA expression during the early postoperative period. Therefore, we recommend investigating the comparison of expression levels of lncRNAs between the preoperative and late postoperative periods to provide a bridging gap in understanding of endometriosis pathophysiology.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTo the best of our knowledge, this is the first study of exploring the expression profile of blood leucocyte lncRNAs\u003cem\u003e\u0026nbsp;UBOX5, MALAT1\u003c/em\u003e, and \u003cem\u003eBAT5\u003c/em\u003e in women with endometriosis compared to the controls before surgery and at 1 month after surgery. Our study findings revealed that expression of lncRNA MALAT1 and \u003cem\u003eUBOX5\u003c/em\u003e seems to be contributed to the pathogenesis of endometriosis, potentially through its involvement in inflammation. Moreover, \u003cem\u003eMALAT1\u003c/em\u003e may serve as a promising biomarker for the diagnosis and monitoring of endometriosis. \u0026nbsp;The data obtained in our study may enrich the limited literature on \u003cem\u003eBAT5\u003c/em\u003e lncRNA. Further studies are necessary to support our findings and to clarify the roles of these lncRNAs in the molecular pathogenesis of endometriosis.\u0026nbsp;\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eDATA AVAILABILITY\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData will be made available on request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eProject development: MH, HA, AT, NT, EB; Performed the experiments: HA, AK, EB Analyzed the data: HA, MH, İK, EB; Data collection or management: HA, MH, İK, E\u0026Ouml;, AK, NT, EB; Contributed reagents/ materials/analysis tools: HA, MH, İK, E\u0026Ouml;, AK, NT, EB, HA, AK; Wrote the manuscript: HA, MH, EB; Final edit of paper: HA, MH, EB, İK, E\u0026Ouml;, AK, NT, AT. All authors read and approved the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical Approval:\u0026nbsp;\u003c/strong\u003eThis study has been approved by Ethics Committee of the Istanbul Medical Faculty, Istanbul.\u003c/p\u003e\n\u003cp\u003eUniversity, Istanbul, Turkey (2018/1519). All research subjects have signed informed consent to participate and publish. This study was performed in accordance with the ethical standards in the Declaration of Helsinki (2013).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u003c/strong\u003e The work was supported by the Scientific Research Projects Coordination Unit of Istanbul University, Turkey [Project numbers: TYL2017-27357 and 28473].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest:\u003c/strong\u003e The authors declare that they have no conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of generative AI\u003c/strong\u003e: The authors declare that there is no use of generative AI and AI-assisted technologies.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eMoustafa S, Burn M, Mamillapalli R, Nematian S, Flores V, Taylor HS (2020) Accurate diagnosis of endometriosis using serum microRNAs. Am J Obstet Gynecol 223:557 e1-557. e11\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eArafah M, Rashid S, Akhtar M (2021) Endometriosis: a comprehensive review. Adv Anat Pathol 28:30\u0026ndash;43\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVercellini P, Vigan\u0026ograve; P, Somigliana E, Fedele L (2014) Endometriosis: pathogenesis and treatment. Nat Reviews Endocrinol 10:261\u0026ndash;275\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMalvezzi H, Marengo EB, Podgaec S, Piccinato CA (2020) Endometriosis: current challenges in modeling a multifactorial disease of unknown etiology. J translational Med 18:311\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSaunders PT, Horne AW (2021) Endometriosis: Etiology, pathobiology, and therapeutic prospects. Cell 184:2807\u0026ndash;2824\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYan W, Hu H, Tang B (2020) Progress in understanding the relationship between long noncoding RNA and endometriosis. Eur J Obstet Gynecol reproductive biology: X 5:100067\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLa Ferlita A, Battaglia R, Andronico F, Caruso S, Cianci A, Purrello M, Di Pietro C (2018) Non-coding RNAs in endometrial physiopathology. Int J Mol Sci 19:2120\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang Y, Li Y, Yang Z, Liu K, Wang D (2015) Genome-wide microarray analysis of long non-coding RNAs in eutopic secretory endometrium with endometriosis. Cell Physiol Biochem 37:2231\u0026ndash;2245\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMarques-Rocha JL, Samblas M, Milagro FI, Bressan J, Mart\u0026iacute;nez JA, Marti A (2015) Noncoding RNAs, cytokines, and inflammation‐related diseases. FASEB J 29:3595\u0026ndash;3611\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePanir K, Schjenken JE, Robertson SA, Hull ML (2018) Non-coding RNAs in endometriosis: a narrative review. Hum Reprod Update 24:497\u0026ndash;515\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGhazal S, McKinnon B, Zhou J, Mueller M, Men Y, Yang (2015) L H19 lncRNA alters stromal cell growth via IGF signaling in the endometrium of women with endometriosis. EMBO Mol Med 7(8):996\u0026ndash;1003\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiang Z, Chen Y, Zhao Y, Xu C, Zhang A, Zhang Q, Wang D, He J, Hua W, Duan P (2017) miR-200c suppresses endometriosis by targeting MALAT1 in vitro and in vivo. Stem Cell Res Ther 8:251\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu H, He H, Zhang Z, Wang L, Zhang L, Liu Y, Xiong W (2021) Upregulation of the long noncoding RNA UBOX5 antisense RNA 1 (UBOX5-AS1) under hypoxic conditions promotes epithelial-mesenchymal transition in endometriosis. Annals Translational Med 9:790\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi W-N, Wu M-H, Tsai S-J (2021) Hypoxia and reproductive health: the role of hypoxia in the development and progression of endometriosis. Reproduction 161:F19\u0026ndash;F31\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCai Y, Yang Y, Chen X, Wu G, Zhang X, Liu Y, Yu J, Wang X, Fu J, Li C (2016) Circulating \u0026lsquo;lncRNA OTTHUMT00000387022\u0026rsquo;from monocytes as a novel biomarker for coronary artery disease. Cardiovascular Res 112:714\u0026ndash;724\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCanis M, Donnez JG, Guzick DS, Halme JK, Rock JA, Schenken RS, Vernon MW (1997) Revised american society for reproductive medicine classification of endometriosis: 1996. Fertil Steril 67:817\u0026ndash;821\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBandini V, Giola F, Ambruoso D, Cipriani S, Chiaffarino F, Vercellini P (2024) The natural evolution of untreated deep endometriosis and the effect of hormonal suppression: A systematic literature review and meta-analysis. Acta Obstet Gynecol Scand 103:1722\u0026ndash;1735\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMelzack R (1975) The McGill Pain Questionnaire: major properties and scoring methods. Pain 1:277\u0026ndash;299\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFaul F, Erdfelder E, Lang A-G, Buchner A (2007) G* Power 3: A flexible statistical power analysis program for the social, behavioral, and biomedical sciences. Behav Res Methods 39:175\u0026ndash;191\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang H, Sha L, Huang L, Yang S, Zhou Q, Luo X, Shi B (2019) LINC00261 functions as a competing endogenous RNA to regulate BCL2L11 expression by sponging miR-132-3p in endometriosis. Am J Translational Res 11:2269\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang W-T, Sun Y-M, Huang W, He B, Zhao Y-N, Chen Y-Q (2016) Genome-wide long non-coding RNA analysis identified circulating LncRNAs as novel non-invasive diagnostic biomarkers for gynecological disease. Sci Rep 6:23343\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCui D, Ma J, Liu Y, Lin K, Jiang X, Qu Y, Lin J, Xu K (2018) Analysis of long non-coding RNA expression profiles using RNA sequencing in ovarian endometriosis. Gene 673:140\u0026ndash;148\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHudson QJ, Proestling K, Perricos A, Kuessel L, Husslein H, Wenzl R, Yotova I (2021) The role of long non-coding RNAs in endometriosis. Int J Mol Sci 22:11425\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang Y-M, Meng L-B, Yu S-J, Ma D-X (2020) Identification of potential crucial genes in monocytes for atherosclerosis using bioinformatics analysis. J Int Med Res 48:0300060520909277\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu H, Liang J, Wang X, Xiong W, Zhang L, Dai X, Wang X, Wang X, Xu Y, Liu Y (2025) ALKBH5 promotes autophagy and progression by mediating m6A methylation of lncRNA UBOX5-AS1 in endometriosis. Am J Physiology-Cell Physiol 328:C639\u0026ndash;C656\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu Y, Zhang W, Jin L, Ren J, Liu Z, Lu D (2023) The role of long noncoding RNAs in endometriosis progression. Front Bioscience-Landmark 28:109\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGordon AD, Biswas S, Feng B, Chakrabarti S (2018) MALAT1: a regulator of inflammatory cytokines in diabetic complications. Endocrinol diabetes metabolism 1:e00010\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTano K, Mizuno R, Okada T, Rakwal R, Shibato J, Masuo Y, Ijiri K, Akimitsu N (2010) MALAT-1 enhances cell motility of lung adenocarcinoma cells by influencing the expression of motility-related genes. FEBS Lett 584:4575\u0026ndash;4580\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi X, Song Y, Liu F, Liu D, Miao H, Ren J, Xu J, Ding L, Hu Y, Wang Z (2017) Long non-coding RNA MALAT1 promotes proliferation, angiogenesis, and immunosuppressive properties of mesenchymal stem cells by inducing VEGF and IDO. J Cell Biochem 118:2780\u0026ndash;2791\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang X, Hamblin MH, Yin K-J (2017) The long noncoding RNA Malat1: Its physiological and pathophysiological functions. RNA Biol 14:1705\u0026ndash;1714\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYu J, Chen LH, Zhang B, Zheng QM (2019) The modulation of endometriosis by lncRNA MALAT1 via NF-κB/iNOS. Eur Rev Med Pharmacol Sci 23:4073\u0026ndash;4080. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.26355/eurrev_201905_17908\u003c/span\u003e\u003cspan address=\"10.26355/eurrev_201905_17908\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFeng Y, Tan BZ (2020) LncRNA MALAT1 inhibits apoptosis of endometrial stromal cells through miR-126-5p-CREB1 axis by activating PI3K-AKT pathway. Mol Cell Biochem 475:185\u0026ndash;194. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s11010-020-03871-y\u003c/span\u003e\u003cspan address=\"10.1007/s11010-020-03871-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi Y, Liu YD, Chen SL, Chen X, Ye DS, Zhou XY, Zhe J, Zhang J (2019) Down-regulation of long non-coding RNA MALAT1 inhibits granulosa cell proliferation in endometriosis by up-regulating P21 via activation of the ERK/MAPK pathway. Mol Hum Reprod 25:17\u0026ndash;29. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/molehr/gay045\u003c/span\u003e\u003cspan address=\"10.1093/molehr/gay045\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSzaflik T, Romanowicz H, Szyłło K, Kołaciński R, Michalska MM, Samulak D, Smolarz B (2022) Analysis of Long Non-Coding RNA (lncRNA) UCA1, MALAT1, TC0101441, and H19 Expression in Endometriosis. Int J Mol Sci 23. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms231911583\u003c/span\u003e\u003cspan address=\"10.3390/ijms231911583\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFontanesi L, Galimberti G, Cal\u0026ograve; DG, Fronza R, Martelli PL, Scotti E, Colombo M, Schiavo G, Casadio R, Buttazzoni L, Russo V (2012) Identification and association analysis of several hundred single nucleotide polymorphisms within candidate genes for back fat thickness in Italian Large White pigs using a selective genotyping approach. J Anim Sci 90:2450\u0026ndash;2464. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.2527/jas.2011-4797\u003c/span\u003e\u003cspan address=\"10.2527/jas.2011-4797\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCai Y, Yang Y, Chen X, Wu G, Zhang X, Liu Y, Yu J, Wang X, Fu J, Li C, Jose PA, Zeng C, Zhou L (2016) Circulating 'lncRNA OTTHUMT00000387022' from monocytes as a novel biomarker for coronary artery disease. Cardiovasc Res 112:714\u0026ndash;724. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/cvr/cvw022\u003c/span\u003e\u003cspan address=\"10.1093/cvr/cvw022\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSenturk H, Karaayvaz EB, Oksen D, Yildiz M, Yildiz CE, Gedikbasi A, Komurcu-Bayrak E (2023) The Importance of Decreased Expression Levels of BAT5 and IL21R-AS1 in Circulating Leukocytes of Patients with Acute Myocardial Infarction. Authorea Preprints\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShuang T, Wang Y, Zhao L, Zhang K, Yin P, Guo L, Jing W, Feng X, Li Q (2022) Extremely high serum CA19-9 level along with elevated D-dimer in assisting detection of ruptured ovarian endometriosis. Ann Med 54:1444\u0026ndash;1451\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003eTables 1 to 4 are available in the Supplementary Files section.\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Endometriosis, long non-coding RNAs, BAT5, MALAT1, UBOX5, inflammation","lastPublishedDoi":"10.21203/rs.3.rs-8011405/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8011405/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e\u003cp\u003eGiven the potential roles of long non-coding RNAs lncRNAs in endometriosis pathogenesis and inflammation, based on the existing literature, we aimed investigate expression of lncRNAs \u003cem\u003eBAT5\u003c/em\u003e, \u003cem\u003eMALAT1\u003c/em\u003e, and \u003cem\u003eUBOX5\u003c/em\u003e in the blood leukocytes of women with endometriosis before surgery and at 1 month after surgery.\u003c/p\u003e\u003ch2\u003eMethods and Results\u003c/h2\u003e\u003cp\u003eThis prospective longitudinal cohort study included women with surgically confirmed endometriosis (n\u0026thinsp;=\u0026thinsp;28),women without endometriosis (n\u0026thinsp;=\u0026thinsp;27), and women with endometriosis who were followed up (n\u0026thinsp;=\u0026thinsp;20).The relative expression levels oflncRNAs \u003cem\u003eBAT5, MALAT1\u003c/em\u003e,and \u003cem\u003eUBOX5\u003c/em\u003e in blood samples from endometriosis patients were determined using real-time quantitative PCR and compared with those of the controls. Preoperative \u003cem\u003eMALAT1\u003c/em\u003e expression was significantly upregulated and \u003cem\u003eUBOX5\u003c/em\u003e \u003cb\u003ee\u003c/b\u003expression was downregulated in the endometriosis group compared to the control group (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.005,p\u0026thinsp;=\u0026thinsp;0.029,respectively). There was a significant drop in \u003cem\u003eMALAT1\u003c/em\u003e expression levels at 1 month after surgery (16.77\u0026thinsp;\u0026plusmn;\u0026thinsp;34.17) compared to the preoperative levels (44.33\u0026thinsp;\u0026plusmn;\u0026thinsp;83.15)(p\u0026thinsp;=\u0026thinsp;0.048).Moreover, we observed no significant difference in postoperative \u003cem\u003eUBOX5\u003c/em\u003e expression levels in the endometriosis group (28.17\u0026thinsp;\u0026plusmn;\u0026thinsp;67.31) compared to both the control group (15.09\u0026thinsp;\u0026plusmn;\u0026thinsp;36.29)and preoperative levels (13.92\u0026thinsp;\u0026plusmn;\u0026thinsp;17.44),(p\u0026thinsp;=\u0026thinsp;0.112;p\u0026thinsp;=\u0026thinsp;0.594,respectively). Preoperative \u003cem\u003eBAT5\u003c/em\u003e expression levels were not significantly different in the endometriosis group (9.26\u0026thinsp;\u0026plusmn;\u0026thinsp;16.02) compared to the controls (3.06\u0026thinsp;\u0026plusmn;\u0026thinsp;4.28) \u003cb\u003e(\u003c/b\u003ep\u0026thinsp;=\u0026thinsp;0.103).The area under the ROC curve of \u003cem\u003eMALAT1\u003c/em\u003e was 0.70, and CA-125 was \u003cem\u003eUBOX5\u003c/em\u003e 0.66. A positive correlation was observed between preoperative \u003cem\u003eBAT5\u003c/em\u003e expression and CA 19\u0026thinsp;\u0026minus;\u0026thinsp;9 level (r\u0026thinsp;=\u0026thinsp;0.422;p\u0026thinsp;=\u0026thinsp;0.036).\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e\u003cp\u003eThis is the first study to reveal that the expression of circulating \u003cem\u003eMALAT1\u003c/em\u003e and \u003cem\u003eUBOX5\u003c/em\u003e may contribute to thepathogenesis of endometriosis, potentially through involvement in inflammation.\u003cem\u003eMALAT1\u003c/em\u003e may serve as a promising biomarker for the diagnosis and monitoring of endometriosis.\u003c/p\u003e","manuscriptTitle":"Identification of long non-coding RNAs BAT5, MALAT1, and UBOX5 in the peripheral blood leukocytes of women with endometriosis before surgery and at 1 month after surgery","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-11-14 11:11:13","doi":"10.21203/rs.3.rs-8011405/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"bbccbb24-a35e-412f-968b-a69831b33d0a","owner":[],"postedDate":"November 14th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-12-15T12:09:06+00:00","versionOfRecord":[],"versionCreatedAt":"2025-11-14 11:11:13","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8011405","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8011405","identity":"rs-8011405","version":["v1"]},"buildId":"B-jG_2CBjPDmsCi4Wdhf-","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}