2-oxoglutarate triggers assembly of active dodecameric Methanosarcina mazei glutamine synthetase

32 Glutamine synthetases (GS) are central enzymes essential for the nitrogen metabolism across all 33 domains of life. Consequently, they have been extensively studied for more than half a century. 34 Based on the ATP dependent ammonium assimilation generating glut amine, GS expression and 35 activity are strictly regulated in all organism s. In the methanogenic archaeon Methanosarcina mazei, 36 it has been shown that the metabolite 2-oxoglutarate (2-OG) directly induces the GS activity. Besides, 37 modulation of the activity by interaction with small proteins (GlnK 1 and sP26) has been reported. 38 Here, we show that the strong activation of M. mazei GS (GlnA1) by 2 -OG is based on the 2 -OG 39 dependent dodecamer assembly of GlnA 1 by using mass photometry (MP) and single particle cryo-40 electron micro scopy (cryo -EM) analysis of purified strep -tagged GlnA 1. The dodecamer assembly 41 from monomers/dimers occurred without any detectable intermediate oligomeric state and was not 42 affected in the presence of GlnK 1. The 2.39 Å cryo-EM structure of the dodecameric complex in the 43 presence of 12.5 mM 2-OG demonstrated that 2 -OG is binding between two monomers . Thereby, 2-44 OG appears to induce the dodecameric assembly in a cooperative way. Furthermore, the active site is 45 primed by an allosteric interaction cascade caused by 2 -OG-binding towards an adaption of the 46 transition state catalytic conformation. In the presence of additional glutamine, strong feedback 47 inhibition of GS activity was ob served. Since glutamine dependent disassembly of the dodecamer 48 was excluded by MP, feedback inhibition most likely relies on an allosteric binding of glutamine to 49 the catalytic site . Based on our findings , we propose that under nitrogen limitation the indu ction of 50 M. mazei GS into a catalytically active dodecamer is not affected by GlnK1 and crucially depends on 51 the presence of 2-OG. 52 53 54 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint

55 Nitrogen is one of the key elements in life and it is essentially required in form of ammonium for 56 biomolecules such as proteins or nucleic acids. Two major pathways of ammonium assimilation in 57 bacteria and archaea are known. Under nitrogen (N) sufficiency glutamate dehydrogenase (GDH) is 58 active and generates glutamate from oxoglutarate and ammonium ( reviewed in van Heeswijk et al., 59 2013). However, under N limitation low ammonium concentration s lead to inactive GDH as a result 60 of its low ammonium affinity, whereas the expression of glutamine synthetase (GS) is strongly 61 induced in response to N limitation (Bolay et al., 2018; Gunka a nd Commichau, 2012; Stadtman, 62 2001). Consequently, under low ammonium conditions GS together with glutamate synthase 63 (GOGAT) are responsible for ammonium assimilation via the GS/GOGAT pathway, one of the major 64 intersections in central carbon and N metabolism. Accordingly, GS present across all domains of life 65 plays a central role in cellular N assimilation under low N availability. The enzyme, its structure and 66 regulation has been investigated in detail in different organisms for more than half a century (e.g. 67 Dos Santos Moreira et al., 2019; Stadtman, 2001; Woolfolk and Stadtman, 1967). 68 Most of the GS are grouped into three major classes based on their monomeric size and 69 oligomerization properties (overview in Dos Santos Moreira et al., 2019) . GSI and GSIII, both found in 70 bacteria and archaea mostly form dodecamers, whereas GSII found in Eukaryotes form decamers of 71 smaller subunits (Dos Santos Moreira et al., 2019; He et al., 2009; Valentine et al., 1968; van Rooyen 72 et al., 2011) . The GSI class can be further grouped into Iα-type GS and Iβ-type GS based on their 73 amino acid sequence and respective molecular mechanisms of activity regulation. Iß-type GS contain 74 a conserved adenylylation site (Tyr397 residue near the active site) that allows for covalent 75 modification of Iβ-type GS and leads to inactivation of the enzyme (Brown et al., 1994; Magasanik, 76 1993; Shapiro and Stadtman, 1970) , wher eas Iα-type GS are not covalently m odified and mainly 77 show feedback inhibition by end products of the glutamine metabolism including glutamine (Fisher, 78 1999; Gunka and Commichau, 2012). 79 GS regulation on transcriptional level 80 Since in contrast to GDH, GS catalyzed generation of glutamine requires ATP, most organisms strictly 81 regulate the expression of GS in response to the nitrogen availability on the transcriptional level. In 82 gram negative bacteria mainly transcriptional activation of the coding gene (glnA) under low nitrogen 83 availability occurs via a transcriptional activator (e.g. NtrC in Escherichia coli (Jiang et al., 1998) ). For 84 several gram positive bacteri a however, the mechanism of regulation is a de -repression of glnA 85 transcription under N limitation, which has also been shown for methanoarchaea (Cohen-Kupiec et 86 al., 1999; Fedorova et al., 2013; Fisher, 1999; Fisher and Wray, 2008; Hauf et al., 2016; Weidenbach 87 et al., 2010, 2008) . Whereas in gram positives the signal perception is complex and often also 88 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint involves protein interactions of GS with transcriptional regulators (reviewed in Gunka and 89 Commichau, 2012) , signal perception and transduction in methanoarchaea occurs directly via the 90 small effector molecule 2-oxoglutarate (2-OG), which increases under N limitation. It has been shown 91 that binding of 2-OG to the global N repressor protein NrpR significantly changes the repressor 92 conformation resulting in dissociation f rom its respective operator (Lie et al., 2007; Weidenbach et 93 al., 2010; Wisedchaisri et al., 2010) . In addition to expression regulation the activity of GS is also 94 strictly regulat ed in all organisms in response to changing N availabilities, however the underlying 95 molecular mechanism(s) of inhibition significantly differ for the various GS classes and in various 96 organisms (Reitzer, 2003) 97 Regulation of GS activity: highly diverse and often complex in various organisms 98 An extensive repertoire of cellular control mechanisms regulating GS activity in response to N 99 availability has been observed in different organisms . Inhibitory mechanisms in response to an N 100 upshift range from feedback inhibition by e.g. glutamine or other end products of the glutamine 101 metabolism (e.g. E. coli (Stadtman, 2004), Bacillus subtilis (Deuel et al., 1970) , yeast (Legrain et al., 102 1982)), proteolytic degradation (yeast , (Legrain et al., 1982) , covalent modification by adenylylatio n 103 of the 1ß-type GS subunits (e.g. enterobacteriaceae), thiol -based GS regulation ( e.g. in soybean 104 nodules (Masalkar and Roberts, 2015) ), inhibition by regulatory proteins (e.g. in gram positive 105 bacteria (Travis et al., 2022a)), inhibition by interactions with small proteins (e.g. inhibitory factors in 106 Cyanobacteria (García-Domínguez et al., 1999; Klähn et al., 2018, 2015) ), to directly effecting the 107 activity through the presence or absence of the small metabolite 2-OG, which has been shown for 108 the first time for Methanosarcina mazei (Ehlers et al., 2005) . Moreover, o ften complex regulations 109 for GS activity including several of the different regulatory mechanisms are reported for one 110 organism. For example, yeast GS (ScGS) is regulated via feedback inhibition by glutamine and is 111 susceptible to proteolytic de gradation under N starvation. It was also found to assemble into 112 nanotubes (He et al., 2009) and under advanced cellular starvation into inactive filaments (Petrovska 113 et al., 2014) . In E. coli, the activity of the Iß-type GS (EcGS) is controlled by cumulative feedback 114 inhibition and covalent modification (reviewed in Reitzer, 2003). It has been shown that each of the 115 12 subunits can be modified by adenylylation (Tyr397) resulting in an inactivation of the respective 116 subunit (Stadtman, 1990). Moreover, the adenlylylation of single subunits in the complex in addition 117 makes the other subunits more susceptible to cumulative feedback inhibition by various substances 118 (Stadtman, 1990) . These substan ces either bind the glutamine -binding pocket or have an allosteric 119 binding site (Liaw et al., 1993; Woolfolk and Stadtman, 1967). The dodecameric structure of EcGS has 120 been known for a long time (Almassy et al., 1986; Yamashita et al., 1989) . However, when artificially 121 exposed to divalent cations ( Mn2+, Co 2+) it randomly aggregates and produces long hexagonal tubes 122 (paracrystalline aggregates) (Valentine et al., 1968) . T he detailed structural information on the 123 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint mechanisms of this GS-filament formation to an inactive form of EcGS, often associated with stress 124 responses, as well as the reversion into individual active dodecamers has only recently been 125 described by cryo-electron microscopy ( cryo-EM) analysis (Huang et al., 2022) . The B. subtilis GS has 126 been shown to be feedback regulated. In addition , binding of the transcriptional r epressor GlnR to 127 the feedback inhibited complex not only activates the transcription repression function of GlnR 128 (Fisher and Wray, 2008) but also stabilizes the inactive GS conformation potentially changing from a 129 dodecamer into a tetradecameric structure (Travis et al., 2022a). 130 In M. mazei , a mesophilic methanoarchaeon, which is able to fix N 2, regulation of the central N 131 metabolisms has been studied extensively on the transcriptional and post -transcriptional level (Jäger 132 et al., 2009; Prasse and Schmitz, 2018; Veit et al., 2005) . A central role of 2-OG for the perception of 133 changes in N availabilities has been proposed as has been demonstrated for cyanobacteria 134 (Forchhammer, 1999; Herrero et al., 2001) . The activity of M. mazei GS encoded by glnA1, is 135 regulated by several different mechanisms. GS /GlnA1) is not covalently modified in response to N 136 availability and thus represents a Iß-type-GS (Ehlers et al., 2005) . It has been demonstrated to get 137 directly activated under N starvation due to the high intracellular concentrations of the metabolite 2-138 OG which directly induces GlnA1 activity (Ehlers et al., 2005) . 2-OG represents the internal signal for 139 N limitation since u nder N starvation the internal 2-OG level significantly increase s due to missing 140 consumption by GDH (M. mazei contains the oxidative TCA part, anabolic). The increased cellular 2-141 OG concentration has been shown to be directly perceived by the GlnA1 most likely by direct binding 142 resulting in strong activation (Ehlers et al., 2005) . Besides, we showed first evidence that in addition 143 two small proteins interact with M. mazei GlnA1, the PII -like protein GlnK1 and small protein sP26 144 comprising 23 amino acids (Ehlers et al., 2005; Gutt et al., 2021) . The presence and potential 145 interaction of both small proteins show small effects on the GlnA1 activity, however compared to the 146 strong 2-OG stimulation only to a very low extend, which might be neglectable and due to the 147 indirect GS activity assay. Moreover, based on initial complex formation analysis using size exclusion 148 chromatography (SEC) and pull-down approaches first indications were obtained that in the absence 149 of 2-OG the GlnA 1/GlnK1 complexes are more stable than in the presence of high 2-OG. This led to 150 the conclusion that due to the shift to N sufficiency after a period of N limitation, GlnA1 activity is 151 reduced due to the lower 2-OG concentration but also due to the inhibitory protein interaction with 152 GlnK1 (Ehlers et al., 2005) . Very recently the first structural analysis of M. mazei GlnA1 was reported, 153 showing first GS complexes with GlnK 1 (Schumacher et al. 23). Based on their findings Schumacher et 154 al. propose a regulation of GlnA1 activity by oligomeric modulation, with GlnK 1 stabilizing the 155 dodecameric structure and the formation of GlnA1 active sites. Since this proposed model is entirely 156 missing the effects of 2-OG on GlnA1 activity, we here aimed to study the obtained effects regulating 157 M. mazei GlnA1 activity in more detail by evaluating oligomerization and complex formation between 158 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint GlnA1, GlnK1 and sP26 in dependence of 2-OG employing mass photometry (MP) allowing molecular 159 weight distribution of single complexes in solution and by high resolution cryo-EM. 160 161

162 2-OG is responsible for GlnA1-dodecamer formation in M. mazei 163 The strep-tagged purified GlnA 1 was analyzed by SEC in the presence of 12.5 mM 2-OG 164 demonstrating that GS is exclusively present in a dodecameric structure, no other oligomers were 165 detectable (suppl. Fig. S1). To investigate the effects of 2 -OG on M. mazei GlnA1 in more detail, we 166 employed MP, a method that allows to measure the molecular weight distribution in solution. Strep-167 tagged purified GlnA 1 (after SEC) was dialyzed into a 2 -OG free HEPES buffer (see M aterials and 168 Methods) and subsequently analyzed by MP, demonstrating that in the presence of low 2 -OG 169 concentrations (0.1 mM) all of the M. mazei GlnA1 was exclusively present as monomers/dimers with 170 no higher molecular weight complexes present. After addition of 12.5 mM 2-OG, the size distribution 171 shifted towards a higher molecular weight complex of 630-700 kDa (calculated based on the 172 measured dimer-size in each measurement; expected molecular weight of dodecamer: 634 kDa) (Fig. 173 1A, B). This molecular weight corresponds to a fully assembl ed dodecamer species , the same 174 oligomeric structure that is adapted in GS from other prokaryotes. Using 2-OG concentrations varying 175 between 0.1 and 12.5 mM, complex analysis showed that up to 62 % of all particles were assembled 176 in a dodecamer . This further allowed to determine the binding affinity of GlnA 1 to 2-OG to be KD = 177 0.75 ± 0.01 mM 2 -OG (based on two biological replicates , calculated with the percentage of 178 dodecamer) as described in M aterials and Methods, and verified that no other intermediate 179 oligomeric complexes were detectable during dodecameric assembly (Fig. 1A, C , suppl. Fig. S2A , B). 180 Activity measurements of Strep-GlnA1 in the presence of increasing 2 -OG concentrations showed a 181 strong i ncrease of the activity from 0.0 U/mg in the absence of 2 -OG up to 7.8 ± 1.7 U/mg in the 182 presence of 12.5 mM 2-OG (six independent protein purifications, Fig. 1D). Thus, we conclude that 2-183 OG acts as a trigger for dodecameric assembly of M. mazei GlnA1, setting it apart from other bacterial 184 and eukaryotic enzyme variants. Moreover, most likely in addition to the dodecameric assembly , 2-185 OG is additionally required for a further 2 -OG induced conformational switch of the active site, since 186 saturated GlnA1 activities are not reached in the presence of 5 mM 2 -OG, when most of the GlnA1 is 187 in a dodecameric structure. For full activity, the presence of 12.5 mM 2-OG is required. 188 Figure 1 189 190 GlnK1 has no detectable effects on GS dodecamer assembly or activity under the tested conditions 191 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint Previous studies have shown protein interactions between M. mazei GlnA1 and GlnK1 as well as GlnK 1 192 induced effects on GlnA1 activity. Consequently, we next tested the effects of GlnK 1 presence on the 193 GlnA1 oligomerization in the presence of 2 -OG. Performing the MP analysis u nder the tested 194 conditions as before but in the presence of purified GlnK 1 demonstrated that (i) in the absence of 2 -195 OG varying ratios between GlnA1 and GlnK1 (20:1, 2:1, 2:10 based on monomers) did not result in any 196 dodecamer assembly of GlnA1 (Fig. 2A, B), (ii) no difference in the GlnA1 dodecameric assembly in the 197 presence of 2 -OG was obtained in the presence of purified GlnK1 (2:1), (iii) nor was binding of GlnK 1 198 to GlnA1 detected by a respective increase in the mass of the higher oligomeric complex (Fig. 2 B, C). 199 Moreover, the presence of GlnK 1 (2:1) neither had an influence on the 2-OG affinity (K D (- GlnK1) = 200 1.06 mM 2-OG; KD (+ GlnK1) = 1.02 mM 2-OG, K D calculated based on the dodecamer/dimer ratio) , 201 nor in any ratio on the specific activity of GlnA1 (Fig. 2 D, C: exemplarily showing 2:1; suppl. Fig. S2C, 202 D). Consequently, we conclude that under the conditions tested using purified proteins , GlnA1 203 dodecamer assembly occurs independently of GlnK 1 and n o binding of GlnK 1 to the dodecameric 204 GlnA1 occurs. However, we cannot exclude that cellular components/metabolites not present in 205 these experiments are crucial for a GlnA1-GlnK1 interaction. 206 Figure 2 207 208 Structural basis of oligomer formation by 2-OG 209 To now unravel the structural mechanism underlying M. mazei GlnA1 activation by 2 -OG, we 210 employed cryo-EM and single-particle analysis. Treating freshly purified Strep-GlnA1 with 12.5 mM 2-211 OG, effectively shifted the equilibrium towards fully assembled homo -oligomers as depicted in the 212 MP experiments . In the micrographs , fully assembled ring-shaped particles are visible . However, 213 initial attempts to obtain a 3D reconstruction were hindered by the pronounced preferred 214 orientation of particles within the ice, a challenge which has been overcome by introducing low 215 concentrations of CHAPSO (0.7 mM). In our final dataset, all particles exhibited well -distributed 216 oligomers in diverse orie ntations. Leveraging this dataset, we aligned the particles to a 2.39 Å 217 resolution structure, revealing well resolved side chains that facilitated seamless model building (Fig. 218 3, suppl. Fig. S 3, suppl. Tab. S2 ). Consequently, we achieved a structure demonstrating excellent 219 geometry and density fitting. 220 The detailed structural analysis uncovered that GlnA 1 assembles into a dodecamer characterized by 221 stacked hexamer rings. A single GlnA 1 protomer is composed of 15 β-strands and 15 α-helices and is 222 split in into a larger C -domain and an N -domain by helix α3. The dodecameric arrangement is 223 achieved through two distinct interfaces , the hexamer interfaces and inter -hexamer interfaces. 224 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint Hexamer interfaces are situated between subunits within each ring, while i nter-hexamer interfaces 225 occur between subunits derived from adjacent rings (Fig. 4A, B, C). The structures are highly similar 226 to Gram -positive bacterial GS structures (PDB: 4lnn, Murray et al., 2013),with root mean squared 227 deviations (rmsds) of 0.5–1.0 Å. 228 A closer inspection of the density reveals the density for the bound 2-OG at an allosteric site localized 229 at the interface between two GlnA 1 protomers in vicinity of the GlnA 1 catalytic site (Fig. 4B, D) . 230 Several residues are contributing to its binding. R172’ and S189’ coordinate the γ-Carboxy-group. 231 Additionally, two tightly bound water molecules are detectable in the binding site. One is interacting 232 with the γ-Carboxy group while being stabilized by another water that is coordinated by S38 and R26. 233 Latter arginine is coordinating the α-Keto-group and, together with R87 and R173 ’, the α-Carboxy 234 group of 2-OG (Fig. 4B). Notably, F24 stabilizes the 2-OG via stacking with its phenyl ring. This binding 235 contribution from two GlnA1 protomers at the intersubunit junction enhances activation by boosting 236 readiness and the rate of full complex assembly. It operates akin to molecular glue that facilitate the 237 observed cooperative assembly. 238 A comparison with the substrate-bound GlnA1 structure (PDB: 8tfk, Schumacher et al. 2023) revealed 239 that the catalytic ally important residues in M. mazei are the aspartic acid (D57) that abstracts the 240 proton from ammonium and the catalytic glutamic acid, Glu307. The active site of M. mazei GlnA1 is 241 formed at the interface between two subunits in the hexamer and formed by five key catalytic 242 elements surrounding the active site: the E flap (residues 303 –310), the Y loop (residues 369 –377), 243 the N loop (residues 235 –247), the Y * loop (residues 152 –161) and the D50 ́ loop (residues 56 -71). 244 The latter one is the only one that originates from adjacent neighboring protomer (Fig 5C, E). 245 Superposition of our structure with the apo- M. mazei X-ray structure (PDB: 8tfb, Schumacher et al., 246 2023) reveals that 2-OG binding also triggers further movements that lead to structural changes in 247 the substrate binding pocket (Fig. 5A, B, D). R87' and its loop undergo a dramatic flip to coordinate 2 -248 OG and D170 of helix α3 (residues 167 -181) (Fig . 5A). This, combined with the action of other 249 coordinating residues, initiates a motion that is propagated through the entire protein. Notably, helix 250 α3 shifts forward, causing F184 to flip over and facilitate a T -shaped aromatic interaction with F202. 251 The resulting pull on F202 causes F204 to flip, allowing π -stacking with the purine moiety of ATP (Fig. 252 5B). This series of structural changes primes the active site for ATP binding by already adopting the 253 side chain conformations that are observed in analogue (Met-Sox-P-ADP)-bound structure (transition 254 state) (PDB: 8tfk, Schumacher et al., 2023), thus facilitating nucleotide binding (Fig. 5C, E). 255 Additionally, the D50’ loop adopts a position similar to the transition state in a catalytic competent 256 conformation. This involved a remodeling of the loop, leading to the positioning of key catalytic 257 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint residues in a catalytic competent configuration. Compared to the apo stru cture (Schumacher et al., 258 2023), R66 flips out of the catalytic pocket, now accommodating R319 which participates in 259 phosphoryl transfer catalysis (Fig. 5D). In addition, Asp 57' moves deeper into the binding site, 260 facilitating the proton abstraction of NH 4 + and preparing for its attack on the phosphorylated 261 glutamate. Similar to the ATP/ADP binding site, these catalytic elements are prime d to ideally 262 stabilize the tetrahedral transition state. This is illustrated by the superposition of the inhibitor -263 bound, transition-state locked structure (Schumacher et al., 2023) (Fig. 5C, E). 264 Figure 5 265 266 Feedback inhibition by glutamine does not affect the dodecameric M. mazei GlnA1 structure 267 For bacteria it is known, that GS can be feedback inhibited. Very recently, the first feedback inhibition 268 of an archaeal GS by glutamine has been reported for Methermicoccus shengliensis GS (Müller et al., 269 2023). The specific arginine residue identified to be relevant for the feedback inhibition is R66. 270 Consequently, we generated the respective M. mazei GlnA1 mutant protein changing the conserved 271 arginine to alanine (R66A ) (see also Fig. 5D, E) and compared the purified strep -tagged mutant 272 protein with the wildtype (wt) protein. In the presence of 12.5 mM 2-OG, the mutant protein showed 273 the same specific activity as obtained for the wt. However, when supplementing 5 mM glutamine , 274 exclusively the wt was strongly feedback inhibited, whereas the R66A mutant protein was not 275 significantly affected (Fig. 6A). In B. subtilis , R62 is responsible for feedback inhibition. The 276 superposition of the apo -BsGS structure (PDB: 4lnn, Murray et al., 2013) with our 2-OG-bound GlnA1 277 reveals a similar positioning of the respective M. mazei R66 (Fig. 6B) indicating a similar mechanism. 278 Moreover, we can rule out an effect on the oligomeric structure of GlnA1 by MP analysis , clearly 279 showing that glutamine does not induce disassembly of the dodecameric wt GlnA1 (Fig. 6C). Instead, 280 this effect can be explained with the role of R66 being an important residue to bind to glutamine in 281 the product state of the enzyme. 282 Figure 6 283 284

285 2-OG is crucially required for M. mazei GS assembly to an active dodecamer and induces the 286 conformational state towards an active open state 287 In M. mazei increased 2-OG concentrations act as central N starvation signal (Ehlers et al., 2005) . 288 Here we demonstrated the importance of 2 -OG as the major regulator of M. mazei GlnA1 activity by 289 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint using independent methods, MP and cryo-EM , to detect and structurally characterize single 290 complexes with high resolution and quantify the different oligomeric complexes. We have found 291 mono- and dimeric GlnA 1 (apo GlnA1) to be inactive and crucially requir e 2-OG to form an active 292 dodecameric complex. Moreover, this dodecameric conformation is the only active state of GlnA 1. In 293 the first step, 2 -OG assembles the dodecamer by binding at the interface of two subunits (Fig. 4B) 294 and functions as a molecular glue between neighbouring subunits. The assembly upon 2 -OG addition 295 observed using MP appears to be cooperative, fast and without any dete ctable intermediate states 296 (Fig. 1B, C). Only immediately after thawing a frozen purified GlnA1 preparation and in case that no 297 additional SEC was performed prior to MP analysis , samples showed addition al octameric complexes 298 in MP with low abundancy (suppl. Fig. S4). However, octameric complexes were never observed in 299 cryo-EM or detected by SEC analysis of frozen purified GlnA 1 samples. Consequently, octamers are 300 most likely broken or disassembled GlnA 1-dodecamers or dead -ends in assembly with no 301 physiological function, rather than an incomplete dodecamer during assembly. Thus, our findings are 302 contrary to the assembly model proposed by Schuhmacher et al. (Schumacher et al., 2023). 303 As a second step of activation, the allosteric binding of 2-OG causes a series of conformational 304 changes in GlnA 1 protomers, which prime the active site for the transition state and hence catalysis 305 of th e enzyme . This conformational change of the ATP -binding pocket of the dodecameric GlnA 1 306 upon 2 -OG binding goes hand in hand with the observed increased activity at higher 2 -OG 307 concentrations (Fig. 1). Comparing our 2 -OG-bound GlnA 1 dodecameric structure a nd the 308 dodecameric M. mazei GlnA1 transition state (PDB: 8tfk) and apo structures (PDB: 8ftb) reported by 309 Schumacher et al. (Schumacher et al., 2023) , clearly demonstrates that 2 -OG transfers GlnA 1 into its 310 open transition state conformation (Fig. 5) . The conformation of our 2 -OG-bound dodecamer 311 resembled the transition state conformation (ADP-Met-Sox-bound complex) reported by Schumacher 312 et al., even though in our case no ATP was added (Fig. 5E). A reconfiguration of the active site upon 313 2-OG-binding has also been reported for GS in Methanothermococcus thermolithotrophicus (Müller 314 et al., 2024). In this report, which does not delineate dodecamer assembly at all, it was demonstrated 315 that binding of 2 -OG in one prot omer-protomer interface of a dodecameric GS causes a cooperative 316 domino effect in the hexameric ring of M. thermolithotrophicus GS (Müller et al., 2024) . A 2 -OG 317 bound protomer undergoes a conformational change and thereby induces the same shift in its 318 neighbouring protomer (Müller et al., 2024) . This is comparable to our observed cooperativity of M. 319 mazei dodecamer assembly at low 2 -OG concentrations (K D = 0.75 mM, percentage of dodecamer ). 320 On the other hand, M. mazei GlnA1 reaches maximal activity only at much higher 2 -OG 321 concentrations and likely requires a fully 2 -OG-occupied dodecamer for maximal activity. The here 322 obtained high activities by 2 -OG saturation (up to 9 U/mg) in comparison with previously described 323 M. mazei GlnA1 activities in the absence of 2 -OG in the significantly lower range (mU/mg) (Gutt et 324 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint al., 2021; Schumacher et al., 2023) support our conclusion that 2-OG is substantial for the GlnA 1 325 active state. 326 GlnA1 activity is further regulated by feedback inhibition, small proteins and possibly filament 327 formation 328 M. mazei GlnA 1 belongs to the group of Iα-type GS, which are known to be feedback inhibited. We 329 confirmed a strong feedback inhibition by a genetic approa ch and found R66 to be the key residue 330 for this inhibition (Fig. 6) as suggested in Müller et al. 202 4. The mechanism of feedback inhibition 331 has been described in detail for B. subtilis GS (Murray et al., 2013) . There, R62 plays the central role 332 by binding glutamine and inducing a well ordered inactive structure at the substrate -binding pocket 333 upon glutamine-binding (Murray et al., 2013). The homologous M. mazei R66 likely conveys a similar 334 way of inhibition to B. subtilis GS (Fig. 6B, alignment in suppl. Fig. S5). 335 Further regulations by the two small proteins sP26 and the PII-like protein GlnK 1 have previously 336 been reported for M. mazei (Ehlers et al., 2005; Gutt et al., 2021; Schumacher et al., 2023) . However, 337 in the present study neither an interaction with GlnK1, nor GlnK1 effects on GlnA1 complex formation 338 analysed by MP, nor an effect of GlnK1 on GlnA1 activity was detectable under the conditions used at 339 varying 2-OG concentrations (0.1 to 12.5 mM) and ratios of GlnK 1 to GlnA 1 (20:1, 2:1, 2:10 ) (Fig. 2). 340 Moreover, the addition of GlnK 1 did not result in a change of the K D for 2 -OG for the dodecamer 341 GlnA1 assembly (Fig. 2D). In previous reports, GlnK 1 was shown to interact with GlnA 1 in vivo after a 342 nitrogen upshift by pull -down approaches (Ehlers et al., 2005), pointing towards an inhibitory 343 function of GlnK 1 under shifting conditions from N limitation to N sufficiency. Similarly, we could not 344 determine a cryo-EM structure including sP26 despite adding large excess of the small protein either 345 obtained by co -expression or by addition of a synthetic peptide . Because these attempts were 346 unsuccessful, we speculate that yet unknown cellular factor(s) might be required for an interaction of 347 GlnA1 with both small proteins, GlnK 1 and sP26, which however is diff icult to simulate under in vitro 348 conditions with purified proteins. Taken this into account, we speculate about a potential function of 349 the two small proteins beyond GlnA1 inactivation or activation. Since the GlnA1 reaction is coupled to 350 the GOGAT reactio n (GS/GOGAT system) and the products of the two reactions replenish the 351 substrates for one other, it is tempting to speculate that GlnA1 and GOGAT experience metabolic 352 coupling by sP26 and/or GlnK1 e.g. by being involved in recruiting or separating GOGAT from GlnA1. 353 Finally, higher oligomeric states of GS enzymes have been known for a long time for organisms like 354 yeast and E. coli (He et al., 2009; Huang et al., 2022; Petrovska et al., 2014; Valentine et al., 1968) . 355 Interestingly, dependent on the ice thickness and on higher concentrated areas of the grids, we could 356 also observe filament-like structures of M. mazei GlnA1 in cryo-EM and resolved their structure at a 357 resolution of 6.9 Å (suppl. Fig. S6). Such GlnA1 filaments are also detectable in the cryo-EM images of 358 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint Schumacher et al. 2023 but were not reported. Their interface is much alike the previously reported 359 E.Coli GS filament structures (Huang et al., 2022) . The physiological relevance of filamentation in M. 360 mazei however remains unresolved and raises the question, whether an additional rapid modulation 361 of GlnA1 activity through higher oligomeric states exists, as described e.g. for yeast GS most 362 depending on stress conditions (Petrovska et al., 2014). 363 M. mazei GlnA1 shows unique properties 364 Overall, we have confirmed 2-OG to be the central activator of GlnA 1 in M. mazei, which assembles 365 the active dodecamer and induces a conformational switch towards an active open state. Though 2 -366 OG has previously been reported as an on -switch for (methano)archaeal GS activity (Ehlers et al., 367 2005; Müller et al., 2024; Pedro -Roig et al., 2013) , the 2 -OG-triggered assembly is novel and 368 described exclusively for M. mazei GlnA1. In this respect, t he way of GS regulation in M. mazei is 369 unique across all prokaryotic GS studied so far. Neither in cyanobacteria, enterobacteria or Bacillus is 370 2-OG a direct activator, nor is complex (dis-)assembly a mode of regulating GS activity in any other of 371 these model organisms. This is further supported by the absence of up to three of those four 372 arginines - coordinating 2 -OG in M. mazei GlnA1 - in these organisms ( suppl. Fig. S 5). The 373 cyanobacterial, enterobacterial and gram positive GS are present in the cell as active dodecamers 374 (Almassy et al., 1986; Bolay et al., 2018; Deuel et al., 1970) . However, these dodecamers are 375 inactivated upon sudden N sufficiency through very different mechanisms: Synechocystis GS is 376 blocked by small proteins (inhibitory factor s), the enterobacterial GS experiences gradual 377 adenylylation of subunits which abolishes the enzyme activity and B. subtilis GS is feedback inhibited 378 by glutamine and further inhibited by binding of the transcription factor GlnR (Almassy et al., 1986; 379 Bolay et al., 2018; Klähn et al., 2018, 2015; Stadtman, 2001; Travis et al., 2022b) (see Fig. 7). 380 The direct 2-OG activation and glutamine feedback inhibition of M. mazei GS are two fast, reversible 381 and very direct ways of reacting towards the changing N status of the cell. We propose that the 382 direct activation through 2 -OG without any required additional protein as it is the case for all other 383 regulations, is a more simple and direct regulation of GS. Due to the evolutionary placement of 384 methanoarchaea an d haloarchaea, where a direct 2 -OG regulation has been found exclusively, this 385 may represent an ancient regulation. 386 387 388 389 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint

390 Strains and plasmids 391 For heterologous expression and purification of Strep-tagged GlnA 1 (MM_0964), the plasmid 392 pRS1841 was constructed. The glnA1-sequence along with the sP26 -sequence (including start-codon: 393 ATG) were codon-optimized for Escherichia coli expression and commercially synthesized by Eurofins 394 Genomics on the same plasmid (pRS1728) (Ebersberg , Germany). Polymerase chain reaction (PCR) 395 was performed using pRS1728 as template and the primers (Eurofins Genomics, Ebersberg, 396 Germany) GlnAopt_NdeI_for (5’TTTCATATGGTTCAGATGAAAAAATG3’) and GlnA1opt_BamHI_rev 397 (5’TTTGGATCCTTACAGCATGCTCAGATAACGG3’). The resulting GlnA1_opt PCR -product and vector 398 pRS375 were restricted with NdeI and BamHI (NEB, Schwalbach, Germany); the resulting pRS375 399 vector fragment and the GlnA 1 fragment were ligated resulting in pRS1841 . For heterologous 400 expression of Strep-GlnA1, pRS1841 was t ransformed in E. coli BL21 (DE3) cells (Thermo Fisher 401 Scientific, Waltham, Massachusetts) following the method of Inoue (Inoue et al., 1990) . For 402 generating the Arg66Ala -mutant, a site -directed mutagenesis was performed. pRS1841 was PCR -403 amplified using primers sdm_GlnA_R66A_for (5’ATTGAAGAAAGCGATATGAAACTGGCGC3’) and 404 sdm_GlnA_R66A_rev (5’CGCGGTAAAGCCCTGAATGCTGCTACC3’) by Phusion High-Fidelity polymerase 405 (Thermo Fisher Scientific, Waltham, Massachusetts) followed by religation resulting in plasmid 406 pRS1951. For heterologous expression, pRS1951 was transformed into E. coli BL21 (DE3). 407 In order to co-express sP26 along with Strep-GlnA 1, the construct pRS1863 was generated. pRS1728 408 with the codon -optimized sP26 -sequence and pET21a (Novagen , Darmstadt, Germany) were 409 restricted with NdeI and NotI and the resulting untagged sP26_opt was ligated into the pET21a 410 backbone yielding pRS1863. pRS1863 was co-transformed with pRS1841 into E. coli BL21 (DE3) cells 411 (Thermo Fisher Scientific, Waltham, Massachusetts) selecting for both Kanamycin (pRS1841 derived) 412 and Ampicillin (pRS1863 derived) resistance. 413 The plasmid pRS1672 was constructed for producing untagged GlnK 1. The GlnK 1 gene was PCR-414 amplified using primers GlnK1_MM0732.for (5’ATGGTTGGCTATGAAATACGTAATTG3’) and 415 GlnK1_MM0732.rev (5’TCAAATTGCCTCAGGTCCG3’) and cloned into pETSUMO b y using the 416 Champion™ pET SUMO Expression System (Thermo Fisher Scientific, Waltham, Massachusetts) 417 according to the manufacturer’s protocol. pRS1672 was then transformed into E. coli DH5α and BL21 418 (DE3) pRIL (suppl. Tab. S1). 419 Heterologous expression and protein purification: Strep-GlnA1 and GlnK1 420 Heterologous expression of Strep-GlnA 1-variants (pRS1841 and pRS1951) and Strep-GlnA 1-sP26-421 coexpression (pRS1841 + pRS1863) were performed in 1 l Luria Bertani medium (LB, 422 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint Carl Roth GmbH + Co. KG, Karlsruhe, Germany). E. coli BL21 (DE3) containing pRS1841, pRS1841 and 423 pRS1863 or pRS1951 was gr own to an optical turbidity at 600 nm ( T600) of 0.6 - 0.8, induced with 25 424 µM isopropylβ-d-1-thiogalactopyranoside (IPTG , Carl Roth GmbH + Co. KG, Karlsruhe, Germany) and 425 further incubated over night at 18 °C and 120 rpm. The cells were harvested (6 ,371 x g, 20 min, 4 °C) 426 and resuspended in 6 ml W -buffer (100 mM TRIS/HCl, 150 mM NaCl, 2.5 mM EDTA , (chemicals from 427 Carl Roth GmbH + Co. KG, Karlsruhe, Germany ), 12.5 mM 2-oxoglutarate ( 2-OG, Sigma -Aldrich, St. 428 Louis, Missouri), pH 8.0). After the addition of DNase I (Sigma-Aldrich, St. Louis , Missouri), cell 429 disruption was performed twice using a French Pressure Cell at 4.135 x 10 6 N/m2 (Sim-Aminco 430 Spectronic Instruments, Dallas, Texas) followed by centrifugation of the cell lysate for (30 min (13,804 431 x g, 4 °C ). The supernatant was incubated with 1 ml equilibrated (W-buffer) Strep-Tactin sepharose 432 matrix (IBA, Gottingen, Ger many) at 4°C for 1 h at 20 rpm . Strep-tagged GlnA1 was eluted from the 433 gravity flow column by adding E -buffer (W -buffer + 2.5 mM desthiobiotine (IBA, Gottingen, 434 Germany)). Strep-GlnA1 was always purified and stored in the presence of 12.5 mM 2-OG, either in E-435 buffer or 50 mM HEPES, pH 7.0 at 4 °C for a few days or with 5 % glycerol at -80 °C (chemicals from 436 Carl Roth GmbH + Co. KG, Karlsruhe, Germany). 437 His6-SUMO-GlnK1 was expressed similarly using E. coli BL21 (DE3) pRIL + pRS1672. Expression was 438 induced with 100 µM IPTG, incubated at 37 °C, 180 rpm for 2 h and harvested. The pellet was 439 resuspended in phosphate buffer (50 mM phosphate, 300 mM NaCl, pH 8 (chemicals from 440 Carl Roth GmbH + Co. KG, Karlsruhe, Germany )) and the cell extract was prepared as described 441 above. His -tag-affinity chromatography -purifcation was performed with a Ni -NTA agarose (Qiagen, 442 Hilden, Germany) gravity flow column, the protein was purified by stepwise -elution with 100 and 250 443 mM imidazole (SERVA, Heidelberg, Deutschland) in phosphate buffer. SUMO -protease (Thermo 444 Fisher Scientific, Waltham, Massachusetts) was used according to the manufacturer’s protocol to 445 cleave the His 6-SUMO-GlnK1 and obtain untagged GlnK 1 by passing through the Ni -NTA-column after 446 the cleavage. Elution fractions of protein purifications were analyzed on 12 % SDS -PAGE gels and the 447 protein concentrations were determined by Bradford (Bio-Rad Laboratories, Hercules, California) or 448 Qubit protein assay (Thermo Fisher Sceintific, Waltham, Massachusetts). 449 Determination of glutamine synthetase activity 450 The glutamine synthetase activity was determined by performing a coupled optical assay (Shapiro 451 and Stadtman, 1970) . The assay was performed as described in Gutt et al. 2021 with modifications. 452 Modifcations included the use of 50 mM HEPES, the adjustment of ATP -pH to 7.0 and the use of 5 453 mM glutamine ( Sigma-Aldrich, St. Louis, Missouri) in some assays. The assays were performed with 454 four technical replicates per condition including two concentrations of GnA1 (2 x 10 µg and 2 x 20 µg 455 of Strep-GlnA1). Strep-GlnA1 was stored in E-buffer or 50 mM HEPES containing 12.5 mM 2-OG which 456 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint was dialysed against 50 mM HEPES pH 7 using Amicon® Ultra catridges with 30 kDa filters 457 (MilliporeSigma, Burlington, Massachusetts) for the enzyme assays in the absence of 2-OG. 458 Mass photometry 459 The molecular weight of protein complex es was analysed by mass photometry (MP) using a Refeyn 460 twoMP mass photometer with the AcquireMP software (Refeyn Ltd., Oxford, UK) . All measurements 461 were performed in 50 mM HEPES, 150 mM NaCl pH 7.0 (MP-buffer, chemicals from 462 Carl Roth GmbH + Co. KG, Karlsruhe, Germany ) on 1.5 H, 24 x 60 mm microscope coverslips with 463 Culture Well Reusable Gaskets (GRACE BIO -LABS, Bend, Oregon). Strep-GlnA1 and untagged GlnK1 464 were prepared as described above. Prior to MP experiments, a size exclusion chromatography (SEC) 465 was performed with GlnA 1 in the presence of 12.5 mM 2 -OG on a Superose™ 6 Increase 10/300 GL 466 column (Cytiva, Marlborough, Massachusetts) with a flow ra te of 0.5 ml/min . Only the dodecameric 467 fraction was used for MP experiments and dialysed against MP buffer using Amicon® Ultra catridges 468 with 30 kDa filters (MilliporeSigma, Burlington, Massachusetts) beforehand. The Gel Filtration HMW 469 Calibration Kit (Cytiva, Marlborough, Massachusetts ) was used as a standard in SEC. 75 – 200 nM 470 monomeric Strep -GlnA1 were used in the MP measurements, GlnK 1 was added accordingly in the 471 desired ratio calculated based on monomers. The analysis of the acquired data was perf ormed with 472 the DiscoverMP software by applying a pre -measured standard (Refeyn Ltd., Oxford, UK). Counts 473 were visualized in mass histograms as relative counts, which were calculated for the Gaussian fits of 474 the measured peaks. For the determination of K D-values and creating sigmoidal fitted curves, RStudio 475 (RStudio Team (2020). RStudio: Integrated Development for R. RStudio, PBC, Boston, MA URL ) was 476 used. 477 Cryo-electron sample preparation and Data collection: 478 Purified GS at a concentration of 1.5 mg/mL was rapidly applied to glow-discharged Quantifoil grids, 479 blotted with force 4 for 3.5 s, and vitrified by directly plunging in liquid ethane (cooled by liquid 480 nitrogen) using Vitrobot Mark IV (Thermo Fisher Scientific, Waltham, Massachusetts) at 100% 481 humidity and 4 °C. To overcome prefererred orientation bias, 0.7 mM CHAPSO was added to prevent 482 water-air interface interactions, consequently the concentration of the protein was increased to 483 6mg/ml. We added purified commercially synthesized sP26 (Davids Biotechn ologie, Regensburg, 484 Germany) to all samples, but the peptide did not stably bind under the observed conditions. Data 485 was acquired with EPU in EER-format on an FEI Titan Krios G4 (Cryo -EM Platform, Helmholtz Munich) 486 equipped with a Falcon IVi detector ( Thermo Fisher Scientific, Waltham, Massachusetts) with a total 487 electron dose of ~55 electrons per Å 2 and a pixel size of 0.76 Å. Micrographs were recorded in a 488 defocus range of -0.25 to -2.0 μm. For details see suppl. Table S2. 489 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint Cryo EM - Image processing, classification and refinement 490 All data was processed using Cryosparc (Punjani et al., 2017). Micrographs were processed on the fly 491 (motion correction, CTF estimation). Using blob picker , 878,308 particles were picked, 2D -classified 492 and used for ab initio reconstruction. Iterative rounds of ab initio and heterogenous refin ement were 493 used to clean the particle stacks. The final refinements yielded models with an estimated resolution 494 of 2.39 Å sets at the 0.143 cutoff (suppl. Fig. S3). 495 An initial model was generated from the protein sequences using alphaFold (Jumper et al., 2021), 496 and thereupon fitted as rigid bodies into the density using UCSF Chimera (Pettersen et al., 2021). The 497 model was manually rebuilt using Coot (Emsley et al., 2010) . The final model was subjected to real -498 space refinements in PHENIX (Liebschner et al., 2019) . Illustrations of the models were prepared 499 using UCSF ChimeraX (Pettersen et al., 2021). The structure is accessible under PDB: 8s59. For details 500 see suppl. Table S2. 501 502 Acknowledgements. 503 We thank the members of our laboratories for useful discussions on the experiments, as well as 504 Claudia Kiessling for technical assistance. This work was sup ported by the German Research Council 505 (DFG) priority program (SPP) 2002 ‘Small proteins in Prokaryotes, an unexplored world’ 506 [Schm1052/20-2]. We acknowledge the contribution of the CryoEM Facility of the Philipps University 507 of Marburg. J.M.S. acknowledges the DFG for an Emmy Noether grant (SCHU 3364/1 -1) cofunded by 508 the European Union (ERC, TwoCO2One, 101075992). Views and opinions expressed are, however, 509 those of the author(s) only and do not necessarily reflect those of the European Union or the 510 European Research Council. Neither the European Union nor the granting authority can be held 511 responsible for them. We thank Sandra Schuller for useful discussions and help in preparing 512 manuscript figures. GKAH was supported by the Max Planck Society. 513 514 515 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint 516

517 Almassy, R.J., Janson, C.A., Hamlin, R., Xuong, N.-H., Eisenberg, D., 1986. Novel subunit—subunit 518 interactions in the structure of glutamine synthetase. Nature 323, 304–309. 519 https://doi.org/10.1038/323304a0 520 Bolay, P., Muro-Pastor, M.I., Florencio, F.J., Klähn, S., 2018. The Distinctive Regulation of 521 Cyanobacterial Glutamine Synthetase. Life 8, 52. https://doi.org/10.3390/life8040052 522 Brown, J.R., Masuchi, Y., Robb, F.T., Doolittlel, W.F., 1994. Evolutionary relationships of bacterial and 523 archaeal glutamine synthetase genes. J. Mol. Evol. 38, 566–576. 524 https://doi.org/10.1007/BF00175876 525 Cohen-Kupiec, R., Marx, C.J., Leigh, J.A., 1999. Function and regulation of glnA in the methanogenic 526 archaeon Methanococcus maripaludis. J. Bacteriol. 181, 256–261. 527 https://doi.org/10.1128/JB.181.1.256-261.1999 528 Deuel, T.F., Ginsburg, A., Yeh, J., Shelton, E., Stadtman, E.R., 1970. Bacillus subtilis glutamine 529 synthetase. Purification and physical characterization. J. Biol. Chem. 245, 5195–5205. 530 Dos Santos Moreira, C.D., Ramos, M.J.R.N., Fernandes, P.M.A.A., 2019. Glutamine synthetase 531 structure‐catalysis relationship—Recent advances and applications. WIREs Comput. Mol. Sci. 9, 532 e1399. https://doi.org/10.1002/wcms.1399 533 Ehlers, C., Weidenbach, K., Veit, K., Forchhammer, K., Schmitz, R.A., 2005. Unique mechanistic 534 features of post-translational regulation of glutamine synthetase activity in Methanosarcina mazei 535 strain Gö1 in response to nitrogen availability: Regulation of glutamine synthetase activity in M. 536 mazei. Mol. Microbiol. 55, 1841–1854. https://doi.org/10.1111/j.1365-2958.2005.04511.x 537 Emsley, P., Lohkamp, B., Scott, W.G., Cowtan, K., 2010. Features and development of Coot. Acta 538 Crystallogr. D Biol. Crystallogr. 66, 486–501. https://doi.org/10.1107/S0907444910007493 539 Fedorova, K., Kayumov, A., Woyda, K., Ilinskaja, O., Forchhammer, K., 2013. Transcription factor TnrA 540 inhibits the biosynthetic activity of glutamine synthetase in Bacillus subtilis. FEBS Lett. 587, 1293–541 1298. https://doi.org/10.1016/j.febslet.2013.03.015 542 Fisher, S.H., 1999. Regulation of nitrogen metabolism in Bacillus subtilis: vive la différence! Mol. 543 Microbiol. 32, 223–232. https://doi.org/10.1046/j.1365-2958.1999.01333.x 544 Fisher, S.H., Wray, L.V., 2008. Bacillus subtilis glutamine synthetase regulates its own synthesis by 545 acting as a chaperone to stabilize GlnR-DNA complexes. Proc. Natl. Acad. Sci. U. S. A. 105, 1014–546 1019. https://doi.org/10.1073/pnas.0709949105 547 Forchhammer, K., 1999. The PII Protein in Synechococcus PCC 7942 Senses and Signals 2-548 Oxoglutarate Under ATP-Replete Conditions, in: Peschek, G.A., Löffelhardt, W., Schmetterer, G. 549 (Eds.), The Phototrophic Prokaryotes. Springer US, Boston, MA, pp. 549–553. 550 https://doi.org/10.1007/978-1-4615-4827-0_63 551 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint García-Domínguez, M., Reyes, J.C., Florencio, F.J., 1999. Glutamine synthetase inactivation by 552 protein–protein interaction. Proc. Natl. Acad. Sci. 96, 7161–7166. 553 https://doi.org/10.1073/pnas.96.13.7161 554 Gunka, K., Commichau, F.M., 2012. Control of glutamate homeostasis in Bacillus subtilis: a complex 555 interplay between ammonium assimilation, glutamate biosynthesis and degradation. Mol. Microbiol. 556 85, 213–224. https://doi.org/10.1111/j.1365-2958.2012.08105.x 557 Gutt, M., Jordan, B., Weidenbach, K., Gudzuhn, M., Kiessling, C., Cassidy, L., Helbig, A., Tholey, A., 558 Pyper, D.J., Kubatova, N., Schwalbe, H., Schmitz, R.A., 2021. High complexity of Glutamine synthetase 559 regulation in Methanosarcina mazei: Small protein 26 interacts and enhances glutamine synthetase 560 activity. FEBS J. n/a. https://doi.org/10.1111/febs.15799 561 Hanahan, D., 1983. Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166, 562 557–580. https://doi.org/10.1016/s0022-2836(83)80284-8 563 Hauf, K., Kayumov, A., Gloge, F., Forchhammer, K., 2016. The Molecular Basis of TnrA Control by 564 Glutamine Synthetase in Bacillus subtilis*. J. Biol. Chem. 291, 3483–3495. 565 https://doi.org/10.1074/jbc.M115.680991 566 He, Y.-X., Gui, L., Liu, Y.-Z., Du, Y., Zhou, Y., Li, P., Zhou, C.-Z., 2009. Crystal structure of 567 Saccharomyces cerevisiae glutamine synthetase Gln1 suggests a nanotube-like supramolecular 568 assembly. Proteins Struct. Funct. Bioinforma. 76, 249–254. https://doi.org/10.1002/prot.22403 569 Herrero, A., Muro-Pastor, A.M., Flores, E., 2001. Nitrogen Control in Cyanobacteria. J. Bacteriol. 183, 570 411–425. https://doi.org/10.1128/jb.183.2.411-425.2001 571 Ho, C.-M., Li, X., Lai, M., Terwilliger, T.C., Beck, J.R., Wohlschlegel, J., Goldberg, D.E., Fitzpatrick, 572 A.W.P., Zhou, Z.H., 2020. Bottom-up structural proteomics: cryoEM of protein complexes enriched 573 from the cellular milieu. Nat. Methods 17, 79–85. https://doi.org/10.1038/s41592-019-0637-y 574 Huang, P.-C., Chen, S.-K., Chiang, W.-H., Ho, M.-R., Wu, K.-P., 2022. Structural basis for the helical 575 filament formation of Escherichia coli glutamine synthetase. Protein Sci. 31, e4304. 576 https://doi.org/10.1002/pro.4304 577 Inoue, H., Nojima, H., Okayama, H., 1990. High efficiency transformation of Escherichia coli with 578 plasmids. Gene 96, 23–28. https://doi.org/10.1016/0378-1119(90)90336-p 579 Jäger, D., Sharma, C.M., Thomsen, J., Ehlers, C., Vogel, J., Schmitz, R.A., 2009. Deep sequencing 580 analysis of the Methanosarcina mazei Gö1 transcriptome in response to nitrogen availability. Proc. 581 Natl. Acad. Sci. 106, 21878–21882. https://doi.org/10.1073/pnas.0909051106 582 Jiang, P., Peliska, J.A., Ninfa, A.J., 1998. Reconstitution of the signal-transduction bicyclic cascade 583 responsible for the regulation of Ntr gene transcription in Escherichia coli. Biochemistry 37, 12795–584 12801. https://doi.org/10.1021/bi9802420 585 Joo, H.K., Park, Y.W., Jang, Y.Y., Lee, J.Y., 2018. Structural Analysis of Glutamine Synthetase from 586 Helicobacter pylori. Sci. Rep. 8, 11657. https://doi.org/10.1038/s41598-018-30191-5 587 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint Jumper, J., Evans, R., Pritzel, A., Green, T., Figurnov, M., Ronneberger, O., Tunyasuvunakool, K., 588 Bates, R., Žídek, A., Potapenko, A., Bridgland, A., Meyer, C., Kohl, S.A.A., Ballard, A.J., Cowie, A., 589 Romera-Paredes, B., Nikolov, S., Jain, R., Adler, J., Back, T., Petersen, S., Reiman, D., Clancy, E., 590 Zielinski, M., Steinegger, M., Pacholska, M., Berghammer, T., Bodenstein, S., Silver, D., Vinyals, O., 591 Senior, A.W., Kavukcuoglu, K., Kohli, P., Hassabis, D., 2021. Highly accurate protein structure 592 prediction with AlphaFold. Nature 596, 583–589. https://doi.org/10.1038/s41586-021-03819-2 593 Klähn, S., Bolay, P., Wright, P.R., Atilho, R.M., Brewer, K.I., Hagemann, M., Breaker, R.R., Hess, W.R., 594 2018. A glutamine riboswitch is a key element for the regulation of glutamine synthetase in 595 cyanobacteria. Nucleic Acids Res. https://doi.org/10.1093/nar/gky709 596 Klähn, S., Schaal, C., Georg, J., Baumgartner, D., Knippen, G., Hagemann, M., Muro-Pastor, A.M., 597 Hess, W.R., 2015. The sRNA NsiR4 is involved in nitrogen assimilation control in cyanobacteria by 598 targeting glutamine synthetase inactivating factor IF7. Proc. Natl. Acad. Sci. 112. 599 https://doi.org/10.1073/pnas.1508412112 600 Legrain, C., Vissers, S., Dubois, E., Legrain, M., Wiame, J.-M., 1982. Regulation of Glutamine 601 Synthetase from Saccharomyces cerevisiae by Repression, Inactivation and Proteolysis. Eur. J. 602 Biochem. 123, 611–616. https://doi.org/10.1111/j.1432-1033.1982.tb06576.x 603 Liaw, S.H., Pan, C., Eisenberg, D., 1993. Feedback inhibition of fully unadenylylated glutamine 604 synthetase from Salmonella typhimurium by glycine, alanine, and serine. Proc. Natl. Acad. Sci. U. S. A. 605 90, 4996–5000. https://doi.org/10.1073/pnas.90.11.4996 606 Lie, T.J., Dodsworth, J.A., Nickle, D.C., Leigh, J.A., 2007. Diverse homologues of the archaeal repressor 607 NrpR function similarly in nitrogen regulation. FEMS Microbiol. Lett. 271, 281–288. 608 https://doi.org/10.1111/j.1574-6968.2007.00726.x 609 Liebschner, D., Afonine, P.V., Baker, M.L., Bunkóczi, G., Chen, V.B., Croll, T.I., Hintze, B., Hung, L.-W., 610 Jain, S., McCoy, A.J., Moriarty, N.W., Oeffner, R.D., Poon, B.K., Prisant, M.G., Read, R.J., Richardson, 611 J.S., Richardson, D.C., Sammito, M.D., Sobolev, O.V., Stockwell, D.H., Terwilliger, T.C., Urzhumtsev, 612 A.G., Videau, L.L., Williams, C.J., Adams, P.D., 2019. Macromolecular structure determination using X-613 rays, neutrons and electrons: recent developments in Phenix. Acta Crystallogr. Sect. Struct. Biol. 75, 614 861–877. https://doi.org/10.1107/S2059798319011471 615 Magasanik, B., 1993. The regulation of nitrogen utilization in enteric bacteria. J. Cell. Biochem. 51, 616 34–40. https://doi.org/10.1002/jcb.240510108 617 Masalkar, P.D., Roberts, D.M., 2015. Glutamine synthetase isoforms in nitrogen-fixing soybean 618 nodules: distinct oligomeric structures and thiol-based regulation. FEBS Lett. 589, 215–221. 619 https://doi.org/10.1016/j.febslet.2014.11.048 620 McMullan, G., Naydenova, K., Mihaylov, D., Yamashita, K., Peet, M.J., Wilson, H., Dickerson, J.L., 621 Chen, S., Cannone, G., Lee, Y., Hutchings, K.A., Gittins, O., Sobhy, M.A., Wells, T., El-Gomati, M.M., 622 Dalby, J., Meffert, M., Schulze-Briese, C., Henderson, R., Russo, C.J., 2023. Structure determination by 623 cryoEM at 100 keV. Proc. Natl. Acad. Sci. 120, e2312905120. 624 https://doi.org/10.1073/pnas.2312905120 625 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint Müller, M.-C., Lemaire, O.N., Kurth, J.M., Welte, C.U., Wagner, T., 2024. Differences in regulation 626 mechanisms of glutamine synthetases from methanogenic archaea unveiled by structural 627 investigations. Commun. Biol. 7, 1–14. https://doi.org/10.1038/s42003-023-05726-w 628 Müller, M.-C., Lemaire, O.N., Kurth, J.M., Welte, C.U., Wagner, T., 2023. Differences in the regulation 629 mechanisms of the glutamine synthetase from methanogenic archaea unveiled by structural 630 investigations. https://doi.org/10.1101/2023.04.07.535877 631 Murray, D.S., Chinnam, N., Tonthat, N.K., Whitfill, T., Wray, L.V., Fisher, S.H., Schumacher, M.A., 632 2013. Structures of the Bacillus subtilis glutamine synthetase dodecamer reveal large intersubunit 633 catalytic conformational changes linked to a unique feedback inhibition mechanism. J. Biol. Chem. 634 288, 35801–35811. https://doi.org/10.1074/jbc.M113.519496 635 Nilsson, M.T., Krajewski, W.W., Yellagunda, S., Prabhumurthy, S., Chamarahally, G.N., Siddamadappa, 636 C., Srinivasa, B.R., Yahiaoui, S., Larhed, M., Karlén, A., Jones, T.A., Mowbray, S.L., 2009. Structural 637 basis for the inhibition of Mycobacterium tuberculosis glutamine synthetase by novel ATP-638 competitive inhibitors. J. Mol. Biol. 393, 504–513. https://doi.org/10.1016/j.jmb.2009.08.028 639 Pedro-Roig, L., Camacho, M., Bonete, M.-J., 2013. Regulation of ammonium assimilation in Haloferax 640 mediterranei: interaction between glutamine synthetase and two GlnK proteins. Biochim. Biophys. 641 Acta 1834, 16–23. https://doi.org/10.1016/j.bbapap.2012.10.006 642 Petrovska, I., Nüske, E., Munder, M.C., Kulasegaran, G., Malinovska, L., Kroschwald, S., Richter, D., 643 Fahmy, K., Gibson, K., Verbavatz, J.-M., Alberti, S., 2014. Filament formation by metabolic enzymes is 644 a specific adaptation to an advanced state of cellular starvation. eLife 3, e02409. 645 https://doi.org/10.7554/eLife.02409 646 Pettersen, E.F., Goddard, T.D., Huang, C.C., Meng, E.C., Couch, G.S., Croll, T.I., Morris, J.H., Ferrin, 647 T.E., 2021. UCSF ChimeraX: Structure visualization for researchers, educators, and developers. 648 Protein Sci. Publ. Protein Soc. 30, 70–82. https://doi.org/10.1002/pro.3943 649 Prasse, D., Schmitz, R.A., 2018. Small RNAs Involved in Regulation of Nitrogen Metabolism. Microbiol. 650 Spectr. 6. https://doi.org/10.1128/microbiolspec.RWR-0018-2018 651 Punjani, A., Rubinstein, J.L., Fleet, D.J., Brubaker, M.A., 2017. cryoSPARC: algorithms for rapid 652 unsupervised cryo-EM structure determination. Nat. Methods 14, 290–296. 653 https://doi.org/10.1038/nmeth.4169 654 Reitzer, L., 2003. Nitrogen Assimilation and Global Regulation in Escherichia coli. Annu. Rev. 655 Microbiol. 57, 155–176. https://doi.org/10.1146/annurev.micro.57.030502.090820 656 Schumacher, M.A., Salinas, R., Travis, B.A., Singh, R.R., Lent, N., 2023. M. mazei glutamine synthetase 657 and glutamine synthetase-GlnK1 structures reveal enzyme regulation by oligomer modulation. Nat. 658 Commun. 14, 7375. https://doi.org/10.1038/s41467-023-43243-w 659 Shapiro, B.M., Stadtman, E.R., 1970. [130] Glutamine synthetase (Escherichia coli), in: Methods in 660 Enzymology. Elsevier, pp. 910–922. https://doi.org/10.1016/0076-6879(71)17305-3 661 Stadtman, E.R., 2004. Regulation of Glutamine Synthetase Activity. EcoSal Plus 1, 662 10.1128/ecosalplus.3.6.1.6. https://doi.org/10.1128/ecosalplus.3.6.1.6 663 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint Stadtman, E.R., 2001. The story of glutamine synthetase regulation. J. Biol. Chem. 276, 44357–44364. 664 https://doi.org/10.1074/jbc.R100055200 665 Stadtman, E.R., 1990. [60] Discovery of glutamine synthetase cascade, in: Deutscher, M.P. (Ed.), 666

in Enzymology, Guide to Protein Purification. Academic Press, pp. 793–809. 667 https://doi.org/10.1016/0076-6879(90)82062-7 668 Travis, B.A., Peck, J.V., Salinas, R., Dopkins, B., Lent, N., Nguyen, V.D., Borgnia, M.J., Brennan, R.G., 669 Schumacher, M.A., 2022a. Molecular dissection of the glutamine synthetase-GlnR nitrogen 670 regulatory circuitry in Gram-positive bacteria. Nat. Commun. 13, 3793. 671 https://doi.org/10.1038/s41467-022-31573-0 672 Travis, B.A., Peck, J.V., Salinas, R., Dopkins, B., Lent, N., Nguyen, V.D., Borgnia, M.J., Brennan, R.G., 673 Schumacher, M.A., 2022b. Molecular dissection of the glutamine synthetase-GlnR nitrogen 674 regulatory circuitry in Gram-positive bacteria. Nat. Commun. 13, 3793. 675 https://doi.org/10.1038/s41467-022-31573-0 676 Valentine, R.C., Shapiro, B.M., Stadtman, E.R., 1968. Regulation of glutamine synthetase. XII. 677 Electron microscopy of the enzyme from Escherichia coli. Biochemistry 7, 2143–2152. 678 https://doi.org/10.1021/bi00846a017 679 van Heeswijk, W.C., Westerhoff, H.V., Boogerd, F.C., 2013. Nitrogen Assimilation in Escherichia coli: 680 Putting Molecular Data into a Systems Perspective. Microbiol. Mol. Biol. Rev. 77, 628–695. 681 https://doi.org/10.1128/mmbr.00025-13 682 van Rooyen, J.M., Abratt, V.R., Belrhali, H., Sewell, T., 2011. Crystal structure of Type III glutamine 683 synthetase: surprising reversal of the inter-ring interface. Struct. Lond. Engl. 1993 19, 471–483. 684 https://doi.org/10.1016/j.str.2011.02.001 685 Veit, K., Ehlers, C., Schmitz, R.A., 2005. Effects of nitrogen and carbon sources on transcription of 686 soluble methyltransferases in Methanosarcina mazei strain Go1. J. Bacteriol. 187, 6147–6154. 687 https://doi.org/10.1128/JB.187.17.6147-6154.2005 688 Weidenbach, K., Ehlers, C., Kock, J., Ehrenreich, A., Schmitz, R.A., 2008. Insights into the NrpR regulon 689 in Methanosarcina mazei Gö1. Arch. Microbiol. 190, 319–332. https://doi.org/10.1007/s00203-008-690 0369-3 691 Weidenbach, K., Ehlers, C., Kock, J., Schmitz, R.A., 2010. NrpRII mediates contacts between NrpRI and 692 general transcription factors in the archaeon Methanosarcina mazei Gö1. FEBS J. 277, 4398–4411. 693 https://doi.org/10.1111/j.1742-4658.2010.07821.x 694 Wisedchaisri, G., Dranow, D.M., Lie, T.J., Bonanno, J.B., Patskovsky, Y., Ozyurt, S.A., Sauder, J.M., 695 Almo, S.C., Wasserman, S.R., Burley, S.K., Leigh, J.A., Gonen, T., 2010. Structural Underpinnings of 696 Nitrogen Regulation by the Prototypical Nitrogen-Responsive Transcriptional Factor NrpR. Structure 697 18, 1512–1521. https://doi.org/10.1016/j.str.2010.08.014 698 Woolfolk, C.A., Stadtman, E.R., 1967. Regulation of glutamine synthetase: III. Cumulative feedback 699 inhibition of glutamine synthetase from Escherichia coli. Arch. Biochem. Biophys. 118, 736–755. 700 https://doi.org/10.1016/0003-9861(67)90412-2 701 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint Yamashita, M., Almassy, R., Janson, C., Cascio, D., Eisenberg, D., 1989. Refined atomic model of 702 glutamine synthetase at 3.5 Å resolution. J. Biol. Chem. 264, 17681–90. 703 https://doi.org/10.2210/pdb2gls/pdb 704 705 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint FIGURE LEGENDS 706 Figure 1 : GlnA1-dodecamer-assembly is induced by 2-OG without detectable oligomeric 707 intermediates. Oligomerisation states of purified strep-tagged GlnA1 were assessed in dependence of 708 2-OG by mass photometry as described in MM using a Refeyn twoMP mass photometer (Refeyn Ltd., 709 Oxford, UK). Mass spectra are shown with relative counts (number of counts in relation to the total 710 counts) plotted against the molecular weight . A: 75 nM GlnA 1 were preincubated in the presence of 711 varying 2-OG concentrations ( 0 to 25 mM) for ten min at room temperature and kept on ice until 712 measurement. The percentage of dodecamer considering the total number of counts was plotted 713 against the 2 -OG concentration . One out of two independent biological replicate s with each three 714 technical replicates is shown exemplarily. The molecular masses shown above the peaks correspond 715 to a Gaussian fit of the respective peak ( Gaussian fit not shown) and the K D is indicated in green. B: 716 Exemplary mass spectra of GlnA 1 oligomers in the presence of 0.1 and 12.5 mM 2 -OG. C: Mass 717 spectra of the three technical replicates (different green colors) of GlnA1-oligomers at 0.39, 0.78 and 718 1.56 mM 2 -OG, excluding the presence of intermediates. D: The specific activity of purified strep -719 tagged GlnA1 was determined as described in MM in the presence of varying 2 -OG concentrations (0, 720 1.25, 5 and 12.5 mM ). The standard deviation of four technical replicates is indicated for one out of 721 two biological replicates. 722 723 Figure 2: GlnA1-dodecamer-assembly and activity are not influenced by GlnK 1 under the conditions 724 tested. Purified strep-tagged GlnA1 and tag-less GlnK1 were incubated in the absence or presence of 725 2-OG in varying concentrations for ten min at RT. Oligomerisation states were assessed by mass 726 photometry. Mass spectra are shown with relative counts (see Fig. 1). A: The obtained ratio of GlnA 1 727 dodecamer/dimer of three technical replicates are shown for varying ratios between GlnA1 and GlnK1 728 (20:1, 2:1, 2:10, ratios relating to monomers) in the absence of 2-OG. B, C: Exemplary mass spectra of 729 GlnA1 incubated in the absence and presence of GlnK1 (2:1) at 2-OG concentrations of 0 mM (B) and 730 12.5 mM (C). The molecular masses shown above the peaks correspond to a Gaussian fit of the 731 respective peak (Gaussian fit not shown). D: 200 nM monomeric GlnA1 were preincubated with GlnK1 732 (in a 2:1 ratio) in the presence of varying 2-OG concentrations (0.19 to 12.5 mM) for ten min at RT. 733 The percentage of GlnA1 dodecamer considering the total number of counts was plotted aga inst the 734 2-OG concentration. One biological replicate with three technical replicates was performed. The ratio 735 of GlnA1 dodecamer/dimer was plotted against the 2 -OG concentration and the KD is indicated in 736 green (●, - GlnK1) and yellow (●, + GlnK1). E: The specific activity of purified strep -tagged GlnA1 in the 737 absence and presence of GlnK 1 (ratio 2:1) was determined as described in MM in the presence of 738 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint varying 2-OG concentrations (0, 0.78, 6.25 and 12.5 mM). The standard deviations of four technical 739 replicates of one biological replicate are indicated. 740 741 742 Figure 3: Structure of M. Mazei GlnA1 with 2-OG. A: Three-dimensional segmented cryo-EM density 743 of the dodecameric complex colored by subunits. B: Corresponding views of the GlnA1 atomic model 744 in cartoon representation. 745 746 Figure 4: Dimeric Interface and 2-OG binding site of dodecameric GlnA 1. A: Surface representation 747 of the M. mazei GlnA1 2-OG dodecamer with three GlnA 1 protomers fitted in cartoon representation 748 into the dodecamer as vertical (blue and ochre) and horizontal (blue and green) dimers. B: Horizontal 749 dimers and close -up of 2 -OG binding site. Important residues are shown as atomic stick 750 representation, primed labels indicate neighboring protomer. 2 -OG and water molecules important 751 for ligand binding fitted into density are shown in grey. Dotted lines represent polar interactions 752 between 2-OG, waters and residues. C Vertical dimers and close -up of dimerization s ite. C-terminal 753 helices H14/15 and H14’/ H15’ of two neighboring protomers lead to tight interaction, mediated by 754 hydrophobic and polar interactions. D: Top-view of GlnA 1 hexamer, 2-OG and substrate binding sites 755 are depicted for one horizontal dimer. 756 757 Figure 5 : Comparison of 2-OG and substrate binding site of 2- OG bound, apo and TS structures 758 (Schumacher et al., 2023) . Atomic mo dels in cartoon, important residues shown in stick 759 representation. Colors: blue/green, purple/ochre and red/yellow represent M. mazei GlnA1 2-OG, M. 760 mazei GlnA1 apo (PDB: 8tfb, Schumacher et al., 2023) and M. mazei GlnA1 Met-Sox-P·ADP (PDB: 8tfk, 761 Schumacher et al., 2023) transition state (GlnA 1 TS), respectively. A left: GlnA1 2-OG dimer in 762 superposition with GlnA 1 apo showing large scale movements upon 2-OG binding. A right: Close-up 763 of 2-OG binding site of GlnA 1 2-OG in superposition with GlnA 1 apo. Dramatic movement of Helix α3 764 (residue 167-181) and R87 loop show effect of 2 -OG binding. B: Close-up of substrate binding site of 765 GlnA1 2-OG in superposition with GlnA 1 apo and ADP ligand from GlnA 1 TS. Helix α3 movement upon 766 2-OG binding leads to a cascade of conformational changes of the phenylalanines F184, F202 and 767 F204 that lead to a priming of the active site for ATP binding. C: Close-up of substrate binding site of 768 GlnA1 2-OG in superposition with GlnA 1 TS shows high similarity between 2 -OG bound and transition 769 state structure. D: Close-up of substrate binding site of GlnA1 2-OG in superposition with GlnA 1 apo 770 and Met-Sox-P ligand f rom GlnA 1 TS. Large structural changes of the D50-loop with ejection of the 771 R66 key -residue shown. Flipping of the loop allows R319 and D57 to move in further and catalyze 772 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint phosphoryl-transfer and attack of NH 4 +, respectively. E: Close-up of the substrate binding site of 773 GlnA1 2-OG in in superposition with GlnA 1 TS reveals strong similarity between 2 -OG bound and 774 transition state structure in the active site. 775 776 Figure 6 : Feedback inhibition of GlnA 1 by glutamine . A: Specific activity of purified strep-tagged 777 GlnA1 (wt) and the respective R66A-mutant protein was determined as described in M aterials and 778

in the presence of 12.5 mM 2-OG and after additional supplementation of 5 mM glutamine. 779 For wt and the R66A -mutant one out of two biological independent replicates are exemplarily 780 shown, the deviation indicates the average of four technical replicates. B: Superposition GS 781 structures without glutamine of M. mazei (blue, green) and B. subtilis (orange, pink; PDB: 4lnn, 782 Murray et al., 2013): substrate binding-site including R’66 (R’62, respectively), which are responsible 783 for feedback inhibition. C: Exemplary mass spectra of Strep-GlnA1 with 12.5 mM 2 -OG in presence 784 and absence of 5 mM glutamine. The molecular masses shown above the peaks correspond to a 785 Gaussian fit of the respective peak (Gaussian fit not shown). 786 787 Figure 7: Model of the various molecular mechanisms of glutamine synthetase activity regulation. 788 Comparison of the regulation of glutamine synthetase activity in E. coli /Salmonella typhimurium, and 789 B. subtilis , Synechocystis and M. mazei. GS are in general active in a dodecameric, unmodified 790 complex under nitrogen limitation . Upon an ammonium upshift, GS are inactivated by feedback 791 inhibition (BcGS, E. coli), covalent modification (adenylylation, EcGS) or binding of (small) inactivating 792 proteins ( Synechocystis, BsGS). M. mazei GS on the contrary is regulated via the assembly of the 793 active dodecamer upon 2 -OG-binding and furthermore is strongly feedback inhibited by glutamine . 794 (Bolay et al., 2018; Klähn et al., 2018, 2015; Stadtman, 2001; Travis et al., 2022b) . Created with 795 BioRender.com 796 797 798 FIGURE LEGENDS SUPPLEMENT 799 Figure S1: Affinity-purified Strep-GlnA1 and size-exclusion-chromatography (SEC) of Strep-GlnA1 800 after purification. A: 1.5 µg (lane 1) and 3 µg (lane 2) Strep-GlnA1 on a coomassie-stained 12 % SDS-801 Gel. B: Elution profile of Strep-GlnA1 (black) and size standard (dashed line, molecular weights in 802 italics). Size exclusion chromatography was performed on a Superose™ 6 Increase 10/300 GL column 803 (Cytiva, Marlborough, USA) with a flow rate of 0.5 ml/min. 804 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint Figure S2: Sigmoidal fitted curves for mass photometry measurements of Strep-GlnA1 with varying 805 concentrations of 2-OG. The curves were fitted and KD-values calculated using RStudio (RStudio 806 Team (2020). RStudio: Integrated Development for R. RStudio, PBC, Boston, MA URL). A, B: Two 807 replicates for 2-OG titration, formation of dodecamer is shown in percent. C, D: 2-OG titration in the 808 absence (C) and presence of GlnK1 (D), formation of dodecamer is shown as a ratio of 809 dodecamer/dimer. 810 Figure S3: Cryo-EM Data processing workflow A: Representative motion-corrected micrograph 811 showing different orientations of the GlnA1 particles B: Cryo-EM processing tree used for obtaining 812 the high-resolution structure of GlnA1. The map obtained is coloured by resolution, where the global 813 resolution was estimated using GSFSC C: Different regions of GlnA1 encased around the cryo-EM 814 density. 815 Figure S4: Mass photometry of purified and thawed Strep-GlnA 1 before and after SEC. Mass spectra 816 of Strep -GlnA 1 samples with 0 and 12.5 mM after affinity -purification (blue ●, 0 mM and green ●, 817 12.5 mM 2-OG) and after SEC (0 mM 2-OG, grey ●). 818 819 Figure S5: Amino-acid sequence alignment of different model organism glutamine synthetases. 820 (Alignment tool: COBALT, visualization in SnapGene) Conserved amino -acids are highlighted in green. 821 The relevant residues in M. mazei for 2 -OG- and substrate -binding, as well as the arginine 822 responsible for the feedback inhibition by glutamine are highlighted by coloured boxes (blue ●, 823 orange ● and purple ●, respectively). 824 825 Figure S6: M. mazei GlnA1 filaments. A: Representative motion-corrected micrograph showing GlnA 1 826 filaments B: Reference-free 2D classes showcasing filament orientations C, D: 3D reconstructed map 827 of GlnA1 filament and its model. 828 829 830 831 832 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint SUPPLEMENTARY TABLES 833 Table S1: Strains and plasmids. 834 Properties Reference Strains E. coli DH5α General cloning strain (Hanahan, 1983) E. coli BL21 (DE3) Strain for protein expression Thermo Fisher Scientific, Waltham, USA E. coli BL21 (DE3) + pRIL Strain for protein expression of genes with unusual codons/ CmR Stratagene, La Jolla, USA Plasmids pET21a General cloning vector providing a C- terminal His6-tag Novagen/Merck, Darmstadt, Germany pETSUMO Expression vector providing an N - terminal His6-SUMO-tag Thermo Fisher Scientific, Waltham, USA pRS375 pET28a/Strep + GlnA1 (Gutt et al., 2021) pRS1672 pETSUMO + GlnK1 This work pRS1728 pEX-A258 + codon -optimized GlnA 1 and sP26 Eurofins Scientific, Ebersberg, Germany pRS1841 pRS375 + codon-optimized GlnA1 This work pRS1863 pET21a + codon-optimized sP26 This work pRS1951 pRS1840mut: R66AGlnA1 This work 835 836 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint 837 838 839 Table S2: Cryo-EM data collection, refinement and validation statistics 840 841 Dodecamer Gln complex (EMDB- 19730) (PDB 8S59) Data collection and processing Magnification 165,000 x Voltage (kV) 300 Electron exposure (e–/Å2) 55.0 Defocus range (μm) 0.25-2.0 Pixel size (Å) 0.72 Symmetry imposed D6 Initial particle images (no.) 1,243,001 Final particle images (no.) 878,308 Map resolution (Å) FSC threshold 2.39 0.143 Map resolution range (Å) 2.3-3.0 Refinement Initial model used (PDB code) de novo, AlphaFold Model resolution (Å) FSC threshold 2.5 0.5 Model resolution range (Å) 2.2-2.5 Map sharpening B factor (Å2) -80.1 Model composition Non-hydrogen atoms Protein residues Ligands 46968 5352 AKG: 12 B factors (Å2) Protein Ligand 16.58 15.64 R.m.s. deviations Bond lengths (Å) Bond angles (°) 0.003 0.602 Validation MolProbity score Clashscore Poor rotamers (%) 1.29 5.32 0.46 Ramachandran plot Favored (%) Allowed (%) Disallowed (%) 98.22 1.56 0.23 842 843 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint 0 100 0.01 0.1 1 10 100 Dodecamer [%] 2-OG [mM] -1 0 1 2 3 4 5 6 0 1.25 5 12.5 Specific Activity [U/mg] 2-OG [mM] Figure 1 A B C D 0.39 mM 2-OG 0 .78 mM 2-OG 1.56 mM 2-OG Mono-/Dimer D odecamer Mass [kDa] Relative Counts Mono-/Dimer Dodecamer Mono-/Dimer Dodecamer .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint 0 0.5 1 1.5 2 2.5 3 3.5 0.1 1 10 Dodecamer/Dimer 2-OG [mM] - GlnK1 + GlnK1 -1 0 1 2 3 4 5 6 7 8 0 0.78 6.25 12.5 Specific Activity [U/mg] 2-OG [mM] - GlnK1 + GlnK1 0 mM 2-OG G lnA1 : GlnK1 (2:1) 12.5 mM 2-OG GlnA1 : GlnK1 (2:1) A B C E F igure 2: GlnA1 : GlnK1 (2:1) D 0 mM 2-OG 0 0.5 1 1.5 2 2.5 3 3.5Dodecamer/Dimer 20:1 2:1 2:10 Ratio GlnA1:GlnK1 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint Figure 3 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint 2OG ADP + Met-Sox-P D F igure 4 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint Figure 5 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint Figure 6: A C 0 5 10 0 mM 5 mM Specific Activity [U/mg] WT R66A 12.5 mM 2-OG 12.5 mM 2-OG glutamine B .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint Figure 7: .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted March 19, 2024. ; https://doi.org/10.1101/2024.03.18.585516doi: bioRxiv preprint